ID: 1092449680

View in Genome Browser
Species Human (GRCh38)
Location 12:8590353-8590375
Sequence CCAAAAGTGTCCTGGGGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092449673_1092449680 18 Left 1092449673 12:8590312-8590334 CCTAGCAGAGCTCATCAGAGCAT No data
Right 1092449680 12:8590353-8590375 CCAAAAGTGTCCTGGGGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092449680 Original CRISPR CCAAAAGTGTCCTGGGGTGA TGG Intergenic
No off target data available for this crispr