ID: 1092451506

View in Genome Browser
Species Human (GRCh38)
Location 12:8606645-8606667
Sequence TAGGGTGCCCAGCATTACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 315}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092451506 Original CRISPR TAGGGTGCCCAGCATTACTG GGG Intronic
901517639 1:9759905-9759927 TAGGTTGCCCAGCTTTAATTTGG + Intronic
901716741 1:11161237-11161259 AGGGGTGCCCACCATTGCTGAGG + Intronic
902463021 1:16593469-16593491 TGGGCTGCCCAGCATTCATGTGG + Exonic
903158497 1:21467258-21467280 TGGGCTGCCCAGCATTCATGTGG - Intronic
904898457 1:33836551-33836573 AGGGGTGCCCACCATTGCTGAGG - Intronic
906008609 1:42502145-42502167 AGGGGTGCCCACCATTGCTGAGG - Intronic
907994026 1:59610965-59610987 AGGGGTGCCCACCATTGCTGAGG + Intronic
910331009 1:86072326-86072348 AGGGGTGTCCACCATTACTGAGG + Intronic
910339344 1:86168031-86168053 AGGGGTGCCCACCATTGCTGAGG - Intergenic
910785923 1:90997999-90998021 AGGGGTGCCCACCATTGCTGAGG + Intronic
911284608 1:95974772-95974794 AGGGGTGACCACCATTACTGTGG - Intergenic
912715201 1:111978613-111978635 TGGGCTGCCCTGCAGTACTGTGG - Intronic
913640056 1:120804115-120804137 TGGGCTGCCCAGCATTCATGTGG - Intergenic
913710433 1:121477563-121477585 AGGGGTGCCCACCATTGCTGAGG + Intergenic
913991120 1:143612867-143612889 TGGGCTGCCCAGCATTCATGTGG + Intergenic
914208705 1:145558987-145559009 AGGGGTGCCCACCATTGCTGAGG - Intergenic
914278423 1:146146223-146146245 TGGGCTGCCCAGCATTCATGTGG + Intronic
914539470 1:148597171-148597193 TGGGCTGCCCAGCATTCATGTGG + Intronic
914627211 1:149474457-149474479 TGGGCTGCCCAGCATTCATGTGG - Intergenic
914940321 1:152017166-152017188 TGGGCTGCCCAGCATTCATGTGG - Intergenic
915088857 1:153407420-153407442 CAGGGTGCCCGCCATTTCTGAGG + Intergenic
916406287 1:164500795-164500817 AGGGGTGTCCACCATTACTGAGG + Intergenic
916916103 1:169408235-169408257 AGGGGTGTCCACCATTACTGAGG + Intronic
917903986 1:179571764-179571786 TGGGGTGTCCACCATTGCTGAGG - Intronic
918163368 1:181921051-181921073 TGGGGTGCCCACCATTACTGAGG + Intergenic
919241452 1:194921861-194921883 CAGTGTCCCCAGCTTTACTGGGG - Intergenic
919599002 1:199599783-199599805 AAGGGCGTCCACCATTACTGAGG + Intergenic
919601902 1:199633159-199633181 AGGGGTGTCCACCATTACTGAGG + Intergenic
919937933 1:202267097-202267119 AAGTGTGGCCAGCATGACTGAGG - Intronic
920562284 1:206947317-206947339 TAGGATGGGCAGCATTTCTGTGG - Intergenic
922186397 1:223278517-223278539 AGGGGTGCCCACCATTGCTGAGG + Intronic
922969152 1:229719668-229719690 TATGTTGCCCAGTATTTCTGAGG + Intergenic
1064257825 10:13759337-13759359 TAGGGGGCCATGAATTACTGTGG + Intronic
1065120988 10:22530299-22530321 AGGGGTGTCCAACATTACTGAGG - Intergenic
1066785144 10:38995299-38995321 ATGGGTGCCCACCATTGCTGAGG - Intergenic
1069199292 10:65592788-65592810 TGGGGTGCCCGCCATTGCTGAGG - Intergenic
1075651760 10:124132022-124132044 TAGGATGCCTAGCATCTCTGGGG - Intergenic
1076242347 10:128917784-128917806 GAGGGTGCCCAGGAGTGCTGGGG + Intergenic
1078812096 11:14778118-14778140 AGGGGTGCCCACCATTGCTGAGG + Intronic
1079842058 11:25415438-25415460 TGAGGTGCCCAACATTTCTGAGG + Intergenic
1079867914 11:25758609-25758631 AAGGGTGTCCGCCATTACTGAGG + Intergenic
1080012415 11:27472288-27472310 TAGCGGGCCCGGCATTGCTGCGG + Exonic
1080150917 11:29051169-29051191 AGGGGTGCCCACCATTGCTGAGG + Intergenic
1080274883 11:30492785-30492807 CAGGGTGTACAGCATGACTGAGG - Intronic
1080490884 11:32763050-32763072 AAGGGCGCCCACCATTGCTGAGG + Intronic
1080977160 11:37356888-37356910 AGGGGCGCCCACCATTACTGAGG + Intergenic
1081087665 11:38821951-38821973 AGGGGTGCCCGCCATTACTGAGG - Intergenic
1081324591 11:41728987-41729009 AGGGGTGCCCACCATTGCTGAGG - Intergenic
1081429960 11:42966046-42966068 TATGGTGCCCAGCATCAGTGGGG - Intergenic
1082136483 11:48555081-48555103 AGGGGTGCCCACCATTGCTGAGG - Intergenic
1082613825 11:55334976-55334998 AGGGGTGCCCACCATTGCTGAGG - Intergenic
1083433902 11:62629857-62629879 AAGGATGCCCAGCATTATGGGGG - Exonic
1083510227 11:63202469-63202491 AAGGGTGTCCAACATTACTGAGG + Intronic
1087541647 11:99529183-99529205 GATGGTGCCCACCATCACTGAGG + Intronic
1087596128 11:100257103-100257125 AGGGGTGTCCACCATTACTGAGG + Intronic
1088243599 11:107795230-107795252 TTGGTTGCCCAGCATTGCTTTGG - Intronic
1090199676 11:124845407-124845429 GATGGTGCAAAGCATTACTGAGG - Intergenic
1092163370 12:6328193-6328215 GAGGGTGACCAGCACTACTGGGG - Exonic
1092451506 12:8606645-8606667 TAGGGTGCCCAGCATTACTGGGG + Intronic
1092703256 12:11256662-11256684 AAAGGTGCCCACCATTACTGAGG + Intergenic
1093333216 12:17868719-17868741 AAGGGCGTCCACCATTACTGAGG + Intergenic
1094432089 12:30380471-30380493 AAGGGTGGCCACCATCACTGTGG - Intergenic
1094528122 12:31246492-31246514 TAGCGGGCCCAGCACTTCTGTGG + Intergenic
1094826934 12:34276596-34276618 TAGGATGCCCCGAATGACTGTGG + Intergenic
1095119931 12:38405185-38405207 AGGGGTGTCCACCATTACTGAGG - Intergenic
1095231596 12:39746379-39746401 AGGGGTGCCCACCATTGCTGAGG + Intronic
1095306308 12:40642894-40642916 AGGGGTGCCCACCATTGCTGGGG - Intergenic
1095456654 12:42392816-42392838 TAAGGTACCAAGCATTATTGTGG + Intronic
1095832334 12:46601408-46601430 AGGGGTGTCCACCATTACTGAGG - Intergenic
1095854829 12:46849007-46849029 AGGGGCGCCCAGCATTGCTGAGG + Intergenic
1098764541 12:74469354-74469376 AGGGGTGACCACCATTACTGTGG - Intergenic
1098844886 12:75523122-75523144 AGGGGTGCCCACCATTGCTGAGG - Intergenic
1099238921 12:80115874-80115896 AGGGGTGTCCACCATTACTGAGG - Intergenic
1099798001 12:87422481-87422503 CGGGGTGTCCACCATTACTGAGG - Intergenic
1100798004 12:98202302-98202324 AGGGGTGTCCACCATTACTGAGG + Intergenic
1102481817 12:113229000-113229022 TGGGGTGTCCAGCTTTCCTGTGG + Intronic
1102913529 12:116736983-116737005 TGGGGTTCCCAGTATTACAGTGG - Intronic
1106326333 13:28693873-28693895 TGGGGTGTCCACCATTGCTGAGG - Intergenic
1106983854 13:35321920-35321942 AGGGGTGTCCACCATTACTGAGG - Intronic
1107090490 13:36473974-36473996 AGGGGTGCCCACCATTGCTGAGG - Intergenic
1108262792 13:48675464-48675486 AGGGGTGTCCACCATTACTGAGG - Intronic
1110209486 13:72954638-72954660 TGGGCTGCCCAGCTTTGCTGTGG + Intronic
1110389716 13:74959774-74959796 AAGGGTGTCCACCATTACTGAGG + Intergenic
1110942041 13:81362864-81362886 GAGGGTGTCCACCATTGCTGAGG + Intergenic
1113995002 14:16057663-16057685 TGGGGTGCCCAGCTGTTCTGTGG + Intergenic
1114695477 14:24623538-24623560 AGGGGTGTCCACCATTACTGAGG - Intergenic
1114710076 14:24768770-24768792 AGGGGTGTCCACCATTACTGAGG + Intergenic
1115106184 14:29764151-29764173 AAGGGTCCCAAGCATTACTTTGG + Intronic
1117850065 14:59958448-59958470 AGGGGTGTCCACCATTACTGAGG - Intronic
1120065773 14:80039223-80039245 AGGGGTGCCCACCATTGCTGAGG + Intergenic
1120271770 14:82321913-82321935 AAGGGTGTCTACCATTACTGAGG - Intergenic
1121214001 14:92233128-92233150 AGGGGTGCCCACCATTGCTGAGG - Intergenic
1123408252 15:20037620-20037642 AGGGGTGCCCATCATTGCTGAGG - Intergenic
1123517575 15:21044271-21044293 AGGGGTGCCCATCATTGCTGAGG - Intergenic
1123830424 15:24130386-24130408 TAGCCTGCCCAGCATCACTGGGG + Intergenic
1123841285 15:24249843-24249865 TAGCCTGCCCAGCATCACTGGGG + Intergenic
1123850677 15:24352992-24353014 TAGCCTGCCCAGCATCACTGGGG + Intergenic
1123855551 15:24407227-24407249 TAGCCTGCCCAGCATCACTGGGG + Intergenic
1123860452 15:24460798-24460820 TAGCCTGCCCAGCATCACTGGGG + Intergenic
1123864082 15:24499417-24499439 TAGCCTGCCCAGCATCACTGGGG + Intergenic
1124145495 15:27121577-27121599 AGGGGTGCACAGCATCACTGTGG - Intronic
1124483057 15:30092990-30093012 TAGGGTGTGCAACATTTCTGTGG + Intronic
1127057155 15:55143618-55143640 GAGGGCGCCCACCATTGCTGAGG + Intergenic
1128857510 15:71031817-71031839 AGGGGTGTCCACCATTACTGAGG - Intronic
1129824385 15:78625131-78625153 TACGCTGCCCAGCGTGACTGAGG - Exonic
1131708160 15:95021047-95021069 CAGTGTGCCCAGCATTTCAGGGG - Intergenic
1132815181 16:1822432-1822454 TAGGGTGCCCAGCAGAACCCAGG + Intronic
1132849749 16:2019706-2019728 TGGGGAGCCCAGCGGTACTGAGG + Exonic
1133916279 16:10112521-10112543 CAGGGAGCCCATCATCACTGTGG - Intronic
1137061313 16:35793697-35793719 GAGGGTGTCCAGGAATACTGTGG + Intergenic
1137485974 16:48891308-48891330 CTGGGTGCCCCTCATTACTGGGG + Intergenic
1137969984 16:52975391-52975413 AGGGGTGCCCGCCATTACTGAGG - Intergenic
1138151553 16:54661979-54662001 AGGGGTGTCCACCATTACTGAGG + Intergenic
1138249570 16:55491681-55491703 CAGGGTTCTCAGCCTTACTGTGG + Intronic
1138357157 16:56391673-56391695 AGGGGTGCCCACCATTGCTGAGG + Intronic
1139248256 16:65469676-65469698 AAGGCTGCCCAGCATTTCTAGGG - Intergenic
1143257591 17:5573269-5573291 AGGGGTGCCCACCATTGCTGAGG + Intronic
1144494253 17:15736763-15736785 TGGGCTGCCCAGCACTGCTGGGG - Intronic
1144906010 17:18639913-18639935 TGGGCTGCCCAGCACTGCTGGGG + Intronic
1145366120 17:22268242-22268264 AAGGGTGCCCAGCAGTGCTGTGG - Intergenic
1145915787 17:28573323-28573345 TAGGGAGCCCCTCATGACTGAGG - Exonic
1146825930 17:36023361-36023383 AGGGGTGCCCACCATTACTGAGG - Intergenic
1151323343 17:73364548-73364570 TAGGGTTCTCAGCTTTACTGTGG - Intronic
1152931857 17:83114018-83114040 ATGGGTGCCCAGCATGTCTGTGG - Intergenic
1154397689 18:14006496-14006518 AGGGGTGCCCACCATTGCTGAGG - Intergenic
1157479490 18:48044395-48044417 TTGGGTGCCCACCACTACAGTGG - Intronic
1157920126 18:51706286-51706308 AGGGGTGCCCACCATTGCTGAGG - Intergenic
1158100185 18:53821338-53821360 AGGGGTGCCCAGTATTGCTGAGG + Intergenic
1158399031 18:57104300-57104322 AGGGGTGTCCACCATTACTGAGG - Intergenic
1159679278 18:71326980-71327002 TAGGTTTCCCAGCCTTCCTGTGG + Intergenic
1163380252 19:16961462-16961484 AGGGGTGCCCACCATTGCTGAGG + Intronic
1165254589 19:34568039-34568061 AGGGGTGTCCACCATTACTGAGG - Intergenic
1168554952 19:57330322-57330344 TAAGATTCCCAGGATTACTGTGG - Exonic
1202678682 1_KI270711v1_random:30901-30923 TGGGCTGCCCAGCATTCATGTGG + Intergenic
925252447 2:2451516-2451538 AAGGGTGTCCGCCATTACTGAGG - Intergenic
925566370 2:5258515-5258537 AGGGGTGTCCACCATTACTGAGG - Intergenic
925977657 2:9152273-9152295 TAGGGTGAGGAGCATTGCTGCGG - Intergenic
926402184 2:12508875-12508897 TAGGGTGCGCAGGTTTACAGAGG + Intergenic
927935152 2:27072011-27072033 AAGGGTGGGCAGCAGTACTGAGG - Intergenic
930310650 2:49735362-49735384 TAGGGTGCCCAGGTTTGCTCAGG + Intergenic
930516931 2:52420155-52420177 AGGGGTGCCCACCATTGCTGAGG + Intergenic
931212084 2:60207155-60207177 TTGGGAGTCCACCATTACTGAGG - Intergenic
933413197 2:81951028-81951050 AGGGGTGTCCACCATTACTGAGG - Intergenic
933631328 2:84662555-84662577 AGGGGTGCCCACCATTGCTGAGG + Intronic
935450251 2:103200994-103201016 AGGGGTGCCCACCATTGCTGAGG + Intergenic
937807287 2:126161089-126161111 AAGGGTGTCCACCATTACTGAGG + Intergenic
937957380 2:127428923-127428945 TAAGGTGCCCAGCTCTTCTGGGG - Exonic
938952314 2:136266576-136266598 AGGGGTGTCCACCATTACTGAGG - Intergenic
939687142 2:145213647-145213669 AAGGGGGTCCACCATTACTGGGG - Intergenic
939840618 2:147182825-147182847 AAGGGTGTTCACCATTACTGAGG + Intergenic
941550831 2:166913293-166913315 GGGGGTGCCCACCATTGCTGAGG - Intronic
942407228 2:175668639-175668661 AGGGGTGTCCACCATTACTGAGG + Intergenic
943147684 2:184065981-184066003 AAGGGTGTCCACTATTACTGAGG - Intergenic
943369746 2:187002252-187002274 CAGGGAGCCCATCATCACTGTGG + Intergenic
943660489 2:190554472-190554494 AAGGGTGTCCACCATTGCTGAGG + Intergenic
943929966 2:193836556-193836578 AGGGGTGCCCATCATTGCTGAGG - Intergenic
944581739 2:201137894-201137916 CAGGGAGCCCATCATCACTGTGG + Intronic
947275823 2:228390939-228390961 AGGGGTGTCCACCATTACTGAGG - Intergenic
947311568 2:228809160-228809182 AGGGGTGACCACCATTACTGTGG - Intergenic
947746821 2:232512205-232512227 TGGGCTGCCCAGCAGTTCTGGGG - Intergenic
1168851895 20:982753-982775 TGACGTGCCCAGCAATACTGGGG + Intronic
1169388378 20:5169930-5169952 AAGGGTGCCCAGCTTGTCTGGGG + Intronic
1172150255 20:32785460-32785482 TAGGGAGTCCACCATTTCTGTGG + Intronic
1174990137 20:55500377-55500399 AGGGGTGTCCACCATTACTGAGG - Intergenic
1177388075 21:20433142-20433164 AGGGGTGGCCATCATTACTGTGG + Intergenic
1177694580 21:24555152-24555174 AAGGGCGTCCACCATTACTGAGG + Intergenic
1177722973 21:24931072-24931094 TTGGGTGCCCAGAATCACTAAGG + Intergenic
1180154153 21:45970091-45970113 GAGGGCCCCCAGCACTACTGTGG + Intergenic
1180312090 22:11249746-11249768 TGGGGTGCCCAGCTGTTCTGTGG - Intergenic
1184384611 22:44167102-44167124 CAGGATGCCCATCATTGCTGGGG - Intronic
1185013188 22:48327903-48327925 TGGGGTGAGCAGCCTTACTGGGG - Intergenic
949583371 3:5412837-5412859 AGGGGTGTCCACCATTACTGAGG + Intergenic
951415124 3:22414366-22414388 AAGGGCGTCCACCATTACTGAGG - Intergenic
955347278 3:58170463-58170485 TAGGGGCCCCAGCATTATCGTGG + Intronic
955906560 3:63813863-63813885 TGGGGTGGCCAGAATTAGTGAGG + Intergenic
956383060 3:68686279-68686301 AGGGGTGTCCACCATTACTGAGG - Intergenic
957249671 3:77757061-77757083 AGGGGTGTCCACCATTACTGAGG + Intergenic
957474850 3:80709747-80709769 AGGGGTGTCCACCATTACTGAGG + Intergenic
957695723 3:83636030-83636052 AGGGGTGTCCACCATTACTGAGG + Intergenic
959291895 3:104485265-104485287 AGGGGTGTCCACCATTACTGAGG + Intergenic
959534615 3:107470678-107470700 CAGGGCGTCCACCATTACTGAGG + Intergenic
960177290 3:114532304-114532326 AGGGGTGTCCACCATTACTGAGG + Intronic
961760306 3:129162206-129162228 TAGGGTGCCCATCACTAGTTAGG - Intergenic
962251184 3:133836999-133837021 AAGGGTTCCCAGCAATGCTGGGG + Intronic
962699230 3:137980283-137980305 AGGGGTGCCCACCATTGCTGAGG + Intergenic
963281742 3:143390903-143390925 AGGGGTGCCCACCATTGCTGAGG + Intronic
964696270 3:159511156-159511178 AGGGGTGCCCACCATTGCTGAGG - Intronic
965103172 3:164328909-164328931 TAGGGTCCACAGTTTTACTGGGG + Intergenic
965828122 3:172751060-172751082 GAAGATGCCCAGCAATACTGGGG - Intronic
965886832 3:173456402-173456424 TAACTTGCCCAGCATTACTCAGG - Intronic
967356675 3:188579669-188579691 CACGGTGCCCAGCCTCACTGGGG - Intronic
968812495 4:2806266-2806288 TAGGGTGCCCAGGCTGGCTGCGG + Intronic
969292852 4:6251882-6251904 TAAGGTGCCCAGCATTCCAGAGG + Intergenic
970727136 4:19060173-19060195 TTGGGTGCCTACCATGACTGGGG + Intergenic
970975722 4:22040883-22040905 AAGGGTGTCCGTCATTACTGAGG - Intergenic
971586082 4:28407235-28407257 AGGGGTGCCCACCATTGCTGAGG + Intergenic
972372450 4:38438036-38438058 AGGGGTGTCCACCATTACTGAGG - Intergenic
973682996 4:53340413-53340435 AGGGGTGCCCACCATTGCTGAGG + Intronic
973858948 4:55041729-55041751 AGGGGTGCCCACCATTGCTGAGG + Intergenic
974302064 4:60081600-60081622 AGGGGTGTCCACCATTACTGAGG + Intergenic
974547687 4:63334038-63334060 AAGGGCGTCCACCATTACTGAGG + Intergenic
975305170 4:72841213-72841235 AGGGGTGCCCACCATTGCTGAGG - Intergenic
976445972 4:85129939-85129961 AGGGGTGCCTACCATTACTGAGG - Intergenic
977218833 4:94314827-94314849 AGGGGTGCCCACCATTGCTGAGG - Intronic
978186317 4:105860559-105860581 AGGGGTGCCCACCATTGCTGAGG + Intronic
978773306 4:112480259-112480281 AGGGGTGCCCACCATTGCTGAGG - Intergenic
979965970 4:127077162-127077184 AGGGGTGTCCACCATTACTGAGG - Intergenic
980136455 4:128863010-128863032 TAGCGTGCTGAGCATGACTGGGG - Intronic
980413736 4:132458236-132458258 AGGGGTGCCCACCATTGCTGAGG + Intergenic
980733227 4:136848782-136848804 AAGGGTGTCCGCCATTACTGAGG - Intergenic
980769335 4:137351195-137351217 AGGGGTGTCCAACATTACTGAGG + Intergenic
981415014 4:144482884-144482906 AAGGGTGTCCACCATTGCTGAGG + Intergenic
983167692 4:164497540-164497562 AGGGGTGTCCAGTATTACTGAGG - Intergenic
985194007 4:187408255-187408277 CGGGGTGTCCACCATTACTGAGG - Intergenic
986110360 5:4709956-4709978 AAGGGCGTCCACCATTACTGAGG + Intergenic
987062462 5:14255555-14255577 TCTGGTGCCCAGCATTTCAGAGG - Intronic
989302197 5:39907733-39907755 TGGGGTGCCCACCATTGCTGAGG + Intergenic
989516819 5:42353587-42353609 AGGGGTGTCCAGCATTGCTGAGG + Intergenic
989619038 5:43367056-43367078 AGGGGTGTCCACCATTACTGAGG - Intergenic
990045244 5:51422128-51422150 TAATTTGCCCAGCTTTACTGAGG + Intergenic
990673875 5:58162143-58162165 AGGGGTGTCCACCATTACTGAGG - Intergenic
990897586 5:60715738-60715760 AGGGGTGTCCACCATTACTGAGG - Intergenic
992163524 5:74025868-74025890 GAGGGTGTCCAGCACAACTGGGG + Intergenic
992258158 5:74942817-74942839 TAGAGTGCTCAGCATTACAAGGG + Intergenic
992610672 5:78505565-78505587 CAGGGTGCACAGCAGTCCTGTGG - Intronic
992915603 5:81449878-81449900 TAGAGTGCCCAGCATCACTAGGG + Intronic
993008816 5:82457228-82457250 AGGGGTGCCCACCATTGCTGAGG - Intergenic
993338640 5:86693347-86693369 GAGGCTGCCCATCATTAATGAGG - Intergenic
993541635 5:89159496-89159518 AGGGGTGTCCACCATTACTGAGG + Intergenic
993911560 5:93690370-93690392 AAGGGTGTCCGCCATTACTGAGG + Intronic
996114149 5:119599764-119599786 AGGGGTGCCCACCATTGCTGAGG + Intronic
998691613 5:144594564-144594586 AGGGGTGTCCACCATTACTGAGG - Intergenic
999243561 5:150140987-150141009 GAGGGGGCCCTGCATTGCTGCGG + Intronic
1000018315 5:157297866-157297888 CAGTGTGCCTAGGATTACTGAGG - Intronic
1000376114 5:160583852-160583874 AGGGGTGTCCACCATTACTGAGG - Intronic
1000590044 5:163147047-163147069 AGGGGTGTCCACCATTACTGAGG + Intergenic
1001144274 5:169170222-169170244 TAGGGTGCCTAGCAACATTGTGG - Intronic
1001471417 5:172015807-172015829 TATGGTGTCCAGCATTGCTGGGG + Intergenic
1002216574 5:177639225-177639247 AAGGGTGCCCGCCATTGCTGAGG - Intergenic
1003416885 6:5917669-5917691 AGGGGTGTCCACCATTACTGAGG - Intergenic
1003713501 6:8619636-8619658 AGGGGTGTCCACCATTACTGAGG - Intergenic
1006460162 6:34153400-34153422 TGGGGTTCCCAGCAGTCCTGAGG - Intronic
1006690997 6:35885066-35885088 AAAGGTACTCAGCATTACTGGGG + Intronic
1008176201 6:48270853-48270875 AGGGGTGTCCACCATTACTGAGG - Intergenic
1008874120 6:56307411-56307433 AGGGGTGCCCACCATTGCTGAGG - Intronic
1008896835 6:56566019-56566041 AGGGGTGTCCACCATTACTGAGG - Intronic
1010286580 6:74084730-74084752 AGGGGTGCCCACCATTGCTGAGG - Intergenic
1010310444 6:74378622-74378644 AGGGGTGCCCAACATTGCTGAGG - Intergenic
1010511812 6:76729577-76729599 GAGGGTGCCCGCCATTGCTGAGG - Intergenic
1010876903 6:81117734-81117756 AGGGGTGCCCACCATTACTGAGG - Intergenic
1011081643 6:83496099-83496121 AGGGGTGCCCACCATTGCTGAGG + Intergenic
1011251609 6:85377637-85377659 ATGGGTGCCCACCATTGCTGAGG + Intergenic
1011303084 6:85896648-85896670 AGGGGTGCCCACCATTGCTGAGG - Intergenic
1011332746 6:86228189-86228211 AAGGCTGCTCACCATTACTGAGG - Intergenic
1012127931 6:95454072-95454094 AGGGGTGTCCACCATTACTGAGG - Intergenic
1012907685 6:105087083-105087105 GAGGCTGCACAGCATTAATGGGG + Intergenic
1013625660 6:111934790-111934812 AGGGGTGTCCAACATTACTGAGG - Intergenic
1013931946 6:115545191-115545213 AAGTGTGGCCATCATTACTGCGG + Intergenic
1013939600 6:115645466-115645488 AGGGGTGTCCACCATTACTGAGG + Intergenic
1014063591 6:117100952-117100974 AGGGGTGCCCACCATTGCTGAGG - Intergenic
1015462039 6:133502537-133502559 GAGGGTGCCCAGCATTGCTAAGG + Intronic
1017031843 6:150230602-150230624 AAGGGTGCCCAGAAGAACTGCGG - Intronic
1018094514 6:160373832-160373854 AGGGGTGTCCATCATTACTGAGG - Intronic
1019845123 7:3491207-3491229 TAGGGTGTCTAGAATTGCTGAGG + Intronic
1020874263 7:13673843-13673865 AGGGGTGTCCACCATTACTGAGG - Intergenic
1021167006 7:17354267-17354289 AGGGGTGCCCACCATTACTGAGG - Intergenic
1022058844 7:26770278-26770300 AGGGGTGTCCACCATTACTGAGG - Intronic
1022079738 7:27008136-27008158 AAGGGTGCCCGCCATTGCTGAGG - Intergenic
1022453594 7:30537919-30537941 AGGGGTGCCCACCATTGCTGAGG + Intronic
1024408238 7:49007677-49007699 AGGGGTGCCCACCATTGCTGAGG - Intergenic
1025637926 7:63339950-63339972 AGGGGTGTCCACCATTACTGAGG - Intergenic
1025644771 7:63408149-63408171 AGGGGTGTCCACCATTACTGAGG + Intergenic
1027577317 7:79946776-79946798 AGGGGTGCCCACCATTGCTGAGG - Intergenic
1028991260 7:97051226-97051248 AAGGGTGTCCACCATTACTGAGG + Intergenic
1030342188 7:108393254-108393276 AGGGGCGCCCACCATTACTGAGG - Intronic
1031031844 7:116743544-116743566 AGGGGTGTCCACCATTACTGAGG + Intronic
1033097158 7:138441844-138441866 AAGGGAGCCCATCATCACTGTGG - Intergenic
1034040094 7:147868667-147868689 TGGGGTGTCCACCATTGCTGAGG - Intronic
1038435349 8:27531987-27532009 TGTGGTGCCCTGCATTTCTGGGG + Intronic
1038870587 8:31489500-31489522 TGGGGCGCCCACCATTGCTGAGG - Intergenic
1038936442 8:32257108-32257130 AGGGGTGTCCACCATTACTGAGG - Intronic
1039133854 8:34297887-34297909 CAGGGCGTCCACCATTACTGAGG + Intergenic
1039707432 8:40022089-40022111 AGGGGTGCCCACCATTGCTGAGG - Intergenic
1040708150 8:50154091-50154113 AGGGGTGCCCACCATTGCTGAGG - Intronic
1042627154 8:70770737-70770759 AGGGGTGTCCACCATTACTGAGG - Intronic
1042731449 8:71939534-71939556 AGGGGTGCCCACCATTGCTGAGG - Intronic
1042753505 8:72184534-72184556 AGGGGTGTCCACCATTACTGAGG + Intergenic
1043253661 8:78106416-78106438 AGGGGTGTCCACCATTACTGAGG - Intergenic
1045333386 8:101176981-101177003 TGAGGTTCCCAGCATTTCTGAGG + Intergenic
1046067974 8:109218833-109218855 AAGGGCGTCCACCATTACTGAGG - Intergenic
1046591566 8:116213542-116213564 TAGGGTGATCAGCACTACTGGGG - Intergenic
1046925212 8:119779690-119779712 TAGGTTGCACAGCAGCACTGGGG - Intronic
1047262198 8:123273756-123273778 TAGGACTCCCAACATTACTGGGG + Intronic
1049573533 8:143380348-143380370 GAGGCTGCCCAGCACTCCTGGGG - Intronic
1051452771 9:17215740-17215762 AGGGGTGCCCACCATTGCTGAGG - Intronic
1052052711 9:23866427-23866449 AAGGGTGTCCACCATTACTAAGG - Intergenic
1052241381 9:26277720-26277742 AGGGGTGTCCACCATTACTGAGG + Intergenic
1052376895 9:27727831-27727853 AATGCTGCCCAACATTACTGAGG + Intergenic
1052941278 9:34133532-34133554 CAGGGAGCCCATCATCACTGTGG + Intergenic
1053839915 9:42182369-42182391 AAGGGTGACCGCCATTACTGCGG + Intergenic
1054118374 9:61188744-61188766 AAGGGTGACCGCCATTACTGCGG + Intergenic
1054589382 9:66993820-66993842 AAGGGTGACCACCATTACTGCGG - Intergenic
1055338682 9:75259372-75259394 AGGGGTGCCCACCATTGCTGAGG - Intergenic
1056176777 9:84043888-84043910 AGGGGTGTCCACCATTACTGAGG - Intergenic
1056464542 9:86840718-86840740 TAGGGTTCCCAGTTTTACAGAGG - Intergenic
1058367065 9:104221003-104221025 AGGGGTGCCCACCATTGCTGAGG - Intergenic
1058594947 9:106605424-106605446 TAGGGCGCCCACCATTGCTGAGG + Intergenic
1062315932 9:135967005-135967027 TAGGGTGCCCGGCGTGGCTGTGG - Intergenic
1062315944 9:135967040-135967062 TAGGGTGCCCGGCGTGGCTGTGG - Intergenic
1062315956 9:135967075-135967097 TAGGGTGCCCGGCGTGGCTGTGG - Intergenic
1062315968 9:135967110-135967132 TAGGGTGCCCGGCGTGGCTGTGG - Intergenic
1062318326 9:135978722-135978744 TAGGGTGTCCAGGGCTACTGAGG - Intergenic
1189361909 X:40359561-40359583 CAGGGAGCCCATCATCACTGTGG + Intergenic
1190554852 X:51623570-51623592 AGGGGTGCCCACCATTGCTGAGG + Intergenic
1190959760 X:55234643-55234665 AAGGGCGTCCATCATTACTGAGG - Intronic
1191115403 X:56847051-56847073 AGGGGTGTCCACCATTACTGAGG + Intergenic
1191628219 X:63291620-63291642 AGGGGTGCCCACCATTGCTGAGG - Intergenic
1191824852 X:65353780-65353802 AGGGGTGTCCACCATTACTGAGG + Intergenic
1191935555 X:66423687-66423709 AGGGGTGCCCACCATTGCTGAGG - Intergenic
1191941854 X:66489530-66489552 AAGGGCGCCCACCATTGCTGAGG + Intergenic
1192007656 X:67234534-67234556 AGGGGTGCCCACCATTGCTGAGG + Intergenic
1192228471 X:69246225-69246247 AGGGGTGTCCAGCATTACTAAGG + Intergenic
1192525877 X:71843610-71843632 AGGGGTGCCCACCATTGCTGAGG - Intergenic
1192598557 X:72437658-72437680 AGGGGTGTCCACCATTACTGAGG + Intronic
1192701775 X:73482148-73482170 AAGGGTGTCCGCCATTACTGAGG - Intergenic
1192994024 X:76492988-76493010 AGGGGTGTCCACCATTACTGAGG + Intergenic
1193228419 X:79013253-79013275 AGGGGCGCCCATCATTACTGAGG - Intergenic
1193229964 X:79032271-79032293 AGGGGTGCCCACCATTGCTGAGG - Intergenic
1193266854 X:79482331-79482353 AAGGGTGTACACCATTACTGAGG + Intergenic
1193367357 X:80651016-80651038 AGGGGTGCCCATCATTGCTGAGG + Intergenic
1193542464 X:82788692-82788714 AGGGGTGCCCACCATTGCTGAGG + Intergenic
1193645709 X:84066434-84066456 GGGGGTGTCCACCATTACTGAGG + Intronic
1194879593 X:99235052-99235074 AGGGGTGCCCACCATTGCTGAGG + Intergenic
1195140108 X:101950499-101950521 TGGGGCGTCCACCATTACTGAGG + Intergenic
1195233010 X:102870004-102870026 AAGGGTGTCCATCATTACTGAGG - Intergenic
1195985581 X:110626633-110626655 AGGGGTGTCCACCATTACTGAGG + Intergenic
1196946585 X:120832886-120832908 AGGGGTGTCCACCATTACTGAGG - Intergenic
1198002264 X:132451492-132451514 AGGGGTGTCCACCATTACTGAGG - Intronic
1199436610 X:147819691-147819713 AAGGGTTTCCACCATTACTGAGG + Intergenic
1200075161 X:153547130-153547152 TGGGGTGGCCAGGATTACTCTGG + Intronic
1200333232 X:155319876-155319898 AGGGGTGTCCACCATTACTGAGG + Intronic
1201590681 Y:15611329-15611351 AGGGGCGCCCACCATTACTGAGG + Intergenic
1201938712 Y:19435332-19435354 GGGGGTGCCCACCATTGCTGAGG + Intergenic
1201945903 Y:19509767-19509789 AGGGGTGCCCACCATTGCTGAGG - Intergenic
1202085194 Y:21129206-21129228 AGGGGTGCCCACCATTACTGAGG - Intergenic