ID: 1092449676

View in Genome Browser
Species Human (GRCh38)
Location 12:8590345-8590367
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092449673_1092449676 10 Left 1092449673 12:8590312-8590334 CCTAGCAGAGCTCATCAGAGCAT No data
Right 1092449676 12:8590345-8590367 GAAATAAGCCAAAAGTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092449676 Original CRISPR GAAATAAGCCAAAAGTGTCC TGG Intergenic
No off target data available for this crispr