ID: 1092451590

View in Genome Browser
Species Human (GRCh38)
Location 12:8607399-8607421
Sequence GACACTTAGGTAAAGACTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 159}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092451590 Original CRISPR GACACTTAGGTAAAGACTGG AGG (reversed) Intronic
900140375 1:1137202-1137224 CACACTCAGGGAAAGACCGGAGG + Intergenic
902137972 1:14327078-14327100 AACACTTATGCAACGACTGGAGG + Intergenic
904904175 1:33882326-33882348 GTGACTTAGGTGAAGACTGATGG + Intronic
905079142 1:35301699-35301721 GATACTTAGCTGAAGACTAGAGG + Intronic
908851677 1:68383041-68383063 GACACTAAGGTTAGCACTGGGGG + Intergenic
918069350 1:181123488-181123510 GACACTGAGGCACAGAATGGTGG + Intergenic
918818472 1:189222917-189222939 GAGAATTAGGTAAAGGCTGTAGG + Intergenic
923687679 1:236164577-236164599 GAGACTTTGCTAAAGACTGGTGG - Intronic
1063837203 10:10029231-10029253 GACCCTTTGTTAAAGGCTGGTGG + Intergenic
1064011500 10:11740127-11740149 GGCACGTGGGTAATGACTGGTGG + Intergenic
1065378573 10:25066593-25066615 GAAATTTAGATAAAGAATGGCGG - Intergenic
1065700583 10:28421372-28421394 GCCACTTAGGTAAAGATTTTGGG - Intergenic
1065837899 10:29675730-29675752 AACACTTGGGCGAAGACTGGAGG - Intronic
1066455878 10:35571591-35571613 GACACATAGGTAGATACTTGAGG + Exonic
1068611456 10:59064945-59064967 GACACTTTGGGAGATACTGGAGG + Intergenic
1069403374 10:68074023-68074045 GACAATTATTTAAAGATTGGCGG + Intronic
1069576548 10:69534349-69534371 GACACCAGCGTAAAGACTGGTGG + Intergenic
1071761010 10:88607048-88607070 GACACTGATTTAATGACTGGAGG - Intergenic
1073393473 10:103198598-103198620 GACACTTGGGTAAAAAATGAAGG + Intergenic
1075786201 10:125051886-125051908 GACACTTAGACACAGACAGGGGG + Intronic
1075944600 10:126421473-126421495 GACACTCAGGAGAAGGCTGGGGG + Intergenic
1075966173 10:126613754-126613776 GACCTTCAGGTAAAGACTGAAGG + Intronic
1075979417 10:126723975-126723997 GACACTGAGCTACAAACTGGAGG + Intergenic
1077266758 11:1654750-1654772 GACACTGAGCCAAAGGCTGGAGG - Intergenic
1077888935 11:6405119-6405141 GGCACTGAGGTAACCACTGGAGG - Intronic
1077950010 11:6946584-6946606 GTCAATTAGGTAAAGAACGGGGG - Intronic
1078643931 11:13120966-13120988 GACACATAGCTAATGAGTGGTGG + Intergenic
1080432895 11:32214943-32214965 AGCACATAGGTAATGACTGGAGG - Intergenic
1081058208 11:38437980-38438002 GACACTTAGTTTAAGATTAGTGG - Intergenic
1083529569 11:63407356-63407378 AAGAGTTAGGTGAAGACTGGTGG - Intronic
1084672326 11:70614683-70614705 GTCACTGAGACAAAGACTGGAGG - Intronic
1085659073 11:78346000-78346022 GAGACTTAGGAAAAGAGTGGAGG - Intronic
1086314460 11:85575693-85575715 GACATTTGAGTAAAGACTTGAGG - Intronic
1086916649 11:92537478-92537500 GACAAGGAGGGAAAGACTGGGGG - Intronic
1087632520 11:100667224-100667246 GAAACTTAGGTGAAAACTCGCGG - Intergenic
1090367385 11:126218345-126218367 GACATTTAAGGAAAGACTTGTGG - Intronic
1092451590 12:8607399-8607421 GACACTTAGGTAAAGACTGGAGG - Intronic
1097523614 12:60701344-60701366 GACAATGAGGTAAAGGATGGAGG - Intergenic
1101651674 12:106682739-106682761 TACATTTAAGTAAAGACTAGGGG + Intronic
1103555835 12:121765995-121766017 GTCACTTCGGCAAAGACTGTGGG - Intronic
1105683329 13:22752184-22752206 GACAGTGAGGTAAAGACAGTAGG - Intergenic
1112130566 13:96519215-96519237 GTCACTTTGTTAATGACTGGTGG + Intronic
1113758213 13:112828784-112828806 CACACTGAGGTCAAGACGGGTGG + Intronic
1114295339 14:21324350-21324372 TAAACTTAGGAAAACACTGGGGG - Intronic
1115103071 14:29726527-29726549 GACACTTATGTCAATACAGGTGG + Intronic
1115789794 14:36866016-36866038 GACATATAGTTAAAGACTAGTGG - Intronic
1115790003 14:36867915-36867937 GTCACATAGGTAATGAGTGGAGG + Intronic
1116006530 14:39297511-39297533 GCAACTTAGGTAAAGAATGCTGG + Intronic
1116763007 14:49038212-49038234 GATCCCTAGGGAAAGACTGGAGG + Intergenic
1119898417 14:78240002-78240024 GAAATTTAAGTAAAGACTTGAGG - Intergenic
1120980913 14:90288230-90288252 GAAACTGAGGAAGAGACTGGTGG - Exonic
1122907792 14:104810209-104810231 GACACTTGGGTACAGTCAGGGGG + Intergenic
1126180896 15:45784160-45784182 GACACTGAGGCTCAGACTGGTGG - Intergenic
1129190507 15:73934866-73934888 GACACTTGAGCAAAGACTTGAGG + Intronic
1132220956 15:100105152-100105174 GGCTCTTTTGTAAAGACTGGTGG + Intronic
1134820258 16:17241082-17241104 GACGCATAAGTAAAGTCTGGAGG + Intronic
1141461594 16:84181314-84181336 GACACTCAGGTACGGGCTGGCGG - Exonic
1142992241 17:3739167-3739189 GACACTTTGGCACACACTGGAGG - Intronic
1149165057 17:53741561-53741583 GACATTTTGGTAGATACTGGAGG + Intergenic
1152294965 17:79461825-79461847 GACACAGAGGTAGAGGCTGGAGG + Intronic
1153672079 18:7420998-7421020 GACACTTAGGGAGAAACAGGGGG + Intergenic
1153942447 18:9989810-9989832 GACACTTGGGAAGAGACTGCTGG - Intergenic
1157412399 18:47474222-47474244 GACACTTTGCTAAGCACTGGAGG - Intergenic
1162077112 19:8195356-8195378 GCCCCTTGGGTAAAGACAGGAGG - Intronic
1167796389 19:51712432-51712454 GAAACTGAGGTCAAGAGTGGGGG + Intergenic
925754380 2:7119687-7119709 GACACTCAGGTCATGAGTGGTGG + Intergenic
927481683 2:23458866-23458888 TAGACTCAGATAAAGACTGGAGG - Intronic
927758830 2:25731885-25731907 AACACTTAGGAAAAGAAAGGGGG + Intergenic
932440761 2:71733279-71733301 GACACTTAGGCCAAGTCTTGAGG - Intergenic
935102782 2:100012477-100012499 GACACTTAGGGAGATACAGGGGG - Intronic
935113158 2:100110379-100110401 GACACTTAGCTTAGGTCTGGGGG + Intronic
935853075 2:107244136-107244158 TACACTTATGCAAAGACAGGAGG - Intergenic
937071358 2:119066142-119066164 GAATTTTAGGTAAAGATTGGAGG - Intergenic
941305302 2:163857348-163857370 GACCCTGAGGTAATAACTGGAGG - Intergenic
944024545 2:195147507-195147529 GACACTAAGCTAAACACTGCTGG - Intergenic
1175769288 20:61613208-61613230 AGCACTTGGGTAAAGACTAGGGG - Intronic
1176266654 20:64212809-64212831 GGCACTTAGGGTAAGGCTGGAGG - Intronic
1177431231 21:20995030-20995052 AAAACTTAAGTAAAGCCTGGGGG - Intergenic
1179150144 21:38802711-38802733 GAGACTTTGGTAAGGAGTGGAGG - Intergenic
1179897586 21:44371240-44371262 GACACGGAGGCAGAGACTGGAGG - Intronic
1179897616 21:44371348-44371370 GACACGGAGGCAGAGACTGGAGG - Intronic
1179897626 21:44371384-44371406 GACACGGAGGCAGAGACTGGAGG - Intronic
1179897636 21:44371420-44371442 GACACGGAGGCAGAGACTGGAGG - Intronic
1179897646 21:44371456-44371478 GACACGGAGGCAGAGACTGGAGG - Intronic
1179897656 21:44371492-44371514 GACACGGAGGCAGAGACTGGAGG - Intronic
1179897666 21:44371528-44371550 GACACGGAGGCAGAGACTGGAGG - Intronic
1180868651 22:19133929-19133951 AACACCTAGGTACAGTCTGGGGG - Exonic
1182762463 22:32733886-32733908 CACACTTAGTCAAAGCCTGGTGG + Intronic
1184592878 22:45496921-45496943 GACTCTTACATAAAGACTGAGGG + Intergenic
949948702 3:9211466-9211488 AACACTGAGGTTAACACTGGGGG - Intronic
950859341 3:16133735-16133757 GACACTAAATTAAAGATTGGGGG + Intergenic
953197296 3:40746494-40746516 GACCCTGAGGCAAAGACCGGGGG - Intergenic
954463206 3:50639335-50639357 GACCCAGAGGTAGAGACTGGGGG - Intronic
956120811 3:65964199-65964221 GACGCTAAGGTAATTACTGGGGG - Intronic
957135680 3:76286001-76286023 GACACTTAGGTAGGCACTGCAGG + Intronic
959143993 3:102522347-102522369 CACACTAAGGTAAGGACTGATGG - Intergenic
960681034 3:120247704-120247726 CATACTTAGGAGAAGACTGGGGG - Intronic
960959644 3:123061228-123061250 GACACTTAGCTCTGGACTGGGGG + Intergenic
965419069 3:168434436-168434458 GCCAATAAGGTCAAGACTGGAGG + Intergenic
965809083 3:172574140-172574162 TACTGCTAGGTAAAGACTGGGGG - Intergenic
966760767 3:183417234-183417256 GAGATTTTGGTAAACACTGGGGG + Intronic
968155551 3:196378254-196378276 GATGCTTAGTTAAAAACTGGAGG - Intronic
968214001 3:196872453-196872475 TATACTTAGGGAAAGGCTGGAGG + Intronic
971548281 4:27914932-27914954 GACAAATAGGTAATGACTGTGGG + Intergenic
972772228 4:42208227-42208249 GACATTTAGGCTAAAACTGGAGG - Intergenic
973185649 4:47324982-47325004 GATAGTTTGGAAAAGACTGGTGG - Intronic
975601169 4:76101024-76101046 GACATTTATGTAAATTCTGGGGG + Intronic
977441699 4:97075933-97075955 GAATCTGAGGAAAAGACTGGGGG + Intergenic
979980014 4:127243322-127243344 AGCACTTAGGTAAATCCTGGTGG + Intergenic
983910683 4:173235468-173235490 GTTACTTAGGTGAAGACAGGAGG - Intronic
984537462 4:180994650-180994672 TTCACTTAGCTAAAGACTTGAGG + Intergenic
987633309 5:20505156-20505178 TACATGTAGATAAAGACTGGTGG + Intronic
992092292 5:73327954-73327976 AACACTTAGGTAAACTCTGTGGG + Intergenic
992973506 5:82087256-82087278 GAAACTAAGCTAAAGACTGAAGG + Intronic
993082040 5:83313468-83313490 GGCAAATAGGTAAAAACTGGGGG - Intronic
998529401 5:142871091-142871113 GACGATTAGGTAATGACTGCTGG - Intronic
1002280068 5:178124636-178124658 GACACTGAGTGAAGGACTGGAGG - Exonic
1003272579 6:4620532-4620554 GACACTGAGTTAAAGAAGGGAGG + Intergenic
1003301247 6:4884776-4884798 GACAGTCAGGTAAAAACTGCTGG - Intronic
1003460597 6:6324519-6324541 GGCACTTGGGCAAAGTCTGGAGG + Intergenic
1007278148 6:40690688-40690710 GACACTTAGGCAAAGGCTGAGGG + Intergenic
1012368123 6:98468040-98468062 GATACTTAGTTAAATACGGGTGG - Intergenic
1012924915 6:105258080-105258102 GACACTGAGGTCTAGACAGGTGG + Intergenic
1013427348 6:110025380-110025402 GACACTGAGGTAAAGAAGGAAGG + Intergenic
1016625953 6:146169513-146169535 AGAACTTAGCTAAAGACTGGAGG + Intronic
1017755884 6:157528770-157528792 CACAATTAGATGAAGACTGGGGG + Intronic
1017755890 6:157528826-157528848 CACAATTAGATGAAGACTGGGGG + Intronic
1017755898 6:157528882-157528904 CACAATTAGATGAAGACTGGGGG + Intronic
1017999875 6:159569643-159569665 GACACATAGGTGAATCCTGGGGG + Intergenic
1019737885 7:2659502-2659524 GACACTCAGGAAAAGACTCAAGG - Intronic
1020679429 7:11218881-11218903 GACACTCAGGTCAAGACTAAGGG + Intergenic
1020965673 7:14864927-14864949 AACATTTAAGGAAAGACTGGAGG + Intronic
1022427445 7:30282977-30282999 GACACTGTGTTAAACACTGGAGG + Intergenic
1026449796 7:70518289-70518311 GAAAGTTGGGTAAAGATTGGGGG + Intronic
1030714165 7:112789566-112789588 GTGAATTAAGTAAAGACTGGTGG - Intronic
1032620958 7:133531472-133531494 GACAAGTAGGTGAAAACTGGAGG + Intronic
1032808524 7:135383603-135383625 TACACTCATGAAAAGACTGGAGG + Intronic
1033932230 7:146538262-146538284 GACATTTGGGGAAAGACTTGAGG - Intronic
1035380428 7:158436291-158436313 GACTCTTGGGAAAAGACTGCAGG - Intronic
1036983248 8:13495282-13495304 AACATTTAGGGAAAGACTTGAGG - Intronic
1038218799 8:25588027-25588049 GCCACGGAGGTACAGACTGGTGG + Intergenic
1041038859 8:53825462-53825484 AAAACCTAGGTAAATACTGGGGG + Intronic
1046064994 8:109185754-109185776 AACCCTTAGGTAAAGGCTGATGG + Intergenic
1047710956 8:127551747-127551769 GACATTTAGGAAAAGATTGAAGG - Intergenic
1048767016 8:137855702-137855724 CACACTTGGGTAAAGAGTAGAGG - Intergenic
1048999841 8:139817791-139817813 GCAACTTAGGTAAAGACTTTCGG + Intronic
1049340266 8:142108655-142108677 ATCACAAAGGTAAAGACTGGGGG + Intergenic
1050689713 9:8212257-8212279 TCCACTTATGTAAAGAATGGGGG - Intergenic
1054999235 9:71429698-71429720 AACACTTAGGGAAAGATTAGGGG - Intronic
1056347784 9:85716859-85716881 GACAGGGAGGTAAGGACTGGGGG - Intronic
1058748522 9:108015939-108015961 GACATTTAGGCAAAGATTGAAGG - Intergenic
1060549560 9:124478485-124478507 CACAGATAGGCAAAGACTGGGGG - Exonic
1061250700 9:129424750-129424772 GACCCTTAGGAAATGAGTGGGGG - Intergenic
1062648087 9:137560342-137560364 GAGACTTAGGAAAAAACAGGTGG + Intronic
1185619069 X:1442450-1442472 CACACTTAGGGAAAGCTTGGCGG - Intronic
1187055517 X:15738344-15738366 GACGCTCAGGTAAGGACGGGTGG + Exonic
1187212074 X:17241665-17241687 GACGCTAAAGCAAAGACTGGAGG + Intergenic
1191069769 X:56388326-56388348 AACAATTTGGTAAGGACTGGGGG - Intergenic
1196549783 X:117010056-117010078 GAGACTTAAGCAAAGACTGGAGG + Intergenic
1196809336 X:119616153-119616175 AACACTTAGGTAGAGAAGGGAGG - Intronic
1198138635 X:133780502-133780524 GACTCGAAGGTAATGACTGGTGG + Intronic
1199466485 X:148143545-148143567 GTCACTTAAGTAAAGCCTAGGGG - Intergenic
1201448515 Y:14084134-14084156 CACCCTTAGGTAGAGACAGGAGG + Intergenic
1201906087 Y:19086892-19086914 GATAATTAGGTAAAAACAGGAGG + Intergenic