ID: 1092447112

View in Genome Browser
Species Human (GRCh38)
Location 12:8568052-8568074
Sequence CAGCTGCCAGTCCCACAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092447112_1092447128 27 Left 1092447112 12:8568052-8568074 CCAGTCTGTGGGACTGGCAGCTG No data
Right 1092447128 12:8568102-8568124 CCTGAAGGAGAGGCCTTACTGGG No data
1092447112_1092447122 12 Left 1092447112 12:8568052-8568074 CCAGTCTGTGGGACTGGCAGCTG No data
Right 1092447122 12:8568087-8568109 TCAAGGCTTCCCTGGCCTGAAGG No data
1092447112_1092447126 26 Left 1092447112 12:8568052-8568074 CCAGTCTGTGGGACTGGCAGCTG No data
Right 1092447126 12:8568101-8568123 GCCTGAAGGAGAGGCCTTACTGG No data
1092447112_1092447115 -5 Left 1092447112 12:8568052-8568074 CCAGTCTGTGGGACTGGCAGCTG No data
Right 1092447115 12:8568070-8568092 AGCTGGGCCCCCAGCCTTCAAGG No data
1092447112_1092447129 28 Left 1092447112 12:8568052-8568074 CCAGTCTGTGGGACTGGCAGCTG No data
Right 1092447129 12:8568103-8568125 CTGAAGGAGAGGCCTTACTGGGG No data
1092447112_1092447119 4 Left 1092447112 12:8568052-8568074 CCAGTCTGTGGGACTGGCAGCTG No data
Right 1092447119 12:8568079-8568101 CCCAGCCTTCAAGGCTTCCCTGG No data
1092447112_1092447123 17 Left 1092447112 12:8568052-8568074 CCAGTCTGTGGGACTGGCAGCTG No data
Right 1092447123 12:8568092-8568114 GCTTCCCTGGCCTGAAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092447112 Original CRISPR CAGCTGCCAGTCCCACAGAC TGG (reversed) Intergenic
No off target data available for this crispr