ID: 1092449790

View in Genome Browser
Species Human (GRCh38)
Location 12:8591412-8591434
Sequence ACCACGGACTTGAGCGCTCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092449787_1092449790 8 Left 1092449787 12:8591381-8591403 CCTCACAAAATGTTTTGTAAGTC No data
Right 1092449790 12:8591412-8591434 ACCACGGACTTGAGCGCTCGAGG No data
1092449785_1092449790 25 Left 1092449785 12:8591364-8591386 CCTACAGATTGCTCAACCCTCAC No data
Right 1092449790 12:8591412-8591434 ACCACGGACTTGAGCGCTCGAGG No data
1092449786_1092449790 9 Left 1092449786 12:8591380-8591402 CCCTCACAAAATGTTTTGTAAGT No data
Right 1092449790 12:8591412-8591434 ACCACGGACTTGAGCGCTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092449790 Original CRISPR ACCACGGACTTGAGCGCTCG AGG Intergenic
No off target data available for this crispr