ID: 1092455196

View in Genome Browser
Species Human (GRCh38)
Location 12:8636825-8636847
Sequence CAGCAGCTGCATCTTGTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 2, 1: 0, 2: 4, 3: 39, 4: 265}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092455196_1092455200 30 Left 1092455196 12:8636825-8636847 CCATGGACAAGATGCAGCTGCTG 0: 2
1: 0
2: 4
3: 39
4: 265
Right 1092455200 12:8636878-8636900 GACACTCAGTGCTTCAGCTGTGG 0: 1
1: 0
2: 0
3: 12
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092455196 Original CRISPR CAGCAGCTGCATCTTGTCCA TGG (reversed) Intergenic
900505251 1:3027166-3027188 CAGCTCCTGCCTCTTGTCCCGGG + Intergenic
900546641 1:3233180-3233202 CAGCAGCTGCCCCCTGCCCAGGG + Intronic
900827289 1:4936965-4936987 CTGCAGCTGGAGCTTTTCCAGGG - Intergenic
901050058 1:6421468-6421490 CAGCATCTGCATCTTGGGGAGGG + Intronic
901367353 1:8764168-8764190 GAGCAGCTGCAACTTGCCCTGGG - Intronic
902423463 1:16300436-16300458 CAGTAGTTTCATCTTTTCCATGG + Intronic
902833260 1:19031364-19031386 CATCAGCTGCATTTGGCCCATGG + Intergenic
903807602 1:26016688-26016710 CATCTGCTGCTTCTTGTCTACGG - Intergenic
904275724 1:29383021-29383043 CAGGGGCTGCATCTTGTCCCTGG + Intergenic
904423221 1:30407429-30407451 CAGAGGCTGCATCTTGTCCCTGG - Intergenic
904583205 1:31563197-31563219 GAGCAGCTGCATCTTGAATAGGG - Intergenic
904876394 1:33657853-33657875 CAGCAGCTGCATCTTGGGCCTGG - Intronic
906086152 1:43136316-43136338 GAGCAACTCCATCTTGTCTAGGG - Intergenic
909260718 1:73486242-73486264 CAGCACGTGCATATAGTCCAAGG - Intergenic
909415715 1:75403240-75403262 CCGCAGCTGCCTCTTCTCCCAGG - Intronic
912344120 1:108948277-108948299 CAGGAACTGCAGCTTCTCCAGGG + Intronic
912486299 1:110031589-110031611 CAGCAACTCCATCTTGAACAGGG - Intronic
913592413 1:120341814-120341836 TAGCGGCTGCTTCTTTTCCAAGG - Intergenic
913650946 1:120913331-120913353 TAGCGGCTGCTTCTTTTCCAAGG + Intergenic
914170168 1:145215736-145215758 TAGCGGCTGCTTCTTTTCCAAGG - Intergenic
914525284 1:148459699-148459721 TAGCGGCTGCTTCTTTTCCAAGG - Intergenic
914598390 1:149176131-149176153 TAGCGGCTGCTTCTTTTCCAAGG + Intergenic
914641119 1:149607435-149607457 TAGCGGCTGCTTCTTTTCCAAGG + Intergenic
915770804 1:158420789-158420811 CAGCTGCTGCAGCCTGGCCAGGG + Exonic
915774258 1:158465617-158465639 CAGCTGCTGCAGCCTGGCCAGGG - Exonic
915801008 1:158793772-158793794 CTGCAGCTGGATCTTACCCATGG - Intergenic
915877866 1:159631390-159631412 CAGCAGCAACATCTCTTCCATGG - Intergenic
915965873 1:160307608-160307630 GAGCAGCTGCATCCTGTGGAGGG - Intronic
918057334 1:181033312-181033334 CAGCAGCTTAAGCTTGTCCAGGG - Intergenic
918233237 1:182554671-182554693 ATGCAGCTGCATCCCGTCCAGGG + Exonic
920387612 1:205579891-205579913 TACCAGCTGCATGTTGGCCACGG - Exonic
920813098 1:209305406-209305428 CAGCAGCAGCAGCTTATCCTAGG - Intergenic
920994974 1:210981308-210981330 CAGCAACTACATCTAGTCCCAGG + Intronic
922585775 1:226734180-226734202 CAGCAGGTGCATAATGCCCAGGG + Intronic
923087445 1:230712312-230712334 CAGCAGCTGCACCGTGTTGAGGG - Intronic
923216577 1:231853783-231853805 CAGCTGCTGTATCTTGGCCCTGG - Intronic
923474238 1:234317915-234317937 TACCACCTGCAACTTGTCCATGG + Intronic
923506289 1:234609190-234609212 CAGCAGCAGCAGCTTGGCCACGG - Exonic
1063387021 10:5622213-5622235 CTGAAGCTGCAGCTTTTCCAGGG + Intergenic
1063601165 10:7482718-7482740 CAGCAGCTTCATCCTGGCCTTGG + Intergenic
1064251737 10:13711162-13711184 AAGCAGCTGCCCCTTGCCCAGGG + Intronic
1066518018 10:36185300-36185322 CAGCAGCTGCCTCTCGCCCACGG - Intergenic
1067718191 10:48705435-48705457 CAGCAGCCTCTTCTTATCCAGGG - Intronic
1070006055 10:72425359-72425381 CAGCAGCTGCAGCTTGCTCAAGG + Intronic
1070282077 10:75057333-75057355 CAGCATCTGCATCTGCTCCTTGG + Intronic
1070363959 10:75717674-75717696 CAGCAACTGCAGCTTGTGCAGGG - Intronic
1072540883 10:96397207-96397229 CAGCAGCAACATCTTGGGCAAGG - Exonic
1072783619 10:98266487-98266509 CAGCAGCTCCTTCCTCTCCAAGG + Intronic
1076518547 10:131063668-131063690 CACCAGCTGAATCTTGCCCAGGG + Intergenic
1076539463 10:131204956-131204978 CTGCAGCTGGATCTGGTCTAAGG + Intronic
1076608289 10:131703624-131703646 CAGGTGCTGCATCCTGCCCAGGG + Intergenic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1077260459 11:1616229-1616251 CAGCAGCTCCATCCTTCCCAGGG - Intergenic
1077302744 11:1854784-1854806 CAGGAGCAGCACCTAGTCCAGGG - Intronic
1078404544 11:11058568-11058590 CAGCACCTGGCTCTTGTCTAGGG + Intergenic
1078682522 11:13490631-13490653 CAGCAGCTGCCTCCTGATCAGGG + Intergenic
1080539047 11:33249292-33249314 AAGAAGCAGCAGCTTGTCCAAGG - Intergenic
1081493362 11:43583384-43583406 CAGCAGCAGGAGCTTCTCCAAGG - Intronic
1081711259 11:45217448-45217470 CAGAATTTGCATCTTGTCCTAGG - Intronic
1083717064 11:64583561-64583583 CAGCAGCTGCCTCTGGTCCCAGG - Intergenic
1084587747 11:70072923-70072945 CAGAAGCTGTATCATGTCTAGGG + Intergenic
1084876264 11:72135963-72135985 CAGCAGCTGCATCATCTGCCAGG - Exonic
1085320833 11:75572992-75573014 CTGCAGCTGCTACTTCTCCAGGG - Intergenic
1085464931 11:76716840-76716862 CAGCAGATGCATCAGGCCCAGGG - Intergenic
1088334646 11:108690380-108690402 CAGCAGCAGCTTCTTGGGCATGG + Intronic
1088581171 11:111318232-111318254 CTGGAGCTGCATCTTCTCAACGG - Intergenic
1088833200 11:113555542-113555564 CAGCAGCTGCATCTCGGGCTGGG + Intergenic
1089345414 11:117788169-117788191 CCGCTGCTTCCTCTTGTCCAAGG - Intronic
1092455196 12:8636825-8636847 CAGCAGCTGCATCTTGTCCATGG - Intergenic
1092652890 12:10653857-10653879 GAGCAGCTCCATCTTGAACAGGG + Intronic
1093250885 12:16803642-16803664 CAGCACCTGCATCTTCTCAGTGG - Intergenic
1096051785 12:48615896-48615918 CAGCAGCTGCACCTCCCCCAGGG + Intergenic
1097644048 12:62214733-62214755 CAGCAGGTTCATTTTTTCCAAGG - Intronic
1100670044 12:96802122-96802144 CAGCAGCTGCTGCCTGACCAAGG + Intronic
1100891562 12:99131849-99131871 TAGCAGCTGCATCTTTCCCATGG - Intronic
1102878444 12:116466036-116466058 CTTCAGATGCAGCTTGTCCAAGG - Intergenic
1104410668 12:128555015-128555037 CAGCAGCTGCTTCTGTTCCAGGG - Intronic
1104706904 12:130954464-130954486 CAGCCGCAGCAGCTTTTCCATGG - Exonic
1104858257 12:131911943-131911965 CAGCTGCTGCATCTCGCCCAGGG - Exonic
1104880463 12:132067383-132067405 CAGCAGCTGCTGCATGTGCACGG - Exonic
1106882582 13:34148184-34148206 CAGCAGCTGCATCTTCCTCATGG + Intergenic
1107542796 13:41408738-41408760 CAGCAGCTGCAGCTTCACCTGGG + Intergenic
1107632573 13:42356921-42356943 CAGCAGCTGCATCCTCACCAAGG - Intergenic
1107979492 13:45720881-45720903 CAGCAGCACAATCATGTCCAGGG - Intergenic
1110010027 13:70320795-70320817 GAGCAGCTCCATCTTGAACAGGG - Intergenic
1112301365 13:98233535-98233557 CCCCAGCTGAAACTTGTCCACGG + Intronic
1114070769 14:19104355-19104377 CACCAGGTTAATCTTGTCCATGG - Intergenic
1114091492 14:19295651-19295673 CACCAGGTTAATCTTGTCCATGG + Intergenic
1116988277 14:51244554-51244576 CAGGACCTGCCACTTGTCCAGGG - Intronic
1119423129 14:74519805-74519827 CAGCAGCTGCTGCTTATCCCAGG + Intronic
1119445314 14:74658372-74658394 CAGCAGCAGCTTCTTAACCATGG - Intronic
1119718158 14:76873363-76873385 CAGCAGCTGCAGCTTTCCCATGG + Intergenic
1120540680 14:85747087-85747109 TAGCAGCTGCATCAAGTCCTTGG + Intergenic
1122105068 14:99446806-99446828 CAGCATCTGCATCCTGCCCTCGG - Intronic
1122172614 14:99889389-99889411 CAGCCGCTGTCTATTGTCCAAGG + Intronic
1122370233 14:101225500-101225522 CACCAGCTGTATCTTGGCCAGGG + Intergenic
1123037011 14:105475630-105475652 CACCACCTGCATCCTGTCCAGGG - Intronic
1123821095 15:24031273-24031295 TGGCAGCGGCAGCTTGTCCAGGG - Intergenic
1124455665 15:29840553-29840575 CAGGAGCTGAATCTTGGGCATGG + Intronic
1125293319 15:38173918-38173940 TAACAGATGCATCTTGTCCTAGG + Intergenic
1127764555 15:62172402-62172424 CAGCAACTAAATCTTGTTCATGG + Intergenic
1127953609 15:63833919-63833941 CAGCAGCAGCGACTTGTCAAAGG + Intronic
1128812136 15:70580425-70580447 CAGGAGCTGCATCCTGCACAAGG - Intergenic
1130074835 15:80679695-80679717 GAGCAGCTCCATCTTGAACAGGG - Intronic
1130980910 15:88811372-88811394 CAGCAGCTGCACCCAGGCCAAGG + Intronic
1131672283 15:94632405-94632427 CAGAAGGTGAATCTTGTACAAGG - Intergenic
1132029157 15:98426568-98426590 CTGCACCTGCATCTGGTCCTTGG + Intergenic
1132575507 16:662016-662038 CGGCCGCTGCTTCTTGTCCTGGG + Exonic
1134685659 16:16156454-16156476 GAGCAGCTGCCTCTCGGCCAGGG - Intronic
1135217439 16:20585134-20585156 CAGCCACTGCACCTAGTCCAGGG + Intergenic
1135467760 16:22701898-22701920 AAGCTGCTGCATCTTTCCCAAGG - Intergenic
1135544133 16:23354436-23354458 CAGCAGCAGCCTCGTGGCCAAGG + Intronic
1141105735 16:81232156-81232178 CAGCTGCTGCTTCATGTCGATGG + Intergenic
1141469699 16:84229983-84230005 CAGGAGCTGGCTCTTGTACAGGG + Intronic
1141478799 16:84292562-84292584 TAGCAGCTCCATCATGTCCGTGG + Intergenic
1141602101 16:85133366-85133388 CAGTAGCTGCTTCTTGTCAGGGG + Intergenic
1141676676 16:85521448-85521470 CTGCAGCAGAATCCTGTCCAGGG + Intergenic
1142106449 16:88306154-88306176 CAGAAGCAGCCTCCTGTCCATGG + Intergenic
1142575836 17:906951-906973 CAGCAGCAGCATCTTTTCTTTGG + Intronic
1142770243 17:2091524-2091546 CAGGAGATGCATCTGGTCCAAGG - Intronic
1143987382 17:10926566-10926588 CAGCAGCTTCACCCTTTCCAAGG + Intergenic
1147693979 17:42337799-42337821 CAGCTGCTGCATCTTCTGCCTGG + Exonic
1148124676 17:45230620-45230642 CAGCAGCTGGACCTTGTCTGGGG - Exonic
1149213180 17:54326696-54326718 CAGCAACTCCATCTTGAACAGGG - Intergenic
1150823264 17:68452915-68452937 GAGCAGCTGGATCAAGTCCACGG - Exonic
1151624256 17:75266821-75266843 CAGCAGCAGCAGCTGGGCCAGGG + Exonic
1155044113 18:22088734-22088756 TAGAGGATGCATCTTGTCCAGGG - Intronic
1155224978 18:23721505-23721527 CAGTAGCTTCATATTGGCCATGG + Intronic
1155826706 18:30453885-30453907 CAGCATCTCCATCCTGTCTATGG - Intergenic
1157628291 18:49070456-49070478 CAGAATCTGCATTCTGTCCACGG + Intronic
1159298136 18:66523418-66523440 CTGCAGCTGCACCTCCTCCAAGG - Intronic
1160825410 19:1078002-1078024 CAGCCGCCGCCGCTTGTCCAGGG - Exonic
1161569867 19:5024541-5024563 CAGCAGCTGCATCTTATGGGCGG - Intronic
1161825769 19:6563921-6563943 CAGCTGCTGCTTCTGCTCCAAGG + Intergenic
1162624549 19:11874222-11874244 CAGCAACTGCATCTAGACCTGGG - Intronic
1162629644 19:11917056-11917078 CAGCAACTGCATCTAGACCTGGG - Intergenic
1162634697 19:11958286-11958308 CAGCAACTGCATCTAGACCTGGG - Intronic
1163712053 19:18852721-18852743 CAGCAGCTGCTCCCTGGCCACGG + Intronic
1163786879 19:19279328-19279350 CAGCAGCTGCATGTCCTGCATGG + Exonic
1165989732 19:39803342-39803364 CAGCAGCATCAGCTTGACCAGGG + Intergenic
1166135027 19:40771253-40771275 CAGCAGCTGCAACTGGCTCAGGG - Intergenic
1166401883 19:42487669-42487691 GAGCAACTGCATCTTGAACAGGG - Intergenic
1166997919 19:46728525-46728547 CCGCAGCTGCTTCCTGTACAGGG - Intronic
1167834937 19:52060745-52060767 TAGCAGCAGCAGCTCGTCCAGGG + Intronic
927149382 2:20186976-20186998 CCGCAGCTGCTTCATGTACATGG - Intergenic
927813675 2:26195185-26195207 CAGCAGCTGCATCTTGTCCACGG + Exonic
928173265 2:29017179-29017201 CTTCAGCTGCATCTTCTCCCGGG - Exonic
928768835 2:34680609-34680631 CAGGAGATGCAGCTTCTCCATGG - Intergenic
929946835 2:46378066-46378088 CAGCAGCAGCAGCTGCTCCACGG + Exonic
930013747 2:46956963-46956985 CAGCAGCCGCATCTGATACAGGG - Exonic
930065746 2:47326298-47326320 GAGCAGAAGCAACTTGTCCAAGG - Intergenic
930143919 2:47981757-47981779 CAGCAGCTGCCCCTGGTGCATGG + Intergenic
931284024 2:60817759-60817781 TTGCAGCTGCATCTTTTCCAGGG + Intergenic
932189826 2:69731431-69731453 AAGCAGCTGCAAATAGTCCAGGG - Intronic
938989410 2:136612497-136612519 CAGCAGCTGCTTCTTGGGCATGG - Intergenic
939951926 2:148485837-148485859 CAACAGCAGCAACTTCTCCAGGG + Exonic
944017668 2:195063278-195063300 GGTCAGCTGCTTCTTGTCCATGG - Intergenic
944500347 2:200352987-200353009 CAGCATCTACATGTTGTACATGG + Intronic
945854784 2:215056239-215056261 CAAAAGCTGCATCTGCTCCACGG + Intronic
948334825 2:237199886-237199908 GAGCAGCTGCATCTAGACAAGGG + Intergenic
948524066 2:238559667-238559689 CAGGAGCTGTAACGTGTCCACGG + Intergenic
948987131 2:241532638-241532660 CAGAAGCTGCAGCTTGGCCTTGG + Intergenic
1168946992 20:1769245-1769267 CACCAGCAGCAGCTTTTCCAGGG + Intergenic
1168967848 20:1910060-1910082 CAGCAGGAGCCTCTTGCCCAGGG + Intronic
1170211684 20:13851641-13851663 AAGCAGCTCCACCTTGTCTACGG - Intronic
1170451571 20:16489216-16489238 CAGCAGGTACCTCTTCTCCAAGG - Intronic
1172272707 20:33663554-33663576 CAGCGGCTGCCGCTTGTCCAGGG - Exonic
1172649671 20:36493723-36493745 CAGCAGCCGCATCTGCTCCACGG - Intronic
1173741024 20:45402048-45402070 CAGCATCTGCATCTTGCACCTGG + Intronic
1174061277 20:47834703-47834725 CAGCAGCACCATCTTCTCCCTGG + Intergenic
1174070250 20:47894620-47894642 CAGCAGCACCATCTTCTCCCTGG - Intergenic
1174156144 20:48516606-48516628 CAGCAGCACCATCTTCTCCCTGG + Intergenic
1175524141 20:59621885-59621907 CAGGAGCTGCCTCTTGTCTCTGG - Intronic
1175799390 20:61792431-61792453 CAGCAGCTGCATCTTGGAAGAGG - Intronic
1176029762 20:63006235-63006257 CAGGCGCCGCATCTCGTCCAGGG + Exonic
1177485636 21:21751703-21751725 ACACTGCTGCATCTTGTCCAAGG + Intergenic
1178726514 21:35057260-35057282 AACCAGGTTCATCTTGTCCATGG - Intronic
1178877720 21:36425504-36425526 CTGCAGCTGCCTCTGGTTCACGG - Intergenic
1178905548 21:36633090-36633112 CAGCAGGTGCCTCTTCTGCATGG - Intergenic
1179516817 21:41914240-41914262 CAGAAGCTGCACCTTGGTCAAGG + Intronic
1179674349 21:42971948-42971970 AAGCAGCTGCAGCAAGTCCAGGG - Intergenic
1180489233 22:15826820-15826842 CACCAGGTTAATCTTGTCCATGG - Intergenic
1181617856 22:24067024-24067046 CAGCCGCTGAATCTCCTCCAGGG - Exonic
1181825340 22:25510717-25510739 CAGCAGCTGCCTCTTCAGCATGG - Intergenic
1183381849 22:37494153-37494175 CACCAGCCGCAGCTGGTCCAGGG + Exonic
1183816181 22:40302696-40302718 CAGCCGCTGCCATTTGTCCAGGG - Intronic
1184352169 22:43951699-43951721 CAGCAGCTGCAGCTGGGCCTTGG - Intronic
1184681621 22:46075185-46075207 CAGGTGCTGCCTCGTGTCCAGGG + Intronic
1185327436 22:50233924-50233946 CAGCATCTACACCCTGTCCATGG + Intronic
950220879 3:11195243-11195265 CAGAAGCTGCCTGTTTTCCAAGG - Intronic
952347737 3:32504068-32504090 CAGCTGCTACATCTTCTCCGTGG + Intergenic
952507663 3:34022128-34022150 CAGGAGATGCAACTTGCCCAAGG + Intergenic
953968344 3:47327394-47327416 CAGAAGCTGGATCAAGTCCAAGG - Intronic
954802373 3:53194638-53194660 CAGCAGCTGCTTCCTGTCCTGGG - Intergenic
954871281 3:53769258-53769280 CAGCAGCTCCACCTCCTCCAGGG - Intronic
955467169 3:59249320-59249342 CAGCAACTGAATCATGTGCAGGG + Intergenic
956008516 3:64805710-64805732 CAGCTGATGCTTCTTGTCCAGGG - Intergenic
959159672 3:102708106-102708128 CAGAAGCTGCAGCTTGTCATTGG + Intergenic
960791093 3:121431938-121431960 CAGCAGCTTCATTTTCTTCATGG + Exonic
962454082 3:135549123-135549145 CAGAAGTTGAATCTTGTCCATGG - Intergenic
963269742 3:143274019-143274041 CAGTTGTTGCATCTTGTCTAAGG + Intronic
966460032 3:180166185-180166207 CAGCAGCTGCAGTTTCTCCTGGG - Intergenic
966748448 3:183300170-183300192 CAGCAGCTGGGCCTTTTCCAGGG + Exonic
968888259 4:3348788-3348810 AAGCAGCTGCAGCTTCTCAAGGG + Intronic
972076149 4:35090126-35090148 CAGTGGCTGCATCTCCTCCAGGG + Intergenic
974346183 4:60684387-60684409 GAATAGCTGAATCTTGTCCATGG - Intergenic
976612159 4:87041322-87041344 CAGCAGCAGCAGCCTGGCCAAGG - Intronic
976985951 4:91298294-91298316 CAGCAACTGCATCTTGCCTGTGG - Intronic
977779756 4:100967029-100967051 CAGCAGCTTGTTCTTGTCCCTGG + Intergenic
980329479 4:131391450-131391472 CAACAGCAGCATTTTGTCTACGG + Intergenic
980685504 4:136221810-136221832 CAGTAGCTGCATTTTGTCAGTGG + Intergenic
982783537 4:159516335-159516357 CAGTAGCTGCATCTTTTCATGGG - Intergenic
983256360 4:165404830-165404852 CAGCAGCTGCATCTTGTCTGCGG + Intronic
986052653 5:4104574-4104596 CAGCGCCTGCATCCTTTCCATGG - Intergenic
988727198 5:33937364-33937386 CAGCTGCTGCTTCTCGGCCAAGG + Exonic
989983206 5:50667064-50667086 TAGCGGCTGCTTCTTTTCCAGGG + Exonic
990237673 5:53784969-53784991 GAGCAGGAGCAGCTTGTCCAGGG - Intergenic
990832507 5:59975279-59975301 CCTCAGCTACATCTTTTCCAAGG + Intronic
993281940 5:85936190-85936212 CAGCAGTTTCATTGTGTCCATGG + Intergenic
993838363 5:92843969-92843991 CAGCAGCTTCCTGATGTCCAGGG + Intergenic
995732883 5:115264885-115264907 CAGCAGCAGCTTCTTGGCCATGG + Intergenic
996085571 5:119301459-119301481 CAGCAGCTGCTTCTTTCCCTGGG + Intronic
997103780 5:130995633-130995655 CAGCAGCTGCATATCCTGCATGG - Intergenic
997602392 5:135149620-135149642 CACGAGCTGCATCCTGTGCATGG + Intronic
997980668 5:138465772-138465794 CATCAGCTGCATCTCGGCCTTGG - Exonic
998328797 5:141305246-141305268 CAGCAACTCCATCTTGACTAGGG + Intergenic
999273030 5:150309081-150309103 CATTATCTGCATCTTGCCCATGG + Intronic
999399060 5:151250436-151250458 CAGCAGCAGCAGCTCATCCAGGG - Intronic
1000045794 5:157521091-157521113 AAGCAGCTGCCTCCAGTCCAAGG - Intronic
1000380063 5:160620891-160620913 GAGCTGCTGAATCTTCTCCAGGG + Exonic
1001216732 5:169863539-169863561 CAGCAGCTGTAGCTGTTCCAGGG - Intronic
1001694433 5:173659531-173659553 CAGAAGCTGCATCTCTCCCAAGG - Intergenic
1001838131 5:174849612-174849634 CAGCAGCTGCAGCATGGACACGG - Intergenic
1002302167 5:178263297-178263319 CAGCAGCTCCATCTTGTCCTTGG + Exonic
1002468899 5:179422943-179422965 CAGCATCTGCATGGTGTCCTCGG - Intergenic
1003508623 6:6760983-6761005 CAGTAACTGCATTTTGCCCACGG - Intergenic
1005022217 6:21429299-21429321 CAGCAGCTGCATCCACCCCAGGG - Intergenic
1006730145 6:36230473-36230495 CAGCATCTTGAGCTTGTCCACGG - Exonic
1007501830 6:42304430-42304452 CAACAGCTGCCACTTATCCAGGG - Intronic
1011930904 6:92711272-92711294 CAGCATCTGCAACTTGTACTGGG - Intergenic
1013178353 6:107696896-107696918 CGGCAGCTGCACCTTTTCCCTGG - Intergenic
1013706376 6:112839742-112839764 CAGCAGCTTTATCTTTTCTATGG + Intergenic
1014024866 6:116633957-116633979 CATCAGCTGCATCCTGGCAAAGG + Intergenic
1018808339 6:167278440-167278462 CAGCAGCGCCATTTTGGCCATGG - Intronic
1020342664 7:7129424-7129446 CAGCACATGCAACTTGTACAAGG + Intergenic
1022711641 7:32856320-32856342 CAGCAGCAGCATCTTTCCTATGG + Intergenic
1022762136 7:33366113-33366135 CAGCAGCTACTTCTTGAGCAAGG + Intronic
1022898240 7:34774529-34774551 CAGCTGTTCCATCTTGACCAAGG + Intronic
1022913017 7:34918639-34918661 CAGCAGCAGCATCTTTCCTATGG - Intergenic
1024025528 7:45406942-45406964 CAGCAGCTGTATCTTGTCTATGG + Intergenic
1024360091 7:48459267-48459289 GAGCAGCTCCATATTGCCCAAGG + Intronic
1025233145 7:57216365-57216387 CAGCAGCACCATCTTCTCCCTGG - Intergenic
1026867028 7:73830310-73830332 CTGAAGGTGCATCATGTCCAAGG + Exonic
1027589194 7:80096604-80096626 CAGAACCTGCCACTTGTCCAAGG + Intergenic
1028269647 7:88773007-88773029 CAGCAGCTGCTTCCTGTTCATGG - Intronic
1029123220 7:98281794-98281816 CAGCAGCGGCTTGTGGTCCATGG - Exonic
1029260165 7:99296720-99296742 GAGCCTCTGCTTCTTGTCCAGGG - Intergenic
1029425009 7:100489472-100489494 CTGCAGCTGGATCTTGACCATGG - Exonic
1029562883 7:101315254-101315276 CACCAGCTTCAGCTTGTTCAAGG + Exonic
1030522925 7:110620524-110620546 CAGCAGCAGCATCTTCTCTGCGG + Intergenic
1031084953 7:117293296-117293318 CAGCAACTGCTTCCTGTCCAAGG - Intronic
1033149398 7:138900078-138900100 TAGCAGCTGCATGTTGCCAATGG - Intronic
1033238750 7:139659485-139659507 CTGCAGCTGCAGCTTGTGCACGG + Intronic
1034789103 7:153951563-153951585 CAGCAGCTGCAGCATGTCAGTGG - Intronic
1034867770 7:154656456-154656478 CAGCAGCCGCAGCATGTGCAGGG + Intronic
1035023499 7:155812111-155812133 CAGCAGCAGCATCTCGCCCATGG + Exonic
1035979861 8:4358284-4358306 CACCAGCTGGATCTGGCCCATGG - Intronic
1036408707 8:8478824-8478846 CACCAGCTGCATCTTTCCCAGGG - Intergenic
1037956983 8:23068036-23068058 TAGCAGCTGCATTTTGGCCTGGG - Intronic
1038421299 8:27435696-27435718 CACCAAGGGCATCTTGTCCACGG + Intronic
1038883754 8:31640590-31640612 CAGCAGGTACATCTTCTTCATGG + Intronic
1041798549 8:61772734-61772756 CAGCAGCTTCAGCTTCTCCTGGG - Intergenic
1042758518 8:72245120-72245142 AATCAGCTGCATCTTTTCTATGG + Intergenic
1043504288 8:80887197-80887219 CAGCAGCTGCTGCTGGTCCATGG - Intergenic
1044138149 8:88612717-88612739 CAGCAGCAGCAGCTTTTCCTAGG - Intergenic
1045353794 8:101366746-101366768 CACCAGGTTGATCTTGTCCATGG + Intergenic
1046016827 8:108615421-108615443 CAGCTGCTTCTTCCTGTCCAAGG - Intronic
1047343967 8:124009541-124009563 CAGCAGCACCATCTTCTCCCTGG - Intronic
1047594603 8:126365706-126365728 CAGCAGCTTCATCCTGGTCAGGG + Intergenic
1048876825 8:138843191-138843213 CAGCATCTGCATCTTGTGCCTGG - Intronic
1049196112 8:141316537-141316559 TCCCAGCTGCATCTTGTCTAGGG + Intergenic
1049263169 8:141650697-141650719 CAGCAGCTGCCTCTGGCCCCCGG - Intergenic
1049557567 8:143290806-143290828 CAGGAGGTGCATCTTGCCCGGGG + Intronic
1049643812 8:143727334-143727356 CAGCAGCTGCACCTTCTCAGTGG + Exonic
1049798449 8:144506927-144506949 CAGCAGCCGCAGTTTCTCCAAGG - Exonic
1050069549 9:1796020-1796042 CAGCTGCTGCATTTTGGTCAAGG + Intergenic
1051038419 9:12776562-12776584 CAGCAGCCGCAGCTGTTCCAAGG + Intronic
1051220895 9:14847186-14847208 CAGCAGTTGCATCTTCTCCCTGG + Intronic
1053420495 9:37974585-37974607 CAGCAGCTGCCTCCTGAGCAGGG + Intronic
1055010929 9:71564228-71564250 CAGCAGCAGCACCTTGACAAAGG + Intergenic
1055993393 9:82131373-82131395 CAGCAGCAGCTTCTTGGGCATGG - Intergenic
1056090070 9:83196529-83196551 CAGCATCTTCATCTTATCAAGGG - Intergenic
1056528601 9:87467330-87467352 CAGCAACTCCATCTTGACTAGGG + Intergenic
1056881620 9:90399129-90399151 CAGAGTCTGCATCTTGTCTATGG + Intergenic
1057725095 9:97562787-97562809 CAGCAGCTCCATCATGAACAAGG + Exonic
1058981670 9:110176172-110176194 CAGCAGCAGCAGCATCTCCAGGG - Intergenic
1060136341 9:121158912-121158934 GAGGAGCTGCATCTACTCCAAGG + Exonic
1060235589 9:121860409-121860431 CAGCAGCAGCAGCCTGTCCATGG - Exonic
1061251438 9:129428710-129428732 CAGCTGCTGCACCTTCCCCAGGG - Intergenic
1061673466 9:132202307-132202329 CAGCAGCTGCAGCCAGCCCAGGG + Intronic
1062606072 9:137349418-137349440 CAGCTGCTGCGTCTTGTCCAGGG + Exonic
1203785349 EBV:124507-124529 CAGCAGATGCCTCTTGAACATGG + Intergenic
1187682151 X:21778391-21778413 CAGCTGCTGCAGCTTCCCCAAGG + Intergenic
1188835458 X:34948720-34948742 CAGCAGCTGCTGCTGGTACATGG + Intergenic
1190421073 X:50285132-50285154 ATTCAGCTGCGTCTTGTCCAAGG - Exonic
1192001866 X:67159630-67159652 CAGCACCTGCATCTTGCTCAAGG - Intergenic
1192126115 X:68502459-68502481 CAGCAGCAGCAGCATCTCCAGGG - Intronic
1193872143 X:86812892-86812914 AGTCAGCTGTATCTTGTCCAAGG - Exonic
1200161584 X:154012548-154012570 CAGCAGCTGCAGGCTGTCCAGGG + Exonic
1201501338 Y:14646232-14646254 CAGCAGCTGCATTTTGAATATGG - Intronic