ID: 1092455077

View in Genome Browser
Species Human (GRCh38)
Location 12:8635955-8635977
Sequence GGCCGCAGGGACCTCCGCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3205
Summary {0: 2, 1: 397, 2: 1688, 3: 798, 4: 320}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092455072_1092455077 15 Left 1092455072 12:8635917-8635939 CCTAATCTCAAGTACACAGGGAC 0: 5
1: 2057
2: 786
3: 107
4: 166
Right 1092455077 12:8635955-8635977 GGCCGCAGGGACCTCCGCCTAGG 0: 2
1: 397
2: 1688
3: 798
4: 320
1092455071_1092455077 16 Left 1092455071 12:8635916-8635938 CCCTAATCTCAAGTACACAGGGA 0: 5
1: 2063
2: 785
3: 116
4: 166
Right 1092455077 12:8635955-8635977 GGCCGCAGGGACCTCCGCCTAGG 0: 2
1: 397
2: 1688
3: 798
4: 320
1092455068_1092455077 21 Left 1092455068 12:8635911-8635933 CCACTCCCTAATCTCAAGTACAC 0: 5
1: 2110
2: 540
3: 380
4: 1233
Right 1092455077 12:8635955-8635977 GGCCGCAGGGACCTCCGCCTAGG 0: 2
1: 397
2: 1688
3: 798
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092455077 Original CRISPR GGCCGCAGGGACCTCCGCCT AGG Intergenic
Too many off-targets to display for this crispr