ID: 1092456581

View in Genome Browser
Species Human (GRCh38)
Location 12:8649255-8649277
Sequence CTGTGGGGTTACAATCTAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092456576_1092456581 11 Left 1092456576 12:8649221-8649243 CCAGAGTGTCAGAAAGCTCTCTA 0: 1
1: 0
2: 0
3: 11
4: 120
Right 1092456581 12:8649255-8649277 CTGTGGGGTTACAATCTAGTAGG 0: 1
1: 0
2: 1
3: 19
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092456581 Original CRISPR CTGTGGGGTTACAATCTAGT AGG Intronic
901154115 1:7123970-7123992 CTGTGGGGTGACATTCTCATGGG - Intronic
901358137 1:8670434-8670456 CAGAGAGATTACAATCTAGTGGG + Intronic
903028333 1:20445136-20445158 CCGTGGGCTCACCATCTAGTTGG - Intergenic
908986942 1:70035805-70035827 CTGGGAGTTTATAATCTAGTTGG - Intronic
909606456 1:77513358-77513380 CAGAGAGGTCACAATCTAGTGGG - Intronic
911558405 1:99374421-99374443 CTATGGGGTTACAATCTTCCCGG - Intergenic
912565286 1:110583229-110583251 CTTGGGGCTTACATTCTAGTGGG + Intergenic
914390530 1:147217871-147217893 CAAGGGGCTTACAATCTAGTTGG - Intronic
918591696 1:186247770-186247792 CTATGGGGTTACAATCTTCCCGG - Intergenic
920224257 1:204426636-204426658 CAGGGGGCTTACATTCTAGTTGG - Intronic
924805761 1:247360359-247360381 CTGTGGGGTTACAATCTTCCCGG - Intergenic
1064575068 10:16736531-16736553 CTGTTGGGTTTCATTCTAGCAGG - Intronic
1065915907 10:30354828-30354850 CCTGGGGCTTACAATCTAGTTGG + Intronic
1066343134 10:34555934-34555956 CTGTGGAGAGATAATCTAGTTGG - Intronic
1068004845 10:51380846-51380868 CTATGGGGTTACAATCTTCCTGG - Intronic
1068904102 10:62303267-62303289 CTGTGGACTTACAGTCTAGTAGG + Intergenic
1070041743 10:72787655-72787677 CTAAGAGGTTACAATCTAATTGG - Intronic
1070450435 10:76552427-76552449 CTGTGGGGTTACAGGCTGGATGG + Intronic
1070714173 10:78706764-78706786 CTATGGGCCTATAATCTAGTAGG - Intergenic
1071238766 10:83680561-83680583 CTGCTGATTTACAATCTAGTGGG + Intergenic
1072002985 10:91216104-91216126 CACTGGGCTTACACTCTAGTGGG + Intronic
1073261412 10:102193320-102193342 CTATGGGGTTACAATCTTCCCGG + Intergenic
1075879253 10:125835898-125835920 ATGTGGGTTTAAAATCTACTTGG + Intronic
1075925564 10:126249229-126249251 CTGTGTGGCTACATTTTAGTAGG - Intronic
1078415222 11:11159361-11159383 CTGTGGGATTAGGATCCAGTAGG + Intergenic
1079650707 11:22925322-22925344 CTTTCGGGTGTCAATCTAGTTGG - Intergenic
1083107254 11:60370037-60370059 CTGAGCGGTTACAATATCGTAGG + Intronic
1085951065 11:81331867-81331889 CTATGGGGTTACAATCTTCCCGG + Intergenic
1085968597 11:81559250-81559272 ATGTTGGGTTACAATCAAGATGG - Intergenic
1087091528 11:94278526-94278548 CTATGGGGTTACAATCTTCCTGG - Intergenic
1087851623 11:103037435-103037457 CTGTGGTCTCACAATCTATTAGG + Intergenic
1088664746 11:112083450-112083472 CTGTGGGGTCAAAATATAGAAGG - Exonic
1089221402 11:116875054-116875076 CTCTGGGGATACAATGTAGTAGG + Intronic
1089489157 11:118870978-118871000 GTGCAGGGTTATAATCTAGTAGG + Intergenic
1089640319 11:119843608-119843630 CCTTGGGGTTAAAATCTGGTTGG + Intergenic
1090353449 11:126122823-126122845 CTGTGGTGTTACCATCTTTTAGG + Intergenic
1092456581 12:8649255-8649277 CTGTGGGGTTACAATCTAGTAGG + Intronic
1093754814 12:22840957-22840979 CTGAGAGTTTATAATCTAGTAGG + Intergenic
1096169861 12:49459193-49459215 CTATGGGGTTACAATCTTCCTGG - Intronic
1096501864 12:52069077-52069099 CTCTGGGCTTACAATCTACATGG + Intergenic
1097298413 12:57991983-57992005 CTGAAGGTTTACAGTCTAGTTGG - Intergenic
1098422694 12:70318675-70318697 CAAGGGGCTTACAATCTAGTGGG - Intronic
1102068387 12:109997699-109997721 CTGAGGGGTTACTATCCAGCAGG - Intergenic
1103269419 12:119660400-119660422 CTGAGTGTTTACGATCTAGTAGG - Intergenic
1103622529 12:122197103-122197125 CTATGGGGTTACAATCTTCCTGG + Intronic
1106845325 13:33731974-33731996 CTATGGGGTTACAATCTTCCCGG + Intergenic
1107121054 13:36796216-36796238 CTATGGGGTTACAATCTTTCTGG - Intergenic
1108000658 13:45902809-45902831 CTGTGGGCTTAAATTCTAGCAGG + Intergenic
1110333154 13:74295581-74295603 CTGAGGGGTCACAATCACGTTGG - Intergenic
1110783406 13:79493085-79493107 CACTGAGTTTACAATCTAGTGGG - Intronic
1111586127 13:90287305-90287327 CTATGGGGCTACAATCTTCTGGG - Intergenic
1112926680 13:104683934-104683956 CTGGGTATTTACAATCTAGTGGG - Intergenic
1115784785 14:36812877-36812899 CTGTTGGGTTCCATTCCAGTTGG - Intronic
1116099112 14:40410045-40410067 CTATGGGGTTACAATCTTCCTGG - Intergenic
1117130681 14:52683571-52683593 CTCTAGAGTTAGAATCTAGTTGG - Intronic
1117518999 14:56531518-56531540 CTATGGGGTCACAATCTTCTTGG - Intronic
1117575328 14:57091890-57091912 CTGAGGGGTTGCAATTTAATTGG + Intergenic
1121226737 14:92326781-92326803 CTGTGGGGTTTTAATATAGATGG + Intronic
1121370154 14:93349452-93349474 CTATGGGGTTACAATCTTCCTGG + Intronic
1121389941 14:93565179-93565201 CTGTGGGGTTACAATCTTCCTGG + Intronic
1122104557 14:99442393-99442415 CAGTGGGCTTACATTCAAGTTGG + Intronic
1127643591 15:60938217-60938239 CTGTGGTATTACAATCTCATGGG + Intronic
1128260626 15:66230335-66230357 CAGAGGGCTTACAATCTAGTGGG - Intronic
1129367223 15:75063731-75063753 CTATGGGGTTACAATCTTCCCGG - Intronic
1129801303 15:78416802-78416824 CTGTGGGGTCACAATCTTCCTGG + Intergenic
1130925899 15:88385625-88385647 CTGTAGGTTTACAATCTGGGTGG + Intergenic
1132868377 16:2104755-2104777 CTGTGGGGGTCCAGTCAAGTGGG - Intronic
1134710946 16:16326730-16326752 CTGTGGGGGTCCAGTCAAGTGGG + Intergenic
1134948637 16:18341879-18341901 CTGTGGGGGTCCAGTCAAGTGGG - Intergenic
1135412879 16:22248428-22248450 TTGTGGGGTTACAGTCCAGTGGG + Intronic
1135975620 16:27107481-27107503 CTATGGGGTTACAATCTTCCCGG - Intergenic
1139155614 16:64438051-64438073 CTGTGGGGTTACAATCTTCCCGG - Intergenic
1140836132 16:78795694-78795716 CTCTGGGGATTCATTCTAGTGGG + Intronic
1142327275 16:89424014-89424036 CTATGGGGTTACAATCTTCCCGG - Intronic
1146451027 17:32974118-32974140 CTGTGGGGTTACAATCTTCCCGG - Intronic
1150713981 17:67555945-67555967 ATTTGGGGTCACAATCTGGTTGG + Intronic
1150722850 17:67628285-67628307 TTGAGAGGTTACCATCTAGTAGG - Intronic
1155188210 18:23405839-23405861 CTGTGCTGTCACAATCCAGTGGG + Intronic
1159234348 18:65651643-65651665 CTATGGGGTTACAATCTTCCTGG - Intergenic
1159454747 18:68646609-68646631 CTGTGGGGTTACAATCCTTGTGG - Intergenic
1160142548 18:76338531-76338553 CTGGGGGGTTACAATCTTCCTGG + Intergenic
1160391651 18:78538687-78538709 CTGTGGGGTTACAATCTTCCCGG + Intergenic
1161560829 19:4971633-4971655 CTGTGGGTTTAGAGTGTAGTGGG + Intronic
1162905898 19:13823698-13823720 CTGTGGAATGACATTCTAGTGGG + Intronic
1165752976 19:38272358-38272380 CTGTGGTGTTAAAATTTTGTGGG + Intronic
925608509 2:5683594-5683616 CTGTGGGCTTTCAATTTGGTGGG + Intergenic
925678212 2:6388676-6388698 CTGTGGGGTTGCAATCTATTAGG + Intergenic
926054158 2:9764364-9764386 CTGTGGGGTGACAATCTTCCTGG - Intergenic
929795490 2:45055579-45055601 TTGTGGGGTTACAATCCTGCTGG - Intergenic
930669258 2:54131050-54131072 CTAAGAGTTTACAATCTAGTGGG - Intronic
931764494 2:65442783-65442805 CAGTAAGCTTACAATCTAGTGGG - Intergenic
932731075 2:74222365-74222387 CTCTGGGGTTTCCATCTGGTTGG + Intronic
935156266 2:100486214-100486236 CTGTGGGGTTAGAAGCAAGATGG + Intergenic
935975749 2:108576778-108576800 CTCAGAGGTTATAATCTAGTAGG + Intronic
938562920 2:132490530-132490552 TTGTGGAGTTAACATCTAGTCGG + Intronic
939016130 2:136905331-136905353 CTCTGAGTTTACCATCTAGTTGG + Intronic
940510445 2:154607317-154607339 CAGTGGGGATGCAATCAAGTTGG - Intergenic
942186269 2:173427606-173427628 CATGGAGGTTACAATCTAGTGGG + Intergenic
943440296 2:187919251-187919273 CTATGGGGTTACAATCTTCCTGG + Intergenic
943954029 2:194162911-194162933 CTATGGGGTTACAATCTCCTTGG + Intergenic
944713424 2:202356256-202356278 CTGTGGGGATACAAACAAGAAGG + Intergenic
945779354 2:214149166-214149188 CTGTGGGGTTACAAAGCTGTGGG + Exonic
945896105 2:215483328-215483350 TTGTGGATTTATAATCTAGTTGG - Intergenic
946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG + Intronic
946786653 2:223252415-223252437 CAATGAGTTTACAATCTAGTTGG - Intergenic
1170137960 20:13095962-13095984 CTGAGGGCTTGGAATCTAGTAGG + Intronic
1181063935 22:20296598-20296620 CTATGGGGTTACAATCTTCCAGG + Intergenic
1181506994 22:23365714-23365736 CTGAGCGCTTACACTCTAGTGGG - Intergenic
1181677081 22:24462409-24462431 CTGGGGAGTTAGAATCTAGGTGG + Intergenic
1183040740 22:35175927-35175949 TCGTGGGTTTACAATCTGGTGGG + Intergenic
949292155 3:2479573-2479595 CTATGGGGTTACAATCTTCCCGG - Intronic
949554447 3:5141016-5141038 CTATGGGGTTACAATCTTCCTGG + Intronic
949991564 3:9583473-9583495 CAGTGGGGATACAAACCAGTTGG - Intergenic
953853933 3:46486270-46486292 CTATGGGGTTACAATCTTCCTGG - Intergenic
955540765 3:59973636-59973658 CAGGGAGGTTACAATCTAGTGGG - Intronic
958774319 3:98463038-98463060 CTGTGCTCTTACAATTTAGTAGG + Intergenic
960580565 3:119275113-119275135 ATGTGGGTTTGCCATCTAGTGGG - Intergenic
961581461 3:127886758-127886780 CTGTGAGGTTAGAATCAAGATGG - Intergenic
962630864 3:137274200-137274222 CTTTTGGGTTAAAGTCTAGTGGG - Intergenic
963967598 3:151390063-151390085 TTGTGGGGTTACAACCTCGTGGG + Exonic
965435874 3:168650672-168650694 CTGTGGGGTCACAGTGTTGTGGG + Intergenic
973191329 4:47389181-47389203 CTGTGGGGTTACAATTTTCCTGG + Intronic
979274693 4:118802031-118802053 CTCTGGCTTCACAATCTAGTTGG + Intronic
979458636 4:120954249-120954271 CTATGGGGTTAAAATATGGTTGG - Intergenic
981130530 4:141153745-141153767 CTGTGGTCCCACAATCTAGTTGG - Intronic
981526860 4:145715353-145715375 CTGTGGGGTGAGAAACAAGTGGG + Intronic
982051306 4:151505142-151505164 CTTTTGTGATACAATCTAGTGGG - Intronic
982521953 4:156429107-156429129 CTTGGAGTTTACAATCTAGTGGG + Intergenic
984386873 4:179072150-179072172 CTGTGGGGTTATACTATAGCAGG - Intergenic
986501932 5:8409815-8409837 CTTGGGGCTTACATTCTAGTGGG - Intergenic
988837882 5:35051186-35051208 CTTGGGGATTACAGTCTAGTGGG - Intronic
989697794 5:44224322-44224344 CTGGGGGCTTATATTCTAGTTGG + Intergenic
994323858 5:98426096-98426118 TAGTGGGGTTAGAATATAGTGGG + Intergenic
995129952 5:108619845-108619867 CTATGGGGTTACAATCTTCCCGG + Intergenic
997295955 5:132768528-132768550 GAGTGGGGTTACAACCTAGGAGG + Intronic
998867651 5:146521411-146521433 TTGAGGAGCTACAATCTAGTGGG + Intergenic
1005739497 6:28777004-28777026 CTATGGGGTTACAATTTTCTCGG - Intergenic
1009885367 6:69618104-69618126 CTATGGGGTTACAATCTTCCTGG + Intergenic
1011158574 6:84362041-84362063 TTGTGGTGAAACAATCTAGTAGG + Intergenic
1011243421 6:85296881-85296903 CGTGGGGGTTACAATTTAGTGGG - Intergenic
1011501719 6:87997839-87997861 CTGTGGGGTTACAATCTTCCCGG + Intergenic
1012134623 6:95540863-95540885 CTATGGGGTTATCATCAAGTGGG + Intergenic
1012723657 6:102781987-102782009 CTGTGGGGTTACAATCTTCCTGG + Intergenic
1014023575 6:116618353-116618375 CTGGGGGCCTCCAATCTAGTGGG - Intronic
1018449338 6:163892531-163892553 CTGTGGGCTTGCAGTCTTGTGGG - Intergenic
1021454797 7:20818197-20818219 CTATGGGGTTACAATCTTCCCGG - Intergenic
1023418856 7:39957400-39957422 CTAGGAGCTTACAATCTAGTAGG - Intronic
1026124447 7:67567274-67567296 CTATGGGGTTACAATCTTCCCGG + Intergenic
1032343574 7:131098866-131098888 CTGTGGGGCTGGAATCTGGTAGG - Intergenic
1032364721 7:131288118-131288140 CTGTGGGGTAACATCCTTGTCGG - Intronic
1034571939 7:151963292-151963314 CTGTGGTGTTTCATTCTAGAAGG - Intronic
1034979310 7:155466302-155466324 CTGTGGGGTAACAGTCTGGCCGG - Intergenic
1035780274 8:2222506-2222528 CTGTGGGGTCACAATCTTCCTGG - Intergenic
1036522610 8:9505951-9505973 CTGGAGTGTTACAATTTAGTGGG - Intergenic
1037680751 8:21095593-21095615 CTGTGGGGCTACAGCCTAGTAGG - Intergenic
1038123797 8:24648318-24648340 ATGTGGTATTACAATCTCGTGGG + Intergenic
1042934956 8:74049116-74049138 TTGTGGAGATACAGTCTAGTGGG - Intergenic
1043861048 8:85317504-85317526 CTGTGAAGTTATAATCTATTTGG - Intergenic
1044347020 8:91117197-91117219 CTGTTTAGATACAATCTAGTAGG + Intronic
1044510573 8:93073652-93073674 CTGTGGTGGTACAATTTAGTAGG + Intergenic
1044677808 8:94747448-94747470 GTGTGGTGTTAACATCTAGTTGG - Intronic
1044998741 8:97861651-97861673 CTGTGAGTTTATAATCTACTGGG - Intergenic
1045628585 8:104087306-104087328 CTGGGAGTTTATAATCTAGTGGG + Intronic
1050354603 9:4770886-4770908 TTGTGGTGCTACAATCTAGTGGG - Intergenic
1052011787 9:23419354-23419376 CAGTGGGGTTCCAACCTGGTTGG - Intergenic
1053393860 9:37754601-37754623 CCCTGGGTTTATAATCTAGTGGG + Intronic
1058215311 9:102225771-102225793 CTGTGGTGTTACAATATACTTGG - Intergenic
1059911481 9:119049286-119049308 TTGTGTGGCTACAATCTACTTGG + Intergenic
1062199748 9:135296054-135296076 CTGTGGGGTCACAATCTTCCTGG - Intergenic
1186387779 X:9127481-9127503 CAGTGGGGATACTATCTGGTAGG - Intronic
1188041187 X:25371317-25371339 TTGGAGGATTACAATCTAGTTGG + Intergenic
1193049648 X:77086469-77086491 CTATGGGGTTACAATCTTCCCGG - Intergenic
1194994493 X:100576979-100577001 CTATGGGGTTACAATCTTCCTGG + Intergenic
1195021708 X:100834771-100834793 CCATGGGCTTACATTCTAGTTGG + Intronic
1195287847 X:103402775-103402797 CTGTGGGGCTACACTCCACTGGG - Intergenic
1196724557 X:118884786-118884808 CTGTGGGGTTACAATCTTTCTGG - Intergenic
1197576685 X:128221148-128221170 CAGTGGGGTTCCAAACTAATTGG - Intergenic
1197976406 X:132170389-132170411 CTGAGAGCTTACATTCTAGTGGG + Intergenic
1199000765 X:142633536-142633558 TTGTGAGATTACAACCTAGTAGG + Intergenic
1199428380 X:147730228-147730250 TTCTGGGGTTAGAATCTGGTTGG - Intergenic
1199924490 X:152448597-152448619 CTGAGGGGATACAATGCAGTGGG - Intronic
1200957849 Y:8969883-8969905 CTGTGGATCTACAATCTAGATGG + Intergenic