ID: 1092470846

View in Genome Browser
Species Human (GRCh38)
Location 12:8779262-8779284
Sequence TCACCTAATAAGTTTGAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 121}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092470846_1092470854 21 Left 1092470846 12:8779262-8779284 CCATATTCAAACTTATTAGGTGA 0: 1
1: 0
2: 1
3: 7
4: 121
Right 1092470854 12:8779306-8779328 TGGCTGCTATTGTGGGGTTTGGG 0: 1
1: 0
2: 1
3: 15
4: 186
1092470846_1092470853 20 Left 1092470846 12:8779262-8779284 CCATATTCAAACTTATTAGGTGA 0: 1
1: 0
2: 1
3: 7
4: 121
Right 1092470853 12:8779305-8779327 CTGGCTGCTATTGTGGGGTTTGG 0: 1
1: 0
2: 3
3: 40
4: 828
1092470846_1092470849 13 Left 1092470846 12:8779262-8779284 CCATATTCAAACTTATTAGGTGA 0: 1
1: 0
2: 1
3: 7
4: 121
Right 1092470849 12:8779298-8779320 TATATACCTGGCTGCTATTGTGG 0: 1
1: 0
2: 0
3: 4
4: 97
1092470846_1092470851 15 Left 1092470846 12:8779262-8779284 CCATATTCAAACTTATTAGGTGA 0: 1
1: 0
2: 1
3: 7
4: 121
Right 1092470851 12:8779300-8779322 TATACCTGGCTGCTATTGTGGGG 0: 1
1: 0
2: 0
3: 6
4: 126
1092470846_1092470855 30 Left 1092470846 12:8779262-8779284 CCATATTCAAACTTATTAGGTGA 0: 1
1: 0
2: 1
3: 7
4: 121
Right 1092470855 12:8779315-8779337 TTGTGGGGTTTGGGAACATGAGG 0: 1
1: 0
2: 1
3: 30
4: 259
1092470846_1092470850 14 Left 1092470846 12:8779262-8779284 CCATATTCAAACTTATTAGGTGA 0: 1
1: 0
2: 1
3: 7
4: 121
Right 1092470850 12:8779299-8779321 ATATACCTGGCTGCTATTGTGGG 0: 1
1: 0
2: 0
3: 14
4: 119
1092470846_1092470848 1 Left 1092470846 12:8779262-8779284 CCATATTCAAACTTATTAGGTGA 0: 1
1: 0
2: 1
3: 7
4: 121
Right 1092470848 12:8779286-8779308 CCTTATATAGCATATATACCTGG 0: 1
1: 0
2: 0
3: 9
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092470846 Original CRISPR TCACCTAATAAGTTTGAATA TGG (reversed) Intronic
902272254 1:15313130-15313152 TCACCTAAAAAGTCAGAACAAGG + Exonic
902671037 1:17973968-17973990 TCAACTAATCAGTTTGAGAAGGG + Intergenic
903087680 1:20877520-20877542 GCACCTACTAAGTTGCAATATGG - Intronic
910129815 1:83890107-83890129 CCACCTAATTAATTTGAATTCGG - Intronic
912101688 1:106215298-106215320 TCTCCTTATAAGTTTGGCTAAGG - Intergenic
912327306 1:108779736-108779758 TAGCCTAACAATTTTGAATATGG - Intronic
912942883 1:114060580-114060602 TGACCTAGGAAATTTGAATATGG + Intergenic
915635844 1:157185995-157186017 TCTGTTAATAAGTTTGAACAAGG + Intergenic
921769551 1:219020283-219020305 GTACCTCATAAGTTTGAATAGGG - Intergenic
921780427 1:219156524-219156546 TCCCCTAATAAGTTAAAATTTGG - Intergenic
922435920 1:225606483-225606505 TCAACTAATATGTTAAAATATGG - Intronic
1064844971 10:19641722-19641744 TCAACTAATGAGCTTGCATAAGG - Intronic
1064855535 10:19763405-19763427 GCATCTAATAAGTTTTGATATGG + Intronic
1079371063 11:19853065-19853087 TCACATATAAAGTTTGAACACGG - Intronic
1080893863 11:36432770-36432792 ACACCTAATAAGTCTGGATCTGG - Intronic
1081324971 11:41733227-41733249 TCACCAAATAATTGGGAATAGGG + Intergenic
1081659243 11:44877764-44877786 CCTCCTAATTAGTGTGAATAGGG + Intronic
1082107707 11:48238438-48238460 TCAATTAATAAGTTCAAATATGG - Intergenic
1091961726 12:4701275-4701297 TTGACTAATAAGTTTGAAAAAGG + Intronic
1092470846 12:8779262-8779284 TCACCTAATAAGTTTGAATATGG - Intronic
1093414025 12:18899667-18899689 TCATTTTATAAGTCTGAATAAGG + Intergenic
1094035890 12:26070907-26070929 TAACCTAATAACTTTAAGTAAGG + Exonic
1101384018 12:104240096-104240118 TCATAAAATAAGTTTGAAAATGG + Intronic
1105035136 12:132913874-132913896 TCATCTATTAAGTTTGAATATGG + Intronic
1108861881 13:54870843-54870865 AGACCTACTAAATTTGAATAGGG - Intergenic
1109628570 13:65012736-65012758 TCGCCTAACAGGATTGAATAGGG - Intergenic
1109630791 13:65043525-65043547 TCAACTAATAATCTTGAATATGG - Intergenic
1110486128 13:76045777-76045799 TCACAGAATAAGTTAAAATAAGG - Intergenic
1110875845 13:80509515-80509537 TTACGTAATATGTTTAAATATGG + Intergenic
1111041333 13:82752908-82752930 TCATTTAATTAGTTTTAATATGG + Intergenic
1111508463 13:89228005-89228027 TCACGTAGTAATTTTAAATAGGG + Intergenic
1111718222 13:91908333-91908355 TCAGTGAATAAGTTTGAACATGG + Intronic
1117212797 14:53518766-53518788 TCACCTAGTAAGTTACAATGTGG - Intergenic
1125443121 15:39724551-39724573 TCAAATAAAAAGTATGAATATGG - Intronic
1126012047 15:44312373-44312395 TCACCTACTAAGCTTGAGAAAGG - Intronic
1126464604 15:48950558-48950580 TGATCTAATAAGTTTTAAAATGG + Intronic
1139991498 16:70943460-70943482 TCACTTAATAACATTGAAAATGG + Intronic
1143209675 17:5175867-5175889 TCACCTATAAAGTTAAAATACGG + Intergenic
1143923059 17:10346253-10346275 TCTCCTAAGAATTTGGAATAGGG + Intronic
1150915886 17:69436578-69436600 CCACTTTATAAGTTTGCATAAGG - Intronic
1155187884 18:23403354-23403376 TGACCTAATCAGTGAGAATAGGG + Intronic
1156866543 18:41894931-41894953 TCACCTTATTAATATGAATAGGG - Intergenic
1159590391 18:70328070-70328092 TCTCCTAATAAGATGGAATATGG + Exonic
1162089226 19:8267915-8267937 TCCCAGAATAATTTTGAATAAGG - Intronic
1166929832 19:46295907-46295929 TCATCTATTTAATTTGAATAGGG - Intergenic
926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG + Intronic
930583277 2:53238596-53238618 ACACCTAATAAATTACAATATGG + Intergenic
932557519 2:72838287-72838309 CCACCTAGTAAGTTTTGATAAGG + Intergenic
933450946 2:82450808-82450830 CAACCTAATAAGATTGAATCAGG + Intergenic
933521088 2:83374976-83374998 TCATCTGATAAGTTTCTATAGGG - Intergenic
941152823 2:161936497-161936519 TAACCTACTAAGGTTGAATCAGG - Intronic
941549062 2:166891273-166891295 TCACTTAATAAATGTGAATGTGG + Intronic
942512209 2:176714799-176714821 TCACCCACTAAGAATGAATAGGG - Intergenic
944381240 2:199113201-199113223 TCACTTCCAAAGTTTGAATAGGG + Intergenic
945058354 2:205887572-205887594 TCATGTAATAGTTTTGAATAGGG + Intergenic
945442042 2:209891452-209891474 TAGCATAATAACTTTGAATAAGG - Intronic
945687864 2:212994335-212994357 TCTCCAAATAAGTTTTATTATGG + Intergenic
946591373 2:221252187-221252209 TCTCATAATCAGTTTGATTAAGG + Intergenic
947308023 2:228768485-228768507 TCACCATATAACTTTAAATAGGG + Intergenic
1173313565 20:41922553-41922575 TCCCATAATAAGATAGAATAAGG - Intergenic
1178262459 21:31112752-31112774 GCTCCTAATCAGTTTGAAGAAGG - Intergenic
1179415677 21:41196597-41196619 TCACCTAAGAAGGTAGCATATGG + Intronic
952167583 3:30767859-30767881 TTTCCTTATAAATTTGAATAAGG - Intronic
953164880 3:40456191-40456213 ACAACTTATAAATTTGAATAAGG + Intergenic
957475885 3:80723417-80723439 TTTCATTATAAGTTTGAATAAGG + Intergenic
962859622 3:139387654-139387676 TCACCTTATATATTTGAGTATGG + Intronic
963512349 3:146263421-146263443 AAACCTAACAAATTTGAATAAGG + Intergenic
964964050 3:162467809-162467831 CAACCTAAGAAGTTTGAAAATGG - Intergenic
967461169 3:189747984-189748006 CAACCTACTAAGGTTGAATAAGG + Intronic
971089257 4:23321288-23321310 TCACCTAATTAGTCAGAATGTGG + Intergenic
972411390 4:38799081-38799103 TAATCAAATAAGTTTTAATATGG + Intronic
973822203 4:54671633-54671655 TCAACTAATAAATTTAAATAGGG - Intronic
975390050 4:73805253-73805275 TAACCTAACAACTTTGAAAAAGG + Intergenic
977341773 4:95767539-95767561 TCTCCTAATAAGTTTGGGTTTGG - Intergenic
979347074 4:119601138-119601160 TCACCTCATTAGTGTGAATTCGG - Intronic
979909706 4:126347269-126347291 TAAACTAATAATTTTTAATATGG - Intergenic
981029697 4:140112056-140112078 TCAACTAATAAGTATAAAAAAGG - Intronic
981152335 4:141393842-141393864 TCACCTAATCATTGTGAATTGGG + Intergenic
982332724 4:154199495-154199517 AAACCTAATAAATTTTAATATGG - Intergenic
983978903 4:173970177-173970199 TCATAAAATGAGTTTGAATATGG + Intergenic
984271515 4:177553505-177553527 TATGCTAATAAGTTTTAATATGG + Intergenic
986390672 5:7284595-7284617 TCTCTTAATAAGTGTTAATAAGG + Intergenic
987645653 5:20669223-20669245 TTACCTAATAAGCTTGAGAAAGG + Intergenic
987982431 5:25103549-25103571 TTACCTAACAGATTTGAATATGG + Intergenic
989221079 5:38965267-38965289 TCAACTCATAAATTTGGATATGG - Intronic
990662912 5:58038374-58038396 TGACCTAAAAAGTTTGAAATGGG + Intergenic
993233879 5:85277767-85277789 TAACCTATTAAGATTGAATCAGG + Intergenic
993272745 5:85816057-85816079 TCCCCTAAAAAGTTTTACTAGGG - Intergenic
993864591 5:93177066-93177088 ACATCTATTAAGTTTGAATTGGG - Intergenic
996486060 5:124035881-124035903 CCACTTAATAAGTTTCAATATGG + Intergenic
1004988045 6:21105129-21105151 TCACCGAATAAGTGGGTATATGG + Intronic
1005629018 6:27689927-27689949 TCATCAAAGAGGTTTGAATATGG + Intergenic
1008320365 6:50104539-50104561 TCACAGAATAAATTTGAACATGG + Intergenic
1009268602 6:61589444-61589466 TCAGCAACTAAGTTTAAATAAGG + Intergenic
1009401688 6:63263763-63263785 TCCCCTAATGTGTTTGAATCTGG + Intergenic
1010052985 6:71530168-71530190 TCACCTAACATGATTGATTAAGG - Intergenic
1010500264 6:76590649-76590671 TCTCCTAATAATTTTGATTTTGG - Intergenic
1011121272 6:83956098-83956120 TCACCTACTAAATAAGAATAGGG - Intronic
1011932831 6:92735818-92735840 TTACCTAATAAATGTGAAGATGG - Intergenic
1013871713 6:114770498-114770520 TCACCTAATAATTTTATATGCGG + Intergenic
1014477582 6:121892335-121892357 TTACCTAAAAAGTTTCAATTAGG - Intergenic
1019761735 7:2817817-2817839 TCATCTATTAATTGTGAATAAGG + Intronic
1020887706 7:13839790-13839812 TCATCTAAATTGTTTGAATAAGG - Intergenic
1022552101 7:31250724-31250746 TCATCTAAAAAGTTCCAATATGG + Intergenic
1029502648 7:100942600-100942622 TAACCTCATAAATTTAAATATGG - Intergenic
1030410256 7:109168464-109168486 TCACTGAATAAATTTGAATTAGG + Intergenic
1030471280 7:109965514-109965536 TTACCCAATAAGTTACAATAAGG + Intergenic
1030836682 7:114295838-114295860 GCAGCTAAAAAGTTGGAATAAGG - Intronic
1035132166 7:156665424-156665446 GCAATTAATAAGATTGAATATGG + Intronic
1038885802 8:31661801-31661823 TCAACAAATAACTATGAATATGG - Intronic
1040777718 8:51067318-51067340 TCACCAAAGAAGATTGAACATGG + Intergenic
1041077147 8:54178959-54178981 TCAGCTTAAAAGTTTGGATATGG + Intergenic
1043258991 8:78173623-78173645 TCAACTTATTACTTTGAATATGG - Intergenic
1044133253 8:88553120-88553142 TCATCTAATTAAATTGAATATGG - Intergenic
1045475901 8:102552087-102552109 TAGCCTTATAAGTTGGAATAAGG + Intronic
1046391594 8:113579973-113579995 TCACTTAATAGGTTTGATTGGGG - Intergenic
1050875331 9:10627498-10627520 TCACCTAATAAATTTGAACTTGG + Intergenic
1050880051 9:10688220-10688242 TCATCGAATAATGTTGAATAAGG - Intergenic
1051713748 9:19959922-19959944 ACACCTAGTAAGTTGGGATAAGG + Intergenic
1057429749 9:94982720-94982742 GCCCCGAATAAGTTTGATTATGG - Intronic
1057783714 9:98071360-98071382 TCAGATTTTAAGTTTGAATATGG + Intronic
1188976589 X:36683087-36683109 TAACCTAATAAATATGAAAACGG + Intergenic
1191135925 X:57065115-57065137 TCATCTAGTTAGTTTGAAGATGG - Intergenic
1191683863 X:63869146-63869168 TTCCCTCATAAGTTTGTATAAGG + Intergenic
1191806487 X:65140782-65140804 CAACCTAACAAGTCTGAATAAGG - Intergenic
1193546882 X:82842412-82842434 TCACATAATAACTATAAATATGG - Intergenic
1197043948 X:121973603-121973625 ACACCTAATAAGTTTTAAGAGGG + Intergenic
1198302995 X:135349672-135349694 TAAAGTATTAAGTTTGAATAAGG - Intronic
1198955765 X:142128550-142128572 TAATCTGATAAGTTTGGATATGG - Intergenic
1201984395 Y:19949042-19949064 TAACCTAACAAGATTGAATTAGG - Intergenic