ID: 1092449673

View in Genome Browser
Species Human (GRCh38)
Location 12:8590312-8590334
Sequence ATGCTCTGATGAGCTCTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092449673_1092449677 11 Left 1092449673 12:8590312-8590334 CCTAGCAGAGCTCATCAGAGCAT No data
Right 1092449677 12:8590346-8590368 AAATAAGCCAAAAGTGTCCTGGG No data
1092449673_1092449678 12 Left 1092449673 12:8590312-8590334 CCTAGCAGAGCTCATCAGAGCAT No data
Right 1092449678 12:8590347-8590369 AATAAGCCAAAAGTGTCCTGGGG No data
1092449673_1092449680 18 Left 1092449673 12:8590312-8590334 CCTAGCAGAGCTCATCAGAGCAT No data
Right 1092449680 12:8590353-8590375 CCAAAAGTGTCCTGGGGTGATGG No data
1092449673_1092449676 10 Left 1092449673 12:8590312-8590334 CCTAGCAGAGCTCATCAGAGCAT No data
Right 1092449676 12:8590345-8590367 GAAATAAGCCAAAAGTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092449673 Original CRISPR ATGCTCTGATGAGCTCTGCT AGG (reversed) Intergenic
No off target data available for this crispr