ID: 1092449786

View in Genome Browser
Species Human (GRCh38)
Location 12:8591380-8591402
Sequence ACTTACAAAACATTTTGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092449786_1092449789 -7 Left 1092449786 12:8591380-8591402 CCCTCACAAAATGTTTTGTAAGT No data
Right 1092449789 12:8591396-8591418 TGTAAGTCATTGTTGGACCACGG No data
1092449786_1092449790 9 Left 1092449786 12:8591380-8591402 CCCTCACAAAATGTTTTGTAAGT No data
Right 1092449790 12:8591412-8591434 ACCACGGACTTGAGCGCTCGAGG No data
1092449786_1092449792 23 Left 1092449786 12:8591380-8591402 CCCTCACAAAATGTTTTGTAAGT No data
Right 1092449792 12:8591426-8591448 CGCTCGAGGCCATCCTATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092449786 Original CRISPR ACTTACAAAACATTTTGTGA GGG (reversed) Intergenic
No off target data available for this crispr