ID: 1092471554

View in Genome Browser
Species Human (GRCh38)
Location 12:8786360-8786382
Sequence TGCTAGGTTTTGAACTTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1408
Summary {0: 1, 1: 3, 2: 50, 3: 315, 4: 1039}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092471554_1092471559 18 Left 1092471554 12:8786360-8786382 CCATCCAAGTTCAAAACCTAGCA 0: 1
1: 3
2: 50
3: 315
4: 1039
Right 1092471559 12:8786401-8786423 AGACTCCATATTCCATATCCAGG 0: 1
1: 0
2: 3
3: 64
4: 607
1092471554_1092471560 19 Left 1092471554 12:8786360-8786382 CCATCCAAGTTCAAAACCTAGCA 0: 1
1: 3
2: 50
3: 315
4: 1039
Right 1092471560 12:8786402-8786424 GACTCCATATTCCATATCCAGGG 0: 1
1: 0
2: 34
3: 176
4: 660
1092471554_1092471563 30 Left 1092471554 12:8786360-8786382 CCATCCAAGTTCAAAACCTAGCA 0: 1
1: 3
2: 50
3: 315
4: 1039
Right 1092471563 12:8786413-8786435 CCATATCCAGGGCACACTGCTGG 0: 1
1: 1
2: 3
3: 40
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092471554 Original CRISPR TGCTAGGTTTTGAACTTGGA TGG (reversed) Intergenic
900892256 1:5457971-5457993 TGCTGGATCTTGACCTTGGAGGG + Intergenic
902085409 1:13856383-13856405 TGCTGGGTTTTGGACTTGCATGG + Intergenic
902115402 1:14116919-14116941 TGCTGGATTTTGGACTTGCATGG + Intergenic
902570668 1:17345173-17345195 TGCTGGATTTTGGACTTGCATGG + Intronic
904200938 1:28818680-28818702 TGCTAGGTGCTGAGCTTGGCTGG + Intronic
905808394 1:40893739-40893761 TGTTGGGTTTTGGACTTGCATGG - Intergenic
906183434 1:43840971-43840993 TGCTGGGTTTCAAACTTGCATGG - Intronic
906353654 1:45084656-45084678 TGCTGGGTTTTGGACTTGGTTGG - Intronic
906371649 1:45258852-45258874 TGCTGGGTTTTGGACTTGCATGG + Intronic
906373009 1:45270311-45270333 TGCTGGATTTTGGACTTGCATGG + Intronic
906401234 1:45506348-45506370 TTCAAGGTGTTGGACTTGGAGGG + Intronic
906763913 1:48409230-48409252 TGCTGGATTTTGGACTTGCATGG - Intronic
906937387 1:50226093-50226115 TGCTGGGTTTTGGACTTGCATGG + Intergenic
907508890 1:54943786-54943808 TGCTGGATTTTGGACTTGCATGG + Intergenic
907707720 1:56847186-56847208 TGCTGGATTTTGGACTTGCATGG - Intergenic
907749318 1:57246862-57246884 TACTGGGTTTTGGACTTGTATGG + Intronic
907808049 1:57841121-57841143 TGTTGGGTTTTGGACTTGCATGG - Intronic
908004279 1:59712151-59712173 TGCTGGATTTTGGACTTGCATGG - Intronic
908032926 1:60020561-60020583 TGCTGGGTTTTGGACTTGCATGG + Intronic
908442568 1:64169851-64169873 TGCTGGATTTTGGACTTGCATGG - Intronic
908699387 1:66881508-66881530 TGCTGGATTTTGGACTTGCATGG + Intronic
908729281 1:67209049-67209071 TGCTGGATTTTGGACTTGCATGG + Intronic
908963446 1:69729495-69729517 TGCTTGATTTTGGACTTGCATGG - Intronic
909057103 1:70834068-70834090 TGCTGGATTTTGGACTTGCATGG + Intergenic
909104835 1:71394263-71394285 TGCTGGGTTTTGAACTTTCATGG + Intergenic
909185292 1:72479645-72479667 TTCTGGATTTTGAACTTGAATGG - Intergenic
909250309 1:73344728-73344750 TGCTAGATTTCAAACTTGCACGG + Intergenic
909373403 1:74913551-74913573 CGCTGGATTTTGAACTTGCATGG - Intergenic
909439759 1:75684578-75684600 TGCTGGATTTTGGACTTGCATGG - Intergenic
909532013 1:76692347-76692369 TGCTGGGTTTTGAACTTGTGTGG - Intergenic
909579874 1:77222080-77222102 TGCTGGATTTTGGACTTGCATGG - Intergenic
909661551 1:78089085-78089107 TGGTATGTTTTTAACTTGGCTGG + Intronic
909681338 1:78295019-78295041 CGCTGGGTTTTGGACTTGCATGG + Intergenic
909773592 1:79457205-79457227 TACTAGGCTTTGAACTTGTATGG + Intergenic
909794655 1:79718812-79718834 TGCTGGGTTTTGGACTTGAATGG - Intergenic
909866953 1:80685888-80685910 TGCCAGGTTTTGGACTTGCATGG - Intergenic
910166808 1:84336938-84336960 TGCTGGATTTTGAACTTGCTTGG - Intronic
910357494 1:86377161-86377183 TGCTGGATTTTGGACTTGCATGG - Intronic
910546018 1:88420213-88420235 TGCTGGGTTTTGGATTTGCATGG + Intergenic
910623803 1:89284926-89284948 TGCTGGATTTTGGACTTGCATGG + Intergenic
910628981 1:89337588-89337610 TGCTGGATTTTGGACTTGCATGG + Intergenic
910925260 1:92391487-92391509 TGCTAGCTTTTGAATTTGTTTGG - Exonic
911023209 1:93409027-93409049 TGTTGGGTTTTGAACTTGCATGG + Intergenic
911082725 1:93949688-93949710 TGCCGGGTTTTGGACTTGCATGG - Intergenic
911235199 1:95404658-95404680 TGCTAAGTTTTGGACTTGCATGG + Intergenic
911267610 1:95761878-95761900 TGCTGGATTTTGGACTTGCACGG - Intergenic
911309558 1:96276107-96276129 TGCTAGATTTTGGACTTGCATGG + Intergenic
911331565 1:96530738-96530760 TGCTGGATTTTGGACTTGCATGG + Intergenic
911541671 1:99164521-99164543 TGCTGGATTTTGGACTTGCATGG + Intergenic
911761973 1:101627060-101627082 TGCCAGGTTTTGAAATTGTTTGG + Intergenic
911817262 1:102368792-102368814 AGCTGGGTTTTGGACTTGCATGG + Intergenic
911830932 1:102550702-102550724 TGTTAGATTTTGAATTTGCATGG - Intergenic
911893461 1:103401338-103401360 TGCTGGATTTTGGACTTGCAGGG - Intergenic
911946005 1:104109909-104109931 TAGTAGGTTTTGAAGTTGGATGG + Intergenic
911969733 1:104416309-104416331 TGCTGGATTTTGGACTTGCATGG - Intergenic
912113407 1:106372408-106372430 TGCTGGGTTTCGGACTTGCATGG - Intergenic
912121762 1:106479968-106479990 TGCTAGATTTTGGACTTGCATGG + Intergenic
912192017 1:107351931-107351953 TGTTGGGTTTTGGACTTGCACGG - Intronic
912192132 1:107352639-107352661 TGTTGGGTTTTGGACTTGCAGGG - Intronic
912983526 1:114402495-114402517 TGCTTGGTTTTGTGCTTGGAGGG + Intronic
913316529 1:117558499-117558521 TGCTAGATTTTGGACTTGCATGG - Intergenic
913337008 1:117717686-117717708 TGCTGGATTTTGAACTTGCATGG + Intergenic
913352397 1:117875763-117875785 TGATAGGTTTTGGACTTATAAGG + Intronic
913396295 1:118376080-118376102 TGCTGGATTTTGGACTTGCATGG - Intergenic
913402291 1:118449357-118449379 TGCTGGGTTTTGGACTTGCATGG + Intergenic
914857482 1:151363152-151363174 TGCTGGGTTTTGGACTTGCATGG + Intergenic
915752438 1:158224233-158224255 TGCTACATTTTGGACTTGCATGG + Intergenic
916023045 1:160810949-160810971 TGTTAGGTTTTGGACTTGTTTGG - Intronic
916286276 1:163109161-163109183 TGCTGGATTTTGGACTTGCATGG - Intergenic
916384908 1:164256080-164256102 TGCTAGGTTTTGGACTTGGATGG + Intergenic
916567509 1:165994055-165994077 TGCTAGGTTTTGGACTTGTTTGG + Intergenic
916829317 1:168474875-168474897 TGCTGGATTCTGAACTTGCATGG + Intergenic
917235550 1:172888353-172888375 TGCTGGGTTTTGGACTTGTGTGG - Intergenic
917245624 1:172997383-172997405 TGCTGGATTTTGGACTTGCATGG + Intergenic
917290920 1:173471443-173471465 TGCTGGATTTTGGACTTGCATGG + Intergenic
917696737 1:177533420-177533442 TGCTGGGTTTTGAGCTTGCTTGG - Intergenic
917892561 1:179453834-179453856 TGCTAGATTTTGGATTTGCATGG + Intronic
918304936 1:183237203-183237225 TGTTAGGTTTTGGGCCTGGATGG + Intronic
918485736 1:185026757-185026779 TGCTGGGATTTGGACTTGCATGG - Intergenic
918591853 1:186249269-186249291 TGCTGGATTTTGAACTTGCATGG - Intergenic
918614089 1:186524264-186524286 TGCTGGATTTTGGACTTGCATGG + Intergenic
918727833 1:187948089-187948111 TGCTGGATTTTGGACTTGCATGG + Intergenic
918931209 1:190859023-190859045 TGCTGGGTTTTGGACTTGTGTGG + Intergenic
919006900 1:191909857-191909879 TGTTGGATTTTGAACTTGAATGG - Intergenic
919044284 1:192431217-192431239 TGCCAGGTTTTAGACTTGCATGG + Intergenic
919177136 1:194033230-194033252 TGCTGGGTTTCAAACTTGAATGG - Intergenic
919290554 1:195624153-195624175 TGCTGGATTTTGGACTTGTATGG + Intergenic
919291859 1:195643262-195643284 TGCTGGATTTTGGACTTGCATGG - Intergenic
919388648 1:196954217-196954239 TGCTGGGTTTTGAACTTGTGTGG - Intronic
920161463 1:204001547-204001569 TGCTAGATTTTGGACTTGCTTGG + Intergenic
920785234 1:209034715-209034737 TGCTGGGTTTTGGATTTGCATGG - Intergenic
921013757 1:211168619-211168641 TGCTGGGTTTTGGACTTGCATGG - Intergenic
921618676 1:217301916-217301938 TGCTAGTTTTTATACTTTGATGG + Intergenic
921621363 1:217329712-217329734 TGTTGGTTTTTGAACTTGCACGG - Intergenic
921763246 1:218941006-218941028 TGCTGGATTTTGGACTTGCATGG + Intergenic
922069137 1:222174086-222174108 TGCTGGGTTTTGGACTTGCATGG - Intergenic
922097956 1:222458592-222458614 TGCTGGGTTTTGGACTCGCATGG + Intergenic
922773047 1:228199360-228199382 TGGTAGGTTTTTAACTGGCAGGG - Intergenic
923097216 1:230785055-230785077 TGCTGGGTTTCAAACTTGCATGG + Intronic
923172287 1:231429046-231429068 TGCTGGGTTTTGGACTTGCATGG - Intergenic
923285668 1:232492665-232492687 TGCTGAGTTTTGGACTTGCATGG + Intronic
923574929 1:235149764-235149786 TTCTAGATTGTGAACTTGCAGGG - Intronic
924396925 1:243630497-243630519 TGCTGGGTTTAGAACTTGCTTGG - Intronic
924759159 1:246968268-246968290 TGCTGGGTTTCGGACTTGCATGG - Intronic
924767439 1:247046935-247046957 TGCTGGATTTTGGACTTGCATGG - Intronic
924792889 1:247269559-247269581 TGCTGGGTTTCAAACTTGCATGG - Intergenic
924868166 1:248009142-248009164 TGCTAGCTTTTGAATTTGTTTGG - Intronic
1062770371 10:95259-95281 TGTTGGGTTTTGGACTTGTATGG - Intergenic
1063606324 10:7526167-7526189 TCCTTGGGTTTGAACTGGGAGGG + Intergenic
1064358544 10:14642134-14642156 TGCTAGGTTTTGGACTTGCTTGG - Intronic
1064571931 10:16702571-16702593 TGCTGGGTTTTGAACTTCCATGG + Intronic
1064676542 10:17765640-17765662 TCCTAGCTTTTGAACTTGCATGG - Intronic
1065626544 10:27635196-27635218 TGCTGGGTTTTGGACTTGAGTGG + Intergenic
1066041067 10:31548440-31548462 TGCTGGGTTTTGGAATTGCATGG + Intergenic
1066058680 10:31703777-31703799 TGCTGGGTTTTGGACTTGCAAGG + Intergenic
1066083568 10:31955634-31955656 TGCTGGGTTTTGGACTTGCAAGG + Intergenic
1066695795 10:38076599-38076621 TGCTGGGTTTTGAATATGCATGG - Intergenic
1066703479 10:38154129-38154151 TGCCAGGTCTTTAATTTGGATGG + Intergenic
1067206169 10:44215759-44215781 TGCCAGATTTTGGACTTGCATGG + Intergenic
1067518232 10:46973690-46973712 TGCTGTGTTTTGGACTTGCATGG - Intronic
1067644017 10:48078138-48078160 TGCTGTGTTTTGGACTTGCATGG + Intergenic
1068175081 10:53447467-53447489 TGAAACGTTTTGAACTTGCATGG - Intergenic
1068197999 10:53744233-53744255 GGTTTGGTTTTGAACTTGCATGG - Intergenic
1068290010 10:54989573-54989595 TGCTGGATTTTGGACTTGCATGG + Intronic
1068305324 10:55200325-55200347 TGCTGTGTTTTGGACTTGCAAGG + Intronic
1068432383 10:56949483-56949505 TGCTAGGTTTTAGACTTGTGTGG + Intergenic
1068434507 10:56973367-56973389 TGATGGGTTTTGAACATGCATGG - Intergenic
1068487439 10:57677980-57678002 TGCTGGATTTTGGACTTGCATGG - Intergenic
1068494983 10:57776224-57776246 TGCTGGATTTTGGACTTGCATGG - Intergenic
1069070093 10:63983791-63983813 TGCTGGATTTTGGACTTGCACGG + Intergenic
1069106065 10:64384852-64384874 TGCTGGGTTTTGGACGTGCATGG - Intergenic
1069851802 10:71410015-71410037 AGCTAGGATTTGAACCTGGGTGG - Intronic
1070083108 10:73207748-73207770 TACTGGGTTTTGAACTTGCATGG + Intronic
1070224106 10:74482742-74482764 TGCTGGGTTTCGGACTTGCATGG - Intronic
1070633565 10:78106048-78106070 TGCTGGATTTTGGACTTGCATGG + Intergenic
1071159365 10:82727961-82727983 TGCTGGATTTTGGACTTGCATGG + Intronic
1071327863 10:84534630-84534652 TACTGGGTTTTGGACTTGCATGG + Intergenic
1071677953 10:87674140-87674162 AGGAAGGTTGTGAACTTGGATGG + Intronic
1071738297 10:88326955-88326977 TGCTGGGTTTTAGACTTGCATGG + Intronic
1072358318 10:94633783-94633805 TGCTGGGTTTTGGACTTGCATGG + Intergenic
1072769307 10:98124447-98124469 TGTTAGATTTTGGACTTGCATGG - Intergenic
1073396558 10:103223000-103223022 TGCTGGGTTTCAAACTTGCATGG - Intergenic
1073725531 10:106226097-106226119 TGCGAGGCTGTGAATTTGGAGGG - Intergenic
1073841481 10:107503639-107503661 TGCTGGATTTTGGACTTGCATGG - Intergenic
1073952640 10:108828904-108828926 TGCTGGGTTTTGGACTTGCGTGG - Intergenic
1073994078 10:109295480-109295502 TGCTGGATTTTGGACTTGCAGGG + Intergenic
1074462301 10:113649114-113649136 TGCTTGGTTTTGAATTTAAAAGG - Intronic
1074608641 10:114999908-114999930 AGCTAGGATTTGAACCCGGATGG + Intergenic
1075281584 10:121143543-121143565 TGCTGGATTTTGGACTTGCATGG - Intergenic
1075354179 10:121756151-121756173 TGCTGGATTTTGGACTTGCATGG - Intronic
1075937910 10:126359513-126359535 TGCTGGATTTTGAACTTGCGTGG - Intronic
1076086145 10:127634072-127634094 TTCTGGGTTTTGGACTTGTATGG - Intergenic
1076155640 10:128203029-128203051 TGTTGGGTTTTGGACTTGCATGG + Intergenic
1077740759 11:4842955-4842977 TGCTGGGTTTCGGACTTGCATGG - Intronic
1078826905 11:14938472-14938494 TGCTGGGTTTTGGACTTGCATGG - Intronic
1079282901 11:19103914-19103936 TAATGGGTTCTGAACTTGGATGG + Intergenic
1079546899 11:21643620-21643642 TGCTAGATTTTGGACTTTCATGG + Intergenic
1079911834 11:26319359-26319381 TACTAGGTTATTAACTTGGGTGG - Intronic
1079952607 11:26823516-26823538 TGCTAGGTTTCAGACTTGCATGG - Intergenic
1079973080 11:27059771-27059793 TGCTGGGTTTTGGACTTGCATGG + Intronic
1079977502 11:27110128-27110150 TGATTGGATTTGAACTTGAAAGG - Intronic
1080045035 11:27799415-27799437 TGCTGGGTTTTGGACTTGCATGG + Intergenic
1080153442 11:29079157-29079179 TGCTGGAGTTTGAACTTGCATGG + Intergenic
1080182548 11:29442509-29442531 TGCTGGGTTTTGAAATTGCATGG - Intergenic
1080306630 11:30844012-30844034 TGCTGCGTTTTGAATTTGCATGG - Intronic
1080337965 11:31221398-31221420 TGCTAGGTTTTTGACTTGTTTGG - Intronic
1080946241 11:36978582-36978604 TGCTGGGTTTTAGACTTGCATGG - Intergenic
1080966142 11:37217266-37217288 TGCTGGATTTTGGACTTGCATGG - Intergenic
1080982324 11:37423556-37423578 TGCTGGATTTTGAACTTGCATGG - Intergenic
1081021961 11:37958420-37958442 TGCTGGATTTTGCACTTGCATGG - Intergenic
1081246271 11:40770753-40770775 CGCTAGATTTTGGACTTGCATGG - Intronic
1081364079 11:42213755-42213777 TGCTGGGTTTTGAACTTTCATGG + Intergenic
1082249354 11:49961851-49961873 TGCTGGGCTTTGAAATTGCATGG + Intergenic
1082270771 11:50167125-50167147 TGCTGGGTTTTGGACTTGAATGG + Intergenic
1082561613 11:54626496-54626518 TGCTGGGCTTTGAAATTGCATGG - Intergenic
1082699540 11:56410348-56410370 TGCTGGATTTTGAGCTTGCATGG + Intergenic
1082981977 11:59132208-59132230 TGCTGGATTTTGGACTTGCATGG + Intergenic
1083500684 11:63105037-63105059 TGCTGGATTTTGAACTTGCATGG - Intronic
1084308941 11:68304774-68304796 TGCTGGGTTTTGGACTTGCTTGG + Intergenic
1084498607 11:69520928-69520950 TGCTGGGTTTTGAACTTGCATGG - Intergenic
1084880805 11:72170174-72170196 TGCTGGATTTTGGACTTGCAGGG + Intergenic
1085016332 11:73176551-73176573 TGCAAGACTTTGCACTTGGATGG - Intergenic
1085166831 11:74409194-74409216 TGGTAAGTCTTGAACTTGGGTGG + Intergenic
1085418466 11:76335574-76335596 TGCTGGATTTTGGACTTGCATGG + Intergenic
1085476453 11:76792200-76792222 TGCTGGATTTTGAACTTGCCTGG + Exonic
1085976287 11:81659741-81659763 TGCTAGGTTTCAGACTTGCATGG - Intergenic
1086532642 11:87803837-87803859 TGCTGAGTTTTGAACTTGCTTGG - Intergenic
1086564634 11:88211824-88211846 TGCCGGGTTTTGGACTTGCAAGG - Intergenic
1086954928 11:92925872-92925894 TGCTGGGTTTTGAACTTGCATGG + Intergenic
1087550140 11:99638658-99638680 TGCTGGATTTTGGACTTGCATGG - Intronic
1087628223 11:100621246-100621268 TGCTGGGCTTTGAACTTGCATGG - Intergenic
1087669039 11:101083670-101083692 TGCTGGGTTTTGAACTTGCTTGG + Intronic
1087908543 11:103726817-103726839 TGCTGGATTTTGAACTTACATGG - Intergenic
1088040449 11:105375278-105375300 TGTTGGATTTTGAACTTGCATGG - Intergenic
1088111560 11:106267477-106267499 TGCTGGATTTTGGACTTGCATGG + Intergenic
1088143616 11:106648892-106648914 TGCTGGATTTTGGACTTGCATGG - Intergenic
1088175878 11:107052008-107052030 TGCTGGATTTTGGACTTGCATGG + Intergenic
1088435172 11:109804479-109804501 TGCTGGATTTTGGACTTGCATGG - Intergenic
1088497151 11:110442524-110442546 TGCTGGATTTTGGACTTGCATGG + Intronic
1089187493 11:116629375-116629397 TGCTGGGTTTTGGACTTGGCTGG - Intergenic
1089746257 11:120619221-120619243 TGCTGGGTTTTGTACTTGCATGG + Intronic
1090504714 11:127298567-127298589 TGCTGGGTTTTAGACTTGCATGG + Intergenic
1090544352 11:127746794-127746816 TGCTGGGTTTTGAACTTGCATGG - Intergenic
1090574757 11:128088842-128088864 TGTTAGGTTTTAAACTTAGTTGG - Intergenic
1090595286 11:128314687-128314709 TACTGGGTTTTGGACTTGCATGG - Intergenic
1090756276 11:129794633-129794655 TGCTGGGTTTTGGACTTGCATGG - Intergenic
1091497033 12:981580-981602 TACTAGGTTTTGAATTTGCTTGG - Intronic
1091669588 12:2443286-2443308 TACTGGGTTTTGAACTTGCCTGG - Intronic
1092471554 12:8786360-8786382 TGCTAGGTTTTGAACTTGGATGG - Intergenic
1093350940 12:18102801-18102823 TGCTGGGTTTTGGACTTGCATGG - Intronic
1093478836 12:19583909-19583931 TGCTGGGTTTTGGACTTGCACGG + Intronic
1093591187 12:20904348-20904370 TGTTGGGTTCTGAACTTGCATGG - Intronic
1093788217 12:23216522-23216544 TGCTGGGTTTTGAACTTGTATGG + Intergenic
1093822089 12:23633198-23633220 TTCTAAGATTTGAAATTGGAAGG - Intronic
1093978475 12:25450061-25450083 TGCTGGATTTTGGACTTGCACGG + Intronic
1094036903 12:26081594-26081616 TGCTGGGTTTTGGACTTACATGG - Intergenic
1094379792 12:29830730-29830752 TGCTGGGTTTTGGACTTGCATGG - Intergenic
1094489178 12:30948030-30948052 TGCTGGATTTTGGACTTGCATGG - Intronic
1094716260 12:33017850-33017872 TGCTGGATTTTGAACTTGCATGG + Intergenic
1095147726 12:38750595-38750617 TGCTGGATTTTGGACTTGCATGG + Intronic
1095235093 12:39785834-39785856 TGCTGGATTTTGGACTTGCATGG + Intronic
1095242697 12:39879555-39879577 TGCTGGGTTTCAAACTTGCATGG + Intronic
1095308260 12:40663114-40663136 TGCTAGATTTTGGACTTGCTTGG + Intergenic
1095323008 12:40852373-40852395 TGCTTGGTTTTAAACTTGGCTGG + Intronic
1095728142 12:45474512-45474534 TGCTGGGTTTCAAACTTTGACGG + Intergenic
1096304582 12:50463237-50463259 TGCTTGGTTTTGCACTTGCATGG - Intronic
1096476065 12:51909792-51909814 TGCTAAGTACTGAACTTGAATGG - Intronic
1096688585 12:53305611-53305633 TGCTAACTTTTGAACAAGGAAGG - Intronic
1097139357 12:56886883-56886905 TTCTGGGTTTTGGACTTGCATGG + Intergenic
1097343562 12:58466787-58466809 TGCTGGGTTTTGGACTTGCATGG - Intergenic
1097404509 12:59174336-59174358 TGATAGATTTTGGACTTGCATGG + Intergenic
1098078463 12:66758745-66758767 TGCTGGATTTTGGACTTGCATGG - Intronic
1098238561 12:68442627-68442649 TGCTGGATTTTGGACTTGCATGG - Intergenic
1098319905 12:69232576-69232598 TGCTGGGTTTTGGACTTGCATGG + Intergenic
1098521067 12:71436093-71436115 TGCTGGGTTTTGGACTTGGATGG - Intronic
1098743096 12:74200188-74200210 TGCTGGATTTTGGACTTGCATGG - Intergenic
1098836450 12:75429319-75429341 TGTTGGGTTTTGAACTTGCATGG + Intronic
1099475531 12:83104003-83104025 TGCTGGGGTCTGAACTTGCATGG - Intronic
1099487829 12:83249839-83249861 TGCTAGGTTTTGGATGTGCATGG + Intergenic
1099503757 12:83446956-83446978 TGCTGGATTTTGGACTTGCATGG + Intergenic
1099525211 12:83710673-83710695 TGCTGGGTTTTGAACTTGCATGG - Intergenic
1099581375 12:84451301-84451323 CGATAGGTTTTGAACTTGCATGG + Intergenic
1099627264 12:85090583-85090605 TGCTGGGTTTTGAATTTGCATGG + Intronic
1099635275 12:85204640-85204662 TGCTGGATTTTGGACTTGCATGG + Intronic
1099694208 12:85997624-85997646 TGCTGGATTTTGGACTTGCATGG - Intronic
1099778317 12:87162863-87162885 TGCTAGGGTTTGGACTTGCTTGG - Intergenic
1099796762 12:87409705-87409727 TGCTGGGTTTTGGACTTGCATGG + Intergenic
1099842208 12:87980532-87980554 TACTATGTTTTGCATTTGGATGG + Intronic
1099859010 12:88205499-88205521 TGCTGGATTTTGGACTTGCATGG + Intergenic
1100054436 12:90491435-90491457 CACTGGATTTTGAACTTGGATGG + Intergenic
1100072155 12:90734549-90734571 TGCCAGGTTTTGGACTTGCATGG - Intergenic
1100376172 12:94018057-94018079 TGCTGGGTTTTGAACTTGCATGG + Intergenic
1100568160 12:95818762-95818784 TTCTAGGTTCTGAGCTAGGATGG + Intronic
1100678536 12:96893919-96893941 TGCTGGATTTTGGACTTGCATGG + Intergenic
1101052202 12:100874838-100874860 TGCTTGGTTTTGAACTTGTATGG + Intronic
1101232938 12:102760054-102760076 TACTAGCTTGTGACCTTGGATGG - Intergenic
1101257887 12:102997768-102997790 TGCTGGATTTTGGACTTGCATGG - Intergenic
1101526323 12:105534618-105534640 TGCTGGGTTTTGGACTTGCATGG - Intergenic
1102794794 12:115679372-115679394 TGCTGGATTTTGGACTTGCATGG + Intergenic
1103357886 12:120335218-120335240 TGCTGGGTTTCGGACTTGCATGG - Intergenic
1105256680 13:18748030-18748052 TGCTGGGTTTTTGACTTGCATGG - Intergenic
1105257614 13:18754690-18754712 TGCTGGGTTTTTGACTTGCATGG - Intergenic
1105262030 13:18786709-18786731 TGCTGGGTTTTTGACTTGCATGG - Intergenic
1105526803 13:21185375-21185397 AGCTAAGTATTGAATTTGGATGG + Intergenic
1105528831 13:21200126-21200148 TGGTAGGTTCTGAACCTGCATGG - Intergenic
1106048246 13:26165699-26165721 TGCTGGATTTTGGACTTGCATGG + Intronic
1106106685 13:26739085-26739107 TGCTGGATTTTGGACTTGCATGG + Intergenic
1106614814 13:31316538-31316560 GGCCAGGTTTTGCACTTGCATGG + Intronic
1106618973 13:31355788-31355810 TGCTGGATTTTGGACTTGCATGG + Intergenic
1106714363 13:32372958-32372980 GGCTAGGTTTCGGACTTGCATGG - Intronic
1106807010 13:33319913-33319935 AGCAGGGCTTTGAACTTGGATGG - Intronic
1107105291 13:36636556-36636578 TGCTAGGTTTTAGACTTGCATGG - Intergenic
1107234542 13:38153044-38153066 TGCTCGATTTTGGACTTGCATGG - Intergenic
1107828249 13:44350262-44350284 TGCTAGGTCTTGAAGGTGCATGG - Intergenic
1108277461 13:48825936-48825958 TGCTGGGTTTTGGACTTACAAGG - Intergenic
1108294437 13:48999298-48999320 TGGTAGGTTTTGGACTTGCTTGG + Intronic
1108473710 13:50791946-50791968 TGGTAAGTTTTCAGCTTGGAAGG - Intronic
1108612487 13:52097521-52097543 TGCTAGGTTTTGAATTTGCATGG + Intronic
1108729514 13:53220001-53220023 TCCTGGGTTTTGAACTTAGCTGG - Intergenic
1108979433 13:56491995-56492017 TGCTGGGTTTTGGAGTTGCATGG - Intergenic
1109005313 13:56868192-56868214 TATTAGGTTTTGAACTTCCATGG - Intergenic
1109262672 13:60163132-60163154 AGCTAGTTTTAGAACTTGGCGGG - Intronic
1109315507 13:60744620-60744642 TGCTGGATTTTGAACTTGCATGG + Intergenic
1109407256 13:61918417-61918439 TGCTGGATTTTGGACTTGCATGG - Intergenic
1109485184 13:63009710-63009732 TGCTCGGTTTTGGAGTTGCATGG - Intergenic
1109552558 13:63922455-63922477 TGCTACTTTTTGCACTTGGCAGG - Intergenic
1109584885 13:64386740-64386762 AGGTAGTTTTTCAACTTGGAGGG + Intergenic
1109614229 13:64809284-64809306 TGCTGGATTTTGAACTTGCCTGG + Intergenic
1109681359 13:65756874-65756896 TGCTGGATTTTGGACTTGCATGG + Intergenic
1109697416 13:65978316-65978338 TGCTGGGTTTTGTACTTGCATGG + Intergenic
1109859624 13:68179967-68179989 TGCTGGATTTTGGACTTGCATGG + Intergenic
1109962195 13:69645266-69645288 TGCTGGGTTTTGGACCTGCATGG + Intergenic
1109973486 13:69800899-69800921 TGCTATGTAATAAACTTGGAAGG + Intronic
1110189574 13:72715224-72715246 TGCTGGGTTTGGAACTTGTATGG + Intronic
1110228798 13:73147170-73147192 TGCTTGGTTTTCACCTTGGTCGG + Intergenic
1110341878 13:74402119-74402141 TGCTGGATTTTGGACTTGCATGG - Intergenic
1110364766 13:74669514-74669536 TGCTAGGTTTTGGACTTGCTTGG + Intergenic
1110440631 13:75521645-75521667 TGATGGGTTTTGGACTTGCATGG + Intergenic
1110489451 13:76086571-76086593 TGTCAGGTTTTGGACTTGCATGG - Intergenic
1110511513 13:76356300-76356322 TGCTGGATTTTGAACTTGCATGG + Intergenic
1110527891 13:76560735-76560757 TGCTAGGCTTTAATCTTGAAGGG - Intergenic
1110890088 13:80688441-80688463 TGCTGGGTTTTGAACATGCATGG - Intergenic
1110970727 13:81758039-81758061 TGCTGGATTTTGAACTTTCATGG - Intergenic
1111051122 13:82884126-82884148 TCCTGGGTTTTGAACTTGCATGG - Intergenic
1111105658 13:83642476-83642498 TGCTGGATTTTGGACTTGCATGG - Intergenic
1111155005 13:84310217-84310239 TGCTGGATTTTGAACTTGCGTGG + Intergenic
1111207193 13:85026919-85026941 TGCTGGGTTTTGGACTTCCATGG - Intergenic
1111336776 13:86836119-86836141 CGCTGGATTTTGAACTTGCATGG - Intergenic
1111443010 13:88304893-88304915 TGCTGGGTTTTGGACTTGCATGG + Intergenic
1111460966 13:88540835-88540857 TGCTGGGTTTTGGACTTGCTTGG + Intergenic
1111461955 13:88556720-88556742 TGCTAGGTTTTGGACTTGGTTGG - Intergenic
1111471979 13:88695366-88695388 TGCTGGATTTTGGACTTGCATGG - Intergenic
1111752984 13:92358179-92358201 TGCTGGGTTTTGGACTTGCATGG - Intronic
1112252159 13:97792436-97792458 TGCTGGGTTTTGGACTTGCATGG - Intergenic
1112739247 13:102454945-102454967 TGCTAGGTTTTTGACTTGCTTGG + Intergenic
1112887681 13:104193989-104194011 TGCTAGATTTTGGACTTGCATGG + Intergenic
1113297134 13:108971281-108971303 TGATAGGTTTTGATGTTTGAAGG - Intronic
1113501793 13:110781731-110781753 CACTGGGTTTTGGACTTGGATGG - Intergenic
1113509558 13:110842158-110842180 TGCTAGATTTTGGACTTGCTTGG - Intergenic
1114082277 14:19211313-19211335 TGCTGGGATTTGAACTTGTGTGG + Intergenic
1114706945 14:24737240-24737262 AGCTGGGTTTTGGACTTGCACGG - Intergenic
1114948480 14:27716376-27716398 TGCTGGATTTTGGACTTGCATGG + Intergenic
1115134266 14:30090456-30090478 TGCTGGGTTTTGAACTTGCATGG - Intronic
1115919454 14:38355976-38355998 TGCTGGATTTTGGACTTGCATGG + Intergenic
1115936527 14:38559252-38559274 TGCTAGGTTTCAAACTTTCATGG - Intergenic
1115946332 14:38665512-38665534 TCATTGGATTTGAACTTGGAAGG - Intergenic
1116154406 14:41185545-41185567 TGCTGGATTTTGGACTTGCATGG - Intergenic
1116165808 14:41332798-41332820 TGCTGGATTTTGGACTTGCATGG - Intergenic
1116255352 14:42547974-42547996 TGCTGGGTTTTGGACTTGTGTGG - Intergenic
1116415457 14:44672356-44672378 TGCTGGATTTTGGACTTGCATGG - Intergenic
1116522851 14:45870906-45870928 TGCTGGATTTTGGACTTGCATGG - Intergenic
1116713389 14:48397532-48397554 TGCTGGGTTTTGTACTTGCATGG + Intergenic
1116742744 14:48776996-48777018 TGCTGGGTTTTGGACTTGTGTGG + Intergenic
1116783943 14:49267554-49267576 TGCTGGATTTTGGACTTGCATGG + Intergenic
1117749304 14:58903527-58903549 TGCTGGATTTTGGACTTGCATGG + Intergenic
1117758313 14:58999198-58999220 TGCTGGGTTTTGGACTTGCATGG + Intergenic
1117881916 14:60320558-60320580 TGCTGGGTTTTATACTTGCATGG + Intergenic
1117984480 14:61374109-61374131 TGCTGGGTTTTGGACTTGCATGG - Intronic
1118060751 14:62135418-62135440 TGCTGGATTTTGGACTTGCATGG - Intergenic
1118080102 14:62348877-62348899 TGCTAGGTTTTGAATTTGCTTGG + Intergenic
1118083416 14:62387838-62387860 TGCTGGGTTTTGGACTTGCATGG + Intergenic
1118274501 14:64373519-64373541 TGCTGGATTTTGAACTTGCATGG - Intergenic
1118402746 14:65394715-65394737 TGCTGGATTTTGGACTTGCATGG - Intergenic
1118582841 14:67321277-67321299 TTTTAGGGTTTGAACTTAGAAGG + Intronic
1118956967 14:70491351-70491373 CTCTGGGTTTTGAACTTGCATGG - Intergenic
1119007440 14:70944383-70944405 TGCTGGATTTTGGACTTGCATGG + Intronic
1119143040 14:72284946-72284968 TGCTGGATTTTGGACTTGGATGG + Intronic
1119200624 14:72749273-72749295 TGCTGGATTTTGAACTTGCATGG + Intronic
1119426912 14:74541684-74541706 TGCTAGGTTTTCTACTGGGCAGG - Intronic
1119450063 14:74701889-74701911 TGCTGGATTTTGGACTTGCATGG - Intronic
1119513514 14:75230051-75230073 ACCTAGGATTTGAACCTGGAAGG + Intergenic
1119945914 14:78694005-78694027 AGCCAGGTTTTGAAATAGGAAGG - Intronic
1120101634 14:80451172-80451194 TGATGGGTTTTGAACTTTCATGG + Intergenic
1120324784 14:83010080-83010102 TGCTAGATTTAGGACTTGTAAGG + Intergenic
1120480820 14:85047236-85047258 TGCTGGATTTTGGACTTGCATGG + Intergenic
1120571038 14:86116722-86116744 TGCTGGGTTTCGGACTTGCATGG + Intergenic
1120575393 14:86175019-86175041 TGCTGGATTTTGGACTTGCATGG + Intergenic
1120622001 14:86775755-86775777 TGCTGGATTTTGGACTTGCATGG + Intergenic
1120799707 14:88674894-88674916 TGCTGGATTTTGGACTTGAATGG - Intronic
1120920997 14:89755399-89755421 TGCTGGATTTTGGACTTGCATGG - Intergenic
1121318859 14:92979154-92979176 TGCTGGGTTTTGGACTTGCATGG + Intronic
1121596550 14:95167729-95167751 TGCTGGGTTTTAGACTTGCAGGG + Intergenic
1121672651 14:95724529-95724551 TGTTGGGTTTTGGACTTGCATGG + Intergenic
1121707609 14:96010761-96010783 TGTTGGGTTTTGAACTTGCGTGG - Intergenic
1122069592 14:99196989-99197011 GGCCAGGTTCTGAACATGGAAGG - Intronic
1122436274 14:101702487-101702509 TGCTGGATTTTGGACTTGCATGG + Intergenic
1122442344 14:101740725-101740747 TGCCTGGTTTTGGACTTGCAAGG - Intergenic
1122656864 14:103267936-103267958 TGCTGGGTTTCAAACTTGCATGG - Intergenic
1122831978 14:104402707-104402729 TGCTGCGTTTTGGACTTGCATGG + Intergenic
1123140606 14:106073663-106073685 TGCTAGTGTTTGGACTTGCATGG + Intergenic
1123197415 14:106629756-106629778 TGCTGGATTTTGGACTTGCATGG + Intergenic
1123198753 14:106641632-106641654 TGCTGGATTTTGGACTTGCATGG + Intergenic
1202834969 14_GL000009v2_random:71158-71180 TGCTGGGTTTTTGACTTGCAGGG + Intergenic
1202835373 14_GL000009v2_random:74239-74261 TGCTGGGTTTTTGACTTGCATGG + Intergenic
1123797347 15:23784944-23784966 TGCTAGATTTTGGACTTGATTGG - Intergenic
1123797657 15:23788980-23789002 TGCTAGATTTTGGACTTGATGGG + Intergenic
1123856320 15:24415797-24415819 TGCTGGGTTTCAAACTTGCATGG - Intergenic
1123872808 15:24593841-24593863 TGCTGGATTTTGAACTTGCTTGG - Intergenic
1124226333 15:27897966-27897988 TGCTGGATTTTGGACTTGCATGG + Intronic
1124664532 15:31581111-31581133 TGCTGGATTTTGAACTTGCATGG - Intronic
1125881462 15:43199392-43199414 TGCTGGATTTTGGACTTGCATGG + Intronic
1126126512 15:45298923-45298945 CGCTGGATTTTGAACTTGCATGG + Intergenic
1126203917 15:46020366-46020388 TGCTGGGTTTTGGACTTGGATGG + Intergenic
1126297850 15:47161157-47161179 TGTTGGATTTTGAACTTAGATGG - Intergenic
1126903249 15:53336461-53336483 TGCAAGGTTTTGGACTTGCTTGG - Intergenic
1127043371 15:55001411-55001433 TGCTGGGCTTTGAACTTGCATGG - Intergenic
1127955279 15:63847671-63847693 TGCTGGATTTTGGACTTGCATGG + Intergenic
1128718549 15:69928469-69928491 TGCTGGGTTTTGGACTTGCATGG - Intergenic
1128814064 15:70592786-70592808 TGCTGGATTTTGGACTTGCATGG + Intergenic
1129715459 15:77845873-77845895 TGCTGGGTTTTGGACTTGCATGG + Intergenic
1130324244 15:82866267-82866289 TGCTGGATTTTGGACTTGCATGG + Intronic
1130702429 15:86198144-86198166 TGCTAGGTTTGGAACATGCTTGG + Intronic
1131987522 15:98060219-98060241 TGCTGGGTTTTGGACTTACATGG - Intergenic
1133644729 16:7753856-7753878 TGCTGGGTTTTAGACTTGTATGG - Intergenic
1133888509 16:9854898-9854920 TGCTATTTTTGGAGCTTGGAGGG + Intronic
1134792951 16:17007271-17007293 TGCTAGCTTTTGAATTTGTTTGG + Intergenic
1136642671 16:31579964-31579986 TGCTGGATATTGAACTTGCATGG - Intergenic
1136662960 16:31781156-31781178 TGCTAGATTTTGAACTTGCATGG + Intronic
1136674712 16:31892684-31892706 TGCTGGATTTTGGACTTGCATGG - Intronic
1137358585 16:47791651-47791673 TGCTGGGTTTTGGACTTGCATGG - Intergenic
1138896148 16:61207008-61207030 TGCTTGGTTTTGCACTGGCATGG + Intergenic
1139078916 16:63490481-63490503 TTCTAGGTTTTGAACTTGCTTGG - Intergenic
1140171187 16:72606642-72606664 TTGTAAGTTTTGAAATTGGAAGG - Intergenic
1141663911 16:85456043-85456065 AGCTAGGATTTGAACTTGAGTGG + Intergenic
1142281113 16:89148039-89148061 TGCTAGGTTTTGGACCTGCCTGG - Intronic
1144351707 17:14403126-14403148 TGCCAGGTTTTGGACTTGCATGG + Intergenic
1144684787 17:17218912-17218934 TGCAGGGTTTTGAAGGTGGAGGG + Intronic
1144839581 17:18177635-18177657 TGGTGGGATTTGAACCTGGATGG - Intronic
1146149288 17:30453358-30453380 TGCTGGATTCTGAACTTGCATGG - Intronic
1146363619 17:32200294-32200316 TGGTTTGTTTTTAACTTGGAAGG + Intronic
1146391857 17:32430153-32430175 TGCTGGGTTTTGGACTTGCATGG + Intergenic
1147336735 17:39730625-39730647 TGCTACGTTTTGACCTCGTAGGG + Exonic
1148983475 17:51599684-51599706 TGCTGGGTTTTGAACTTGCATGG + Intergenic
1149029572 17:52067789-52067811 TGCTGGATTTTGGACTTGCATGG + Intronic
1149101294 17:52909717-52909739 TGCTGGATTTTGGACTTGCATGG + Intergenic
1149110149 17:53018952-53018974 TGCTGGATTTTGGACTTGCACGG - Intergenic
1149140656 17:53428921-53428943 TGCTGGGTTTTAGACTTGCACGG + Intergenic
1149145734 17:53490670-53490692 TGCTGGGTTTTGGACTTGCATGG - Intergenic
1149175661 17:53867532-53867554 TGCTGGGTTTTGGACTTGCATGG - Intergenic
1149358565 17:55869555-55869577 TGCTGGGTTTTGAACTTTCTTGG - Intergenic
1150653382 17:67024260-67024282 TGCTTGGTTTTGTACATGTAAGG - Intronic
1150922667 17:69500000-69500022 AGGGAGGTTTTGAATTTGGAAGG + Intronic
1150978775 17:70119072-70119094 TGCTAAGTTTTAAACTTGTGTGG - Intronic
1151041113 17:70861735-70861757 TGCTAGGTTTTGGACTTGCATGG + Intergenic
1151045747 17:70917734-70917756 TGCTGGATTTTGAACTTGGCTGG + Intergenic
1151375644 17:73686973-73686995 TGCTGAGTTTTGAACTTGCATGG + Intergenic
1151902104 17:77023112-77023134 TGCTGGGTTTCAAACTTGCATGG + Intergenic
1152548153 17:81013378-81013400 TGCTGGGTTTGGAACTTCCATGG + Intergenic
1152849696 17:82625759-82625781 TGCTCGGTTCTGAACCTAGATGG - Intronic
1153011873 18:546916-546938 TGCTGGATTTTGGACTTGCATGG - Intergenic
1153108058 18:1550547-1550569 TGCTGGGTTTCGGACTTGGATGG + Intergenic
1153578716 18:6549896-6549918 TGCTGGGTTTTGGACTTGTCTGG - Intronic
1153778894 18:8477163-8477185 TCCTAGGTTCTGGACTTGAAGGG + Intergenic
1154425752 18:14270796-14270818 TGCTGGGTTTTTGACTTGTATGG + Intergenic
1154426657 18:14277405-14277427 TGCTGGGTTTTTGACTTGCATGG + Intergenic
1154428065 18:14287299-14287321 TGCTGGGTTTTTGACTTGCATGG + Intergenic
1154428496 18:14290389-14290411 TGCTGGGTTTTTGACTTGTATGG + Intergenic
1154429402 18:14296997-14297019 TGCTGGGTTTTTGACTTGCATGG + Intergenic
1154433443 18:14326037-14326059 TGCTGGGTTTTTGACTTGTATGG + Intergenic
1154434368 18:14332648-14332670 TGCTGGGTTTTTGACTTGCATGG + Intergenic
1154504310 18:15020505-15020527 TGCTGGATTTTGGACTTGCATGG - Intergenic
1155046159 18:22105256-22105278 TGGGAGGCTTTGAACCTGGAAGG - Intergenic
1155665843 18:28307411-28307433 TGCTGGATTTTGGACTTGCATGG + Intergenic
1155745891 18:29356101-29356123 AGCTGGGTTTTGGACTTGCATGG + Intergenic
1155773403 18:29727619-29727641 TGCTGGGTTTTGAACTTGCATGG + Intergenic
1155798852 18:30074407-30074429 TGCTGGGTTTTGAACTTGCCTGG + Intergenic
1155808985 18:30208037-30208059 TGCCAAGTTTTGAACTTGCTTGG - Intergenic
1155818570 18:30347256-30347278 TGCTGGATTTTGGACTTGCATGG - Intergenic
1156169289 18:34462994-34463016 TGTTGGATTTTGAACTTGCATGG - Intergenic
1156322414 18:36038834-36038856 TGCTGGGTTTCGGACTTGCATGG + Intronic
1156511260 18:37638759-37638781 TGCTATGTTCTGAACCTGGCTGG - Intergenic
1156683252 18:39616603-39616625 TGCTGGGTTTTGGACTTGCATGG - Intergenic
1156858784 18:41813305-41813327 TGCTGGATTTTGGACTTGCATGG - Intergenic
1156941064 18:42767379-42767401 TGCTGGATTTTGGACTTGCATGG + Intronic
1157537916 18:48474159-48474181 TGCTAGGTATTGAACTTGCTTGG + Intergenic
1158092115 18:53727032-53727054 TACTGGGTTTTGGACTTGCATGG - Intergenic
1159215641 18:65387442-65387464 TGCTAGATTTTGGACTTGATTGG + Intergenic
1159282845 18:66310033-66310055 TGCTGGATTTTGAACTTGCATGG - Intergenic
1159554624 18:69932516-69932538 TGCCAGGTGGTGAACTTGGAGGG - Intronic
1159569027 18:70090933-70090955 TGCTAGGCTTTGGACTTGCTTGG + Intronic
1159606344 18:70478728-70478750 TGCTGGGTTTTGGACTTGCATGG + Intergenic
1159617607 18:70599157-70599179 TGCTAGATTTTGGACTTGCATGG + Intergenic
1159705155 18:71677072-71677094 TGCTTGATTTTGGACTTGCATGG - Intergenic
1159960303 18:74550335-74550357 TGCTGGGTTTTACACTTGCATGG + Intronic
1160573806 18:79837166-79837188 TGCTGGGTTTTGGATTTGCATGG - Intergenic
1161675324 19:5644264-5644286 TGCTAGGCATTGAACTAGGCTGG - Intronic
1164514455 19:28921994-28922016 TGCTGGGTTTTGGACTTGCTTGG + Intergenic
1164587028 19:29482331-29482353 TGCCAGGTTTTGGACTTACATGG - Intergenic
1165647400 19:37454044-37454066 TGCTAGGTTTTTAACATGGGGGG + Intronic
1165888314 19:39095372-39095394 TGCTGGATTTTGGACTTGCATGG - Intronic
1167144897 19:47675811-47675833 TGCTGACTTTTGACCTTGGATGG + Intronic
1167403556 19:49289046-49289068 TGCTAGATTTTGGACTTGCATGG + Intergenic
1167829941 19:52011333-52011355 TGCTGGGTTTTGAACTTGCATGG + Intergenic
1168559859 19:57373700-57373722 CGCTGGGTTTTGGACTTGCATGG - Intronic
1202637251 1_KI270706v1_random:53110-53132 TGCTGGGTTTTTGACTTGCATGG - Intergenic
1202637735 1_KI270706v1_random:56534-56556 TGCTGGGTTTTTGACTTGCAGGG - Intergenic
925036022 2:686470-686492 TGCTGGATTTTGGACTTGCATGG + Intergenic
925393206 2:3513044-3513066 TGCTGAGTTTTGAACTTTCATGG + Intronic
925453273 2:3990244-3990266 TGCTAGATTTTGGACTTGCATGG - Intergenic
925494782 2:4435023-4435045 TGCCAGGTTTTGGACTTGCATGG - Intergenic
925539525 2:4951923-4951945 TGCTGGGTTTTGAACTTGCATGG - Intergenic
925594837 2:5544768-5544790 TGCTGGGTTTTGGACTTGCAGGG + Intergenic
925638378 2:5964594-5964616 TGCTGGATTTTGGACTTGGATGG - Intergenic
925898443 2:8491203-8491225 TTCTGGTTTTTGAACTTTGAAGG + Intergenic
926099497 2:10105307-10105329 TGCTGGGGTTTGGACTTGCATGG - Intergenic
926383311 2:12312666-12312688 TGCTAGAATTTGAAGATGGAAGG + Intergenic
926461175 2:13131047-13131069 TGCTGGGTTTTGGACTTTCAGGG + Intergenic
926478612 2:13359128-13359150 CGCTAGATTTTGGACTTGCAGGG - Intergenic
926483890 2:13431988-13432010 TGCTGGATTTTGGACTTGCATGG - Intergenic
926511914 2:13792033-13792055 TGCTAGGTTTTGGACTTGTTGGG - Intergenic
926769086 2:16351951-16351973 TGCTGGTTTTTGGACTTGTATGG + Intergenic
926836641 2:17031083-17031105 TGCTGGATTTTGGACTTGCATGG - Intergenic
926929536 2:18023368-18023390 TGCTGGATTTTGGACTTGCATGG - Intronic
927288195 2:21378747-21378769 TGCTGGATTTTGGACTTGGGTGG - Intergenic
927611783 2:24548704-24548726 TGCTGGATTTTGGACTTGGTTGG - Intronic
928749974 2:34459515-34459537 TGCTGGGTTTTGGACTTGCATGG + Intergenic
929081683 2:38128053-38128075 TGCTGGGTTTCGGACTTGCATGG + Intergenic
929226993 2:39521391-39521413 TGCTGGGTTTTGGACTTGCATGG - Intergenic
929586287 2:43116900-43116922 TGCTAGGTTTTGGATTTGTTTGG - Intergenic
929612905 2:43284934-43284956 TGCTGGGTTTTGAACTTGCATGG + Intronic
930076218 2:47407712-47407734 TGCTGGATTTTGGACTTGCATGG + Intronic
930227752 2:48811915-48811937 TGCTGGATTTTGGACTTGCATGG - Intergenic
930293157 2:49520814-49520836 TCCTAGGTTTCTGACTTGGACGG + Intergenic
930298278 2:49582304-49582326 AACAAAGTTTTGAACTTGGAGGG - Intergenic
930490169 2:52059028-52059050 TGCTAGGTTTCAAACTTGCATGG + Intergenic
930585529 2:53263253-53263275 TGCTGGATTTTGGACTTGCATGG - Intergenic
931033429 2:58210769-58210791 TGCTGGATTTTGGACTTGCATGG - Intronic
931105599 2:59051962-59051984 TGCTAAGTTTTGGACTTGCTTGG - Intergenic
931439551 2:62278510-62278532 TGCTAGGTTTTGGACTTGCATGG + Intergenic
932276643 2:70456606-70456628 TGCCAGCTTTTGCAATTGGAGGG + Intronic
932317944 2:70798625-70798647 TGCTGGATTTTGGACTTGCATGG - Intergenic
932356345 2:71071441-71071463 TGCCAGCTTTGGAGCTTGGAAGG - Intronic
932648449 2:73530340-73530362 AGCCAGGTTTTCAACTTGCATGG - Intronic
932849606 2:75171725-75171747 TGCTGGATTTTGGACTTGCATGG + Intronic
932960710 2:76409318-76409340 TGCTGGATTTTGGACTTGCATGG + Intergenic
933099006 2:78226495-78226517 TGCTGGATTTTGGACTTGCATGG - Intergenic
933350314 2:81145426-81145448 TGCTGGATTTTGGACTTGCATGG - Intergenic
933521638 2:83381489-83381511 TGCTGGGTTTTGGAATTGCATGG + Intergenic
933985893 2:87591867-87591889 TGCTGGGTTTTGGACTTGCATGG + Intergenic
934017150 2:87899839-87899861 CGCTAGATTTCGAACTTGCATGG + Intergenic
934055061 2:88244440-88244462 TGCTGGATTTTGGACTTGCATGG + Intergenic
934491733 2:94765847-94765869 TGCCAGGTTTTTGACTTGCATGG - Intergenic
934493153 2:94776027-94776049 TGCTGGGTTTTTGACTTGCATGG - Intergenic
934700921 2:96439401-96439423 TGCTAGATTTTGGACTTGCATGG + Intergenic
935239814 2:101168659-101168681 TCCTGGGTTTTGAACTTGCATGG + Intronic
935466113 2:103400023-103400045 TGTTAGGTTTGTAACTTTGATGG - Intergenic
935495617 2:103777201-103777223 TGTTAGGTTTTGAACTTACTTGG + Intergenic
935496975 2:103793835-103793857 TGCTAGATTTTGGCCTTGCATGG - Intergenic
935792021 2:106601570-106601592 TGCTGGGTTTCCAACTTGCATGG - Intergenic
935931600 2:108132927-108132949 TGCTAGGTTTTAGACTTGCATGG - Intergenic
936307946 2:111358937-111358959 TGCTGGGTTTTGGACTTGCATGG - Intergenic
936499478 2:113054738-113054760 CGCTGGATTTTGAACTTGCATGG - Intergenic
936734694 2:115427026-115427048 TGCTGTGTTTTGAACTTGCATGG - Intronic
936827954 2:116604434-116604456 TGCTGGATTTCGAACTTGCATGG + Intergenic
936843451 2:116802239-116802261 TGCTAGATTTTGGACTTTCATGG - Intergenic
936862303 2:117032433-117032455 TGCTGGATTTTGGACTTGCATGG - Intergenic
936898401 2:117455230-117455252 TGCTGGGTTTTGAACTTGCATGG + Intergenic
936969706 2:118165210-118165232 TGCTGGATTTTGGACTTGCATGG + Intergenic
937427731 2:121813912-121813934 TGCTGGGTTTTGGAATTGCATGG + Intergenic
937491316 2:122371271-122371293 TGCTGTGTTTTGGACTTGCATGG - Intergenic
937566814 2:123302883-123302905 TGTTAAGTTTTGAAATTGAAAGG - Intergenic
937588957 2:123591072-123591094 TGTTAGATTTTGGACTTGCATGG - Intergenic
937640165 2:124203176-124203198 TGCTGGATTTTGGACTTGCATGG - Intronic
937800688 2:126077390-126077412 CGCTAGATTTTGTACTTGCATGG + Intergenic
937995345 2:127690263-127690285 TGCTGGGTTTTGAACTTGCATGG - Intergenic
938160655 2:128982053-128982075 TGCTGGGTTTTGAACTTGCTTGG + Intergenic
938165452 2:129021736-129021758 TGCTGGATTTTGGACTTGCATGG + Intergenic
938260115 2:129889541-129889563 TGCTAGGTTTTGGACTTGCCTGG - Intergenic
938494311 2:131785291-131785313 TGCTGGGATTTGAACTTGTGTGG - Intergenic
938503500 2:131850711-131850733 TGCTGGATTTTGGACTTGCATGG - Intergenic
939091994 2:137790679-137790701 TGCTGGATTTTGGACTTGCATGG - Intergenic
939092929 2:137799899-137799921 TGCTAGGTTTTGGACTTGTGTGG + Intergenic
939155811 2:138523687-138523709 TGCTGGATTTTGAATTTGCATGG - Intronic
939174713 2:138735893-138735915 TGCTGGATTTTGGACTTGCATGG - Intronic
939445916 2:142310130-142310152 TACTGGATTTTGAACTTGCATGG - Intergenic
939522824 2:143253446-143253468 TGATAGGATTTCAACTAGGAAGG - Intronic
939667478 2:144969130-144969152 TGCTGGATTTTGGACTTGCATGG - Intergenic
939853011 2:147321892-147321914 TGCTGGGTTCTCAACTTGCATGG + Intergenic
940148974 2:150578367-150578389 TGCTGGGTTTAGCACTTGCATGG - Intergenic
940425889 2:153531814-153531836 TGCTGGGTTTCGGACTTGCATGG - Intergenic
940691581 2:156926035-156926057 TGCTGGGCTTTGAAGTTGCATGG - Intergenic
940783553 2:157958794-157958816 TGCTGGGTTTCAGACTTGGATGG - Intronic
941093016 2:161199978-161200000 TGCTAGTCTTTGAAATTGGAAGG + Intronic
941261880 2:163307414-163307436 TGCTGGGTTTTGAACCTGAGTGG + Intergenic
941335605 2:164240393-164240415 TGCTGGATTTTGGACTTGCATGG - Intergenic
941423993 2:165320158-165320180 TGCTGGATTTTGAACTTGCATGG - Intronic
941455237 2:165707216-165707238 AGCTAGGATTTGAATTTAGATGG - Intergenic
941468848 2:165860389-165860411 TGCTGGATTTTGGACTTGCATGG - Intronic
941803522 2:169687490-169687512 TGCTGGATTTTGGACTTGCATGG - Intronic
942281034 2:174364177-174364199 TGCTGGATTTTGGACTTGCATGG - Intronic
942367014 2:175238795-175238817 TGCTAGATTTTGGACTTGCATGG - Intergenic
942420041 2:175797836-175797858 TGCTGGCTTTTGGACTTGCATGG + Intergenic
942704376 2:178752954-178752976 TGCTTGGTTTAGAATTTTGATGG - Intronic
942727594 2:179026884-179026906 TGCTGGATTTTGGACTTGCATGG + Intronic
942769679 2:179502050-179502072 TGCTGGGTTTTGGACTTGGGTGG + Intronic
942842647 2:180381036-180381058 TGCTAGGTGTTGGACTTGCTTGG + Intergenic
943144017 2:184018816-184018838 GACTAGGTTTTGGACTTGAATGG + Intergenic
943268697 2:185770957-185770979 TGCTAGGTTTTAGATTTGCATGG - Intronic
943415016 2:187591034-187591056 TGCTGGGTTTTGGATTTGCATGG - Intergenic
943511314 2:188830788-188830810 TGCTAAATTTTGGACTTGCATGG + Intergenic
943565417 2:189510337-189510359 TGCTGGATTTTGGACTTGCATGG + Intergenic
943705231 2:191027081-191027103 TGCTGGGTTTTGGACTTGATGGG + Intergenic
943889681 2:193271119-193271141 TGCTATGTTTTGGACTTGCTTGG - Intergenic
943902868 2:193463718-193463740 TGCTAGATTTTGAACTTGCTTGG + Intergenic
944010073 2:194964690-194964712 TGCTGGATTTTGGACTTGCATGG - Intergenic
944307387 2:198193988-198194010 TGCTGGGTTTTTGACTTGCATGG - Intronic
944338393 2:198565449-198565471 TGCTGGGTTTCAAACTTGCATGG + Intronic
944470245 2:200045462-200045484 TGCTGGGCTTTGGACTTGCATGG - Intergenic
944943007 2:204651369-204651391 TGCTGGGTTTTGGACTTGCATGG - Intronic
945114179 2:206394486-206394508 TGCTGGGTTTTGGACTTGCATGG + Intergenic
945120733 2:206454747-206454769 TGCTAGGTTTCGGACTTGCATGG - Intronic
945129585 2:206555309-206555331 TCCTAGGTTTTGAACTTGAATGG - Intronic
945356362 2:208843900-208843922 TGCTGCGTTTTGGACTTGAATGG + Intronic
945410174 2:209498186-209498208 TGCTAGGTTTTGAACTTGCATGG - Intronic
945457163 2:210063644-210063666 TGCTGGATTTTGGACTTGTATGG + Intronic
945515486 2:210758905-210758927 TGCTGGGTTTCAAACTTGCATGG - Intergenic
945585106 2:211651674-211651696 TGCTGGGTTTTGAAGATGGTGGG + Intronic
945618771 2:212107346-212107368 TGCTGGATTTTGGACTTGCATGG + Intronic
945713546 2:213330447-213330469 TGCTGGATTTTGCACTTGCATGG + Intronic
945788547 2:214275333-214275355 TGCTAGCTTTTGAATTTGTTTGG + Intronic
946055767 2:216900765-216900787 TGCTAGGTTTAAGACTTGCATGG - Intergenic
946937507 2:224737002-224737024 TGCTGGGTTTTGGACTTGCATGG + Intergenic
946995362 2:225384670-225384692 TGCTGGGTTTTGGACTTGCATGG + Intergenic
947054347 2:226084184-226084206 TTCTGGATTTTGAACTTGTATGG - Intergenic
947443249 2:230141540-230141562 TGCTGGGTTTTGGACTTGCATGG + Intergenic
947903173 2:233739563-233739585 TGCCTGGTTTTGGACTTGCATGG + Intronic
947904586 2:233751228-233751250 TGCCTGGTTTTGGACTTGCATGG + Intronic
1169322463 20:4644932-4644954 TGCTGGGTTTTGGGCTTGTATGG - Intergenic
1169857921 20:10123797-10123819 TGCTGGATTTTGAACTTGCATGG - Intergenic
1169985142 20:11435674-11435696 TGCTGGATTTTGGACTTGCATGG - Intergenic
1170079077 20:12451202-12451224 TGCTGGATTTTGGACTTGCATGG + Intergenic
1170389292 20:15854365-15854387 TGCTAGGTGTTGACCAGGGATGG - Intronic
1170498598 20:16951211-16951233 TGCTAGGTTTTGGATTTGCTTGG + Intergenic
1171001811 20:21422877-21422899 TGCTGGGTTTCAGACTTGGATGG - Intergenic
1171076982 20:22137520-22137542 TGCTGGATTTTGGACTTGCATGG - Intergenic
1171197319 20:23210150-23210172 TGCTAGGTTTTGGACTTTTTTGG + Intergenic
1171525167 20:25803474-25803496 TGCTGGATTTTGGACTTGCATGG + Intronic
1171534358 20:25873128-25873150 TGCTGGATTTTGGACTTGCATGG + Intergenic
1171551660 20:26052410-26052432 TGCTGGATTTTGGACTTGCATGG - Intergenic
1171792779 20:29543713-29543735 TGCTGGATTTTGGACTTGCATGG - Intergenic
1171883415 20:30634134-30634156 TGCTGGGTTTTTGACTTGCATGG - Intergenic
1171884311 20:30640626-30640648 TGCTGGGTTTTTGACTTGCAGGG - Intergenic
1172438356 20:34946576-34946598 TGCTGGGATTTGAACCAGGATGG + Intronic
1172672781 20:36645807-36645829 TGCTTGCTTTTGTTCTTGGATGG - Intronic
1173314769 20:41933112-41933134 TGCTGGGTTTTGGACTTGTGTGG + Intergenic
1173323348 20:42009705-42009727 TACTGGATTTTGGACTTGGATGG - Intergenic
1174965372 20:55208203-55208225 TGCTAGGTTTCGAACTTGCATGG + Intergenic
1175860038 20:62145037-62145059 TGCTAGTTTTAGAAATTTGATGG + Intronic
1176613608 21:9009075-9009097 TGCTGGGATTTGAACTTGTGTGG + Intergenic
1176711573 21:10154798-10154820 TGCTGGGATTTGAACTTGTGTGG - Intergenic
1176842672 21:13853070-13853092 TGCTGGGTTTTTGACTTGCATGG - Intergenic
1176843600 21:13859714-13859736 TGCTGGGTTTTGGACTTGCATGG - Intergenic
1176845364 21:13872417-13872439 TGCTGGGTTTTTGACTTGCATGG - Intergenic
1176846273 21:13879033-13879055 TGCTGGGTTTTTGACTTGTATGG - Intergenic
1176846700 21:13882124-13882146 TGCTGGGTTTTTGACTTGCATGG - Intergenic
1176847199 21:13885569-13885591 TGCTGGGTTTTTGACTTGCAGGG - Intergenic
1176848093 21:13891974-13891996 TGCTGGGTTTTTGACTTGCATGG - Intergenic
1176849008 21:13898575-13898597 TGCTGGGTTTTTGACTTGTATGG - Intergenic
1177130507 21:17248891-17248913 TGCTGGATTTTGGACTTGCATGG + Intergenic
1177212107 21:18083697-18083719 TGCTGGGCTTTGGACTTGCATGG + Intronic
1177406424 21:20673808-20673830 TGCTGGGTTTTGCATTTGAATGG + Intergenic
1177471212 21:21563322-21563344 TGCTAGATTTTGGACTTGCATGG - Intergenic
1177602751 21:23336591-23336613 TGCTGGGTTTCGGACTTGCATGG + Intergenic
1177803311 21:25849139-25849161 TGTCAGGTTTTGGACTTGCATGG + Intergenic
1178029197 21:28505325-28505347 TGCTGGGTTTCAAACTTGCATGG - Intergenic
1178097577 21:29232438-29232460 GGCTAGGATTTGAACCTAGATGG - Intronic
1178207551 21:30487016-30487038 TGCTGGGTTTTGGACTTGTTTGG + Intronic
1178450041 21:32689996-32690018 TGCTAAGTTTTGAACTTGTATGG - Intronic
1179380882 21:40897912-40897934 TGCTTGGTTTTGCACTTGTGTGG + Intergenic
1179936758 21:44610904-44610926 TGCTGGATTTTGGACTTGCATGG + Intronic
1180589059 22:16920372-16920394 TGTTAGGTTTTAAAGTTGCATGG + Intergenic
1181448565 22:23000324-23000346 TGCTGGGTTTTGGACTGGCATGG - Intergenic
1181898107 22:26129051-26129073 TGCCAGGTTTTGATCTGAGATGG - Intergenic
1182127342 22:27825664-27825686 TGCTTGGCTTTGAAGATGGAAGG - Intergenic
1184905148 22:47477999-47478021 TAGTAAGTTTTGAAATTGGAAGG + Intronic
949635895 3:5981266-5981288 AGCTAGATTTTGGACTTGCATGG - Intergenic
949673234 3:6424187-6424209 TGCTAGATTTTAGACTTGAATGG - Intergenic
950110429 3:10415088-10415110 AGGTGGGGTTTGAACTTGGATGG + Intronic
950294654 3:11818526-11818548 TGCTAGGTTTTAAGCTTCAAAGG + Intronic
950561687 3:13733435-13733457 TGCTAGCTTTTGAATTTGTTTGG + Intergenic
950806037 3:15603799-15603821 TGCCAGATTTTGAACTTGCATGG - Intronic
951100705 3:18684692-18684714 AGCTGGGTTTTGGACTTGCATGG + Intergenic
951180606 3:19654480-19654502 TGCCAGGTTTTAAACTTGCATGG - Intergenic
951289906 3:20862925-20862947 CGCTAGATTTTGGACTTGCATGG - Intergenic
951317646 3:21205753-21205775 TGCTGGATTTTGAACTTGCATGG + Intergenic
951446075 3:22782200-22782222 TGCTGGATTTTGAACTTGCATGG - Intergenic
951449303 3:22818779-22818801 TGCTGGGTATTGGACTTGCATGG - Intergenic
951452130 3:22851919-22851941 TGCTGGATTTAGAACTTGCATGG - Intergenic
951773427 3:26283430-26283452 CGCTGGATTTTGAACTTGCATGG - Intergenic
952105464 3:30065134-30065156 TGCTAGATTTTGGACTTGCATGG - Intergenic
952132619 3:30383166-30383188 TGCTGAGTTTTGAACTTGAATGG - Intergenic
952139229 3:30459575-30459597 TGCTGGGTTTTGAACTTGCATGG + Intergenic
952247170 3:31607015-31607037 TGCTGGATTTTGGACTTGCATGG + Intronic
952569844 3:34701420-34701442 TGCTGGGTTTTGGACTTGCATGG - Intergenic
952674284 3:36008394-36008416 TCCTTGGTTTTGGACTTGTATGG - Intergenic
952807896 3:37374821-37374843 TGCTGGGTTTTTAACCTGCATGG - Intergenic
952831330 3:37567694-37567716 CGCTGGGTTTTGGACTTGCATGG - Intronic
953074352 3:39554302-39554324 TGCTAGCTTTTGAATTTGTTTGG - Intergenic
953092307 3:39741003-39741025 TGCTAGCTTTTGAATTTGTTTGG + Intergenic
953185043 3:40629815-40629837 GGCTAGGTTTTGGATTTGCATGG + Intergenic
953503839 3:43463549-43463571 TGCTGGATTTTGGACTTGCATGG + Intronic
953624758 3:44561708-44561730 TGCTTGGTTTTGGACTTGCATGG - Intronic
953826843 3:46260524-46260546 TGCTGGATTTTGAATTTGCATGG - Intronic
954426881 3:50448009-50448031 GGCTAGGTTTTGTTCATGGAGGG - Intronic
954507897 3:51094700-51094722 TGCTTGGTTTTGAATTTGCTTGG + Intronic
955048458 3:55384645-55384667 TGCCAGTTTTTGAGCTGGGAGGG - Intergenic
955167353 3:56527493-56527515 TGTTGGATTTTGAACTTGCAGGG + Intergenic
955435404 3:58894421-58894443 TGCTGGATTTTGGACTTGCATGG - Intronic
955826380 3:62951870-62951892 TGCTGGATTTTGGACTTGCATGG + Intergenic
955858999 3:63306746-63306768 TGAAAGGTTTTGCACTTGGGAGG + Intronic
955885052 3:63589176-63589198 TTTTAGGTTTTGTCCTTGGATGG - Intronic
956191841 3:66615524-66615546 TTCAAGGTTTTGAACTGAGAAGG + Intergenic
956282183 3:67569574-67569596 TGCTAGGTTTTGGACTTGCTTGG + Intronic
956489269 3:69753721-69753743 TGCTGGGTTTTGGACTTGCATGG + Intronic
956911464 3:73822044-73822066 TGCTGGGTTTTGGACTTGCATGG + Intergenic
957113246 3:75992892-75992914 TGCTGGATTTTGGACTTGCATGG + Intronic
957131980 3:76234754-76234776 TGCTAAGTTTTGAACTTCCTTGG + Intronic
957144986 3:76412600-76412622 TGCTAGATTTTGGACTTGCATGG - Intronic
957160217 3:76601025-76601047 TGCTGGATTTTGAACTTGTGTGG - Intronic
957293489 3:78307049-78307071 TGCTGGGTTATGGACTTGCATGG + Intergenic
957370930 3:79293415-79293437 TGCTAGCTTTTGAATTTGTTTGG + Intronic
957470699 3:80654154-80654176 TGCTGGATTTTGGACTTGCAGGG + Intergenic
957609945 3:82453345-82453367 TGCCTGGTTTTGGACTTGCATGG + Intergenic
957655091 3:83063780-83063802 TGCTAGGTTTTGGACTAGCTTGG - Intergenic
957674368 3:83347373-83347395 TGCTGGATTTTGGACTTGCATGG + Intergenic
957769103 3:84665310-84665332 TGCTGAGTTTTGAACTTGGGAGG - Intergenic
957896249 3:86424492-86424514 TGCTGGATTTTGGACTTGCATGG - Intergenic
957945399 3:87057195-87057217 TGCTGGAGTTTGGACTTGGATGG - Intergenic
957978402 3:87476018-87476040 TGCTAGGTTTTGAGATGGAAGGG - Intergenic
958026353 3:88054451-88054473 TACAAGGTTTTTAACATGGATGG - Exonic
958160074 3:89808185-89808207 TGTTAGATTTTGGACTTGCATGG - Intergenic
958475024 3:94569412-94569434 TGTTAGGTTTTGGACTTGCATGG + Intergenic
958560426 3:95742355-95742377 TGCTGGGTTTTGGACTCGCATGG - Intergenic
958611814 3:96436308-96436330 TGCTTGATTTTGGACTTGCATGG - Intergenic
958860316 3:99437608-99437630 TGCTGGATTTTGAACTTGCATGG + Intergenic
958935391 3:100250685-100250707 TGTTGGGTTTTGGACTTGCATGG - Intergenic
959004786 3:101008184-101008206 TGCTGGATTTTGGACTTGTATGG - Intergenic
959054531 3:101554207-101554229 TGCTGGATTTTGGACTTGCAGGG + Intergenic
959161094 3:102725113-102725135 TGCTGGGTTTTGGACTTACATGG + Intergenic
959228608 3:103618677-103618699 TGCTAGATTTTGGACTTGTATGG - Intergenic
959233576 3:103690111-103690133 TGCTGGATTTTGGACTTGCATGG - Intergenic
959303402 3:104630693-104630715 TGCTGGGTTTCAAACTTGCATGG - Intergenic
959507996 3:107176680-107176702 TGTTGGGTTTTGGACTTGCATGG + Intergenic
959740610 3:109714880-109714902 TACTAGGTTTTGGAATTGGTTGG + Intergenic
959752539 3:109855510-109855532 TGCTGGGTTTTGAACTTGCTTGG - Intergenic
959769279 3:110072839-110072861 TGCTGGATTTTGAACTTGCATGG + Intergenic
959803639 3:110525344-110525366 TGCTACATTTTGGACTTGCATGG + Intergenic
959815706 3:110671202-110671224 TGCTGAATTTTGAACTTGCATGG + Intergenic
959838939 3:110951660-110951682 TGCTGGGTTTTGGATTTGCATGG + Intergenic
959973489 3:112432465-112432487 TGCTGGATTTTGGACTTGCATGG + Intergenic
960021895 3:112964509-112964531 TGCTGGATTTTGGACTTGCATGG + Intronic
960191649 3:114713662-114713684 TGCCAGGCTTTGAACATTGAAGG + Intronic
960341438 3:116479523-116479545 TCCTGGATTTTGAACTTGCATGG + Intronic
960486575 3:118259746-118259768 TGCTAGATTTTGGACTTACATGG + Intergenic
961634129 3:128322209-128322231 AGCTGGGATTTGAACCTGGACGG - Intronic
961701975 3:128751473-128751495 TGCTGGATTTTGGACTTGGATGG + Intronic
961788494 3:129361610-129361632 TGCTGGATTTTGAACTTGCATGG - Intergenic
961918041 3:130397783-130397805 TGATAGATTTGGAACTTGGCAGG - Exonic
962125140 3:132609245-132609267 TGCTAGCTTTTGAATTTGTTTGG - Intronic
962692253 3:137910718-137910740 TTCTTGGTTTTGAATTGGGAGGG - Intergenic
963003551 3:140705469-140705491 TGCTGGGTTTTGGACTTGTATGG - Intergenic
963072759 3:141318611-141318633 TGCTAGATTTCGGACTTGCATGG - Intergenic
963368365 3:144367177-144367199 TGCTGGATTTTGGACTTGCATGG - Intergenic
963441394 3:145344628-145344650 TGCTGGATTTTGGACTTGCATGG - Intergenic
963494775 3:146045265-146045287 TGCTTGGTTTTGGACTTGTATGG - Intergenic
963592917 3:147286098-147286120 TGCTTGATTTTGGACTTGCATGG - Intergenic
963640639 3:147857940-147857962 TGCTGGGTTTTGGACTTGTGTGG - Intergenic
963777237 3:149451846-149451868 GGATAGGTTTTGAACTTGCATGG - Intergenic
963952912 3:151222083-151222105 TGCTGGATTTTGGACTTGGATGG + Intronic
963980543 3:151531788-151531810 TGCTAGCTTTTGAATTTGTTTGG - Intergenic
964241563 3:154600949-154600971 TGCTGGGTTTTGGACTTGCATGG - Intergenic
964341903 3:155717057-155717079 TGCTGGGTTTTGAGCTTGCATGG - Intronic
964605603 3:158556738-158556760 TGCTAGATTTTGGACGTGCATGG + Intergenic
964853450 3:161119518-161119540 TGCTGGGTTTTGGACTTGCATGG + Intronic
964910844 3:161777722-161777744 TACTGGATTTTGAACTTGCATGG + Intergenic
964920093 3:161885616-161885638 TGCTGGGTTTTGAACTTGCATGG + Intergenic
964933941 3:162059157-162059179 TGCTGGGTTTTGGACCTGCATGG - Intergenic
965134065 3:164739663-164739685 TGCTGGGTTTTACACTTGCATGG - Intergenic
965198915 3:165631755-165631777 TGCTGGATTTTGGACTTGCATGG + Intergenic
965647383 3:170898027-170898049 TGCTAGGTTTCGGACTTGTATGG + Intronic
965662199 3:171053331-171053353 TGCTGGGTTTTGGACTTGCATGG + Intergenic
965795248 3:172432651-172432673 TGCTGGATTTTGGACTTGCATGG - Intergenic
965891487 3:173519592-173519614 TGCTGGGTTTTGAACTTGTGTGG + Intronic
965897358 3:173594341-173594363 TGCTGGATTTTGGACTTGCATGG - Intronic
966059105 3:175733836-175733858 TGCTGGATTTTGGACTTGCATGG - Intronic
966164916 3:177006540-177006562 TGATAGGTTTTGAAGTTGCATGG + Intergenic
966302759 3:178497251-178497273 TGCTGGGTTTTGGACTTGCATGG + Intronic
966466188 3:180233438-180233460 TGCTGGATTTTGGACTTGCATGG - Intergenic
966576786 3:181511328-181511350 TGCTGGATTTTGGACTTGCATGG + Intergenic
967331344 3:188293126-188293148 TGCTAGATTTTGAACTCTGGAGG + Intronic
967412437 3:189180513-189180535 TGCTTGATTTTGGACATGGATGG - Intronic
967450106 3:189613825-189613847 TGCTGGATTTTGGACTTGCATGG + Intergenic
967567474 3:190988926-190988948 TGCTAGGTTTTGGACTTGCATGG + Intergenic
968175997 3:196549881-196549903 TGCTGGATTTTGGACTTGTATGG + Intergenic
968530589 4:1089315-1089337 TGCTGGGTTCTGGACTTGCATGG + Intronic
968885563 4:3329295-3329317 TGGTGTGTTTAGAACTTGGAGGG + Intronic
969128814 4:4975302-4975324 TGCTGGGTTTTGGACTTGCATGG + Intergenic
970097352 4:12479080-12479102 TGCTGGGTTTTGAACTTGCATGG - Intergenic
970099282 4:12502691-12502713 TGCTGGATTTTGGACTTGCATGG - Intergenic
970127569 4:12831899-12831921 TGCTGGATTTTGGACTTGCATGG - Intergenic
970306031 4:14733660-14733682 TGCTGGATTTTGGACTTGCATGG - Intergenic
970357478 4:15270001-15270023 TGCTGGATTTTGGACTTGCATGG + Intergenic
970567855 4:17349962-17349984 TGCTGGGTTTTGGACTTGCATGG - Intergenic
970701659 4:18748399-18748421 TTCTAGGTTTTGAACTAGAGAGG + Intergenic
970744733 4:19281270-19281292 TGCTGGGTTTCCAACTTGCATGG - Intergenic
970790642 4:19854151-19854173 TGCTGGTTTTGGAACTTGCATGG - Intergenic
970868093 4:20782038-20782060 TGCTGGATTTTGGACTTGCAAGG - Intronic
970976426 4:22047823-22047845 TGCTAGATTTTGGACTTGCATGG - Intergenic
971276823 4:25206150-25206172 TGCTTTGGTTTGAACTTAGAAGG + Intronic
971277839 4:25215093-25215115 AGCCAGGTTTTGGACTTGTATGG - Intronic
971378124 4:26071586-26071608 TGCTAGGTTTTATCATTGGAGGG - Intergenic
971510518 4:27417804-27417826 TGCTGGATTTTGGACTTGCATGG + Intergenic
971687390 4:29787054-29787076 TGCTGGATTTTGGACTTGCATGG - Intergenic
971969547 4:33604200-33604222 TGCTGGGTTTCAAGCTTGGATGG - Intergenic
972054275 4:34780425-34780447 TGCTGGATTTTGAACTTGCATGG - Intergenic
972079727 4:35136207-35136229 TGCTAGTTTTTGAATTTGCATGG - Intergenic
972137428 4:35909051-35909073 TGCTGGATTTTGGACTTGCATGG + Intergenic
972301903 4:37792567-37792589 TGCTGGATTTTGGACTTGCATGG + Intergenic
972465196 4:39348920-39348942 TGCTAGGTTTTGGACTTGTTTGG + Intronic
972847229 4:43004669-43004691 TGCTGGGTTTTGGACTTGAATGG + Intronic
972849919 4:43035944-43035966 TGCTGGATTTTGGACTTGCATGG + Intergenic
972976725 4:44644482-44644504 TGCTGGGTTTTAAACTTGCATGG + Intronic
973012401 4:45093153-45093175 TGCTAAGTTTTAAACATGCATGG - Intergenic
973214949 4:47658202-47658224 TGCTGGGTTTTGGGCTTGCATGG - Intronic
973367073 4:49216451-49216473 TGCTGGGTTTTTGACTTGCATGG - Intergenic
973393077 4:49572527-49572549 TGCTGGGTTTTTGACTTGCAGGG + Intergenic
973393551 4:49575955-49575977 TGCTGGGTTTTTGACTTGCATGG + Intergenic
973784797 4:54324654-54324676 TGCTAGCTTTTGTACAAGGATGG - Intergenic
974071509 4:57128150-57128172 TGCTGGATTTTGGACTTGTATGG + Intergenic
974105973 4:57470435-57470457 TGCTAGGTTTTGAATTTGTTTGG + Intergenic
974116961 4:57590703-57590725 TGCTAGGTTTTGGAGTTGCTTGG + Intergenic
974145186 4:57937658-57937680 TGCTGGATTTTGGACTTGCATGG + Intergenic
974188175 4:58466808-58466830 AGGTAGGGTTTGAACTTGGATGG - Intergenic
974202729 4:58662492-58662514 TGCTGGATTTTGGACTTGCATGG - Intergenic
974229329 4:59089930-59089952 TGCCAGGTTTCGAATTTGAAAGG + Intergenic
974248954 4:59360289-59360311 TGCTGGGTTTCGGACTTGTATGG + Intergenic
974267536 4:59604061-59604083 TGCTGGGTTTTGGACTTGGATGG + Intergenic
974271071 4:59652024-59652046 TGCTGGATTTTAAACTTGCATGG + Intergenic
974563394 4:63552669-63552691 TGCTGGATTTTAAACTTGCATGG - Intergenic
974606268 4:64156323-64156345 TGCTGGGTTCTGGACTTGTATGG - Intergenic
974624147 4:64400217-64400239 TACTAGGTTTTGGACTTGCATGG + Intronic
974724251 4:65778092-65778114 TGCTAGATTTTGGACTTGCATGG + Intergenic
974973942 4:68866496-68866518 TGCTGGGTTTTGGACTTGCCTGG + Intergenic
975279271 4:72541242-72541264 TGCTGGATTTCGAACTTGCATGG + Intronic
975285086 4:72607564-72607586 TGGTGGATTTTGAACTTGCATGG + Intergenic
975435205 4:74343853-74343875 AGATGGGTTTTGAACTTGCATGG - Intergenic
975620039 4:76287666-76287688 TGCTAGCTTTTGAATTTGTTTGG + Intronic
975637450 4:76464290-76464312 TGCTGGGTTTCGCACTTGCATGG + Intronic
976011536 4:80494892-80494914 TGCTAGAATTTGAACTTGTGTGG - Intronic
976287487 4:83384633-83384655 TGCTGGGTTTCGGACTTGCATGG - Intergenic
976503059 4:85814498-85814520 TGCTGGATTTTGGACTTGCATGG - Intronic
976542012 4:86288787-86288809 TGATAGGTTTTTAAATAGGAGGG + Intronic
976635741 4:87284973-87284995 TACTGGATTTTGGACTTGGATGG + Intergenic
976636054 4:87287278-87287300 TGCTGGGTTTTGGACTTGCATGG + Intergenic
976660461 4:87535295-87535317 TGCTCTGTTTTGAACTTGCTTGG - Intergenic
976842229 4:89445151-89445173 TGCTAGGTTTCAGACTTGCATGG - Intergenic
976987985 4:91326837-91326859 TGCTGGGTTTTGGACTTGGGTGG - Intronic
977189207 4:93978310-93978332 TGCTGGATTTTGGACTTGCATGG + Intergenic
977339932 4:95744857-95744879 TGCTGGATTTTGGACTTGCATGG + Intergenic
977362066 4:96017866-96017888 TGTTAGGTTTTGAACTTCTGGGG + Intergenic
977396637 4:96479158-96479180 TGCTGGGTTTTGGCCTTGCATGG + Intergenic
977697102 4:99977878-99977900 TACTAGGCTTTGTACCTGGATGG + Intergenic
977783493 4:101006293-101006315 TGCTGGGTTTTGGACTTGCATGG + Intergenic
977984027 4:103360737-103360759 TGCCAGGTTTTGGACTTGCATGG + Intergenic
978322756 4:107516090-107516112 TGCTAGATTTTGGACTTGCATGG + Intergenic
978934069 4:114354534-114354556 TGCTGGATTTTGGACTTGCATGG - Intergenic
979122517 4:116921050-116921072 TGCTGGGTTCTGGACTTGCATGG + Intergenic
979388644 4:120100438-120100460 TGCTAGATTTTGGACTTGCTTGG - Intergenic
979610282 4:122682364-122682386 TGCTAGGTTTCAGACTTGCATGG + Intergenic
979645100 4:123059082-123059104 TGCTGGATTTTGGACTTGCATGG - Intronic
979672684 4:123377339-123377361 AGCTAGGTTTTGTAGTTGGGAGG - Intergenic
979805061 4:124960940-124960962 TGCTGGATTTTGAAATTGTATGG - Intergenic
979881456 4:125964277-125964299 TGCTGGGTTTTGGACTTGTGTGG + Intergenic
980218411 4:129880949-129880971 TGCTAGCTTTTGAATGTGTATGG + Intergenic
980458552 4:133075937-133075959 TGCTGGGTTTCAGACTTGGATGG - Intergenic
980525628 4:133988452-133988474 TATTAGATTTTGAACTTGTATGG - Intergenic
980545736 4:134259663-134259685 TGCTGGATTTTGGACTTGCATGG - Intergenic
980609313 4:135136715-135136737 TGCTAGGTTTTAGACTTGCTTGG + Intergenic
981281601 4:142965802-142965824 TGCTGGATTTTGGACTTGCATGG - Intergenic
981351440 4:143734263-143734285 TGCTGGGTTTTGGACTTGCACGG - Intergenic
981391611 4:144197346-144197368 TGCTGGGTTTTGGACTTGCAGGG + Intergenic
981503030 4:145473005-145473027 TGCTGGGTTTTGAACTTGCATGG - Intergenic
981687937 4:147475874-147475896 TGCTAGGTTTTGAATTTGCTTGG - Intergenic
982428783 4:155298208-155298230 TGCTGGGTTTGGAAGTTGTATGG - Intergenic
982432483 4:155338542-155338564 TTCTGGGTTTTGGACTTGCATGG + Intergenic
982478291 4:155878695-155878717 TGCTGGATTTTGGACTTGCATGG - Intronic
982627477 4:157785844-157785866 TGCCAGGTTTTGGACTTTCATGG - Intergenic
983075106 4:163316613-163316635 TGCTGGGTTTTGGACTTGCTGGG - Intergenic
983132774 4:164042877-164042899 TGCTGGGTTTTGGACTTGCATGG - Intronic
983351556 4:166596975-166596997 TGCTGTGTTCTGAACTTGCACGG + Intergenic
983419556 4:167500363-167500385 TGCTAGATTTTGGACTTGCATGG - Intergenic
983789838 4:171783021-171783043 TGTTGGATTTTGAACTTGCATGG - Intergenic
983855070 4:172633407-172633429 TGCTGGATTTTGAAGTTGCATGG + Intronic
983985871 4:174060298-174060320 TGCTGGGTTTCAAACTTGCATGG - Intergenic
984065655 4:175044316-175044338 TGCTGGGTTTTGGATTTGCATGG + Intergenic
984116119 4:175683210-175683232 TGCTGTATTTTGAACTTGCATGG + Intronic
984117141 4:175695513-175695535 TGCTAGATTTTGGACTTGCATGG + Intronic
984219402 4:176955029-176955051 TATTAGATTTTGAACTTGCATGG - Intergenic
984416066 4:179459576-179459598 TGCTGGATTTTGGACTTGCATGG + Intergenic
984424285 4:179563551-179563573 TGCTAGATTTTGATCCTGCAGGG + Intergenic
984774345 4:183467559-183467581 TGCTGGATTTTGGACTTGCACGG + Intergenic
984900283 4:184580388-184580410 TGCTGGATTTTGGACTTGCAAGG - Intergenic
985304398 4:188522506-188522528 TGCTGGATTTTGGACTTGCATGG + Intergenic
985371799 4:189292786-189292808 TGATTGGTTTTGGACTTGCATGG + Intergenic
985381411 4:189398909-189398931 CCCTAGGTTTTGAACTTTGTAGG - Intergenic
1202764570 4_GL000008v2_random:138967-138989 TGCTGGGTTTTTGACTTGCATGG - Intergenic
1202765055 4_GL000008v2_random:142391-142413 TGCTGGGTTTTTGACTTGCAGGG - Intergenic
986467265 5:8038067-8038089 TGCTGGATTTTGTACTTGCATGG + Intergenic
986582419 5:9279255-9279277 TGCTGGGTTTTGGACTTGCATGG + Intronic
986680015 5:10224176-10224198 TGCTGGATTTTGGACTTGCATGG - Intergenic
986805978 5:11309434-11309456 TGCTGGGTTGTAAACTTGAATGG + Intronic
986904941 5:12485123-12485145 TGTTGGGTTTTGAACTTGCATGG - Intergenic
986924529 5:12731070-12731092 TGCTAAGTTTTGGACTTACATGG - Intergenic
986983518 5:13475392-13475414 TGCTGGATTTTGGACTTGCATGG + Intergenic
987102494 5:14604709-14604731 TGCTGGATTTTGGACTTGCATGG - Intronic
987201652 5:15583560-15583582 TGCTGGATTTTGGACTTGCATGG - Intronic
987260314 5:16196040-16196062 TGCTGGATTTTGGACTTGCATGG - Intergenic
987473858 5:18366504-18366526 TGCTGGATTTGGAACTTGCACGG - Intergenic
987488400 5:18548415-18548437 TGCTGGGTTTTGAACTTACTTGG - Intergenic
987510385 5:18829229-18829251 TGCTGGCTTTTGGACTTGCATGG + Intergenic
987514480 5:18888289-18888311 TGCTGGATTTTGGACTTGCATGG - Intergenic
987531737 5:19130346-19130368 TGCTGGGTTTTGGACTTGCATGG - Intergenic
987542865 5:19277387-19277409 TGCTGGGTTTTGGACTTGCATGG + Intergenic
987650335 5:20732804-20732826 TGCTGGGTTTTGGATTTGGATGG - Intergenic
987658489 5:20839854-20839876 TGCTGGGTTTTGGACTTGCATGG + Intergenic
987663227 5:20904605-20904627 TTCTGGGTTTTGAACTTGCATGG - Intergenic
987708958 5:21485577-21485599 TGCTGGGTTTTGGACTTGCATGG - Intergenic
987737724 5:21867573-21867595 TGCTGGATTTTGAACTTGCTTGG + Intronic
987811826 5:22846603-22846625 TGCTGGATTTTGAATTTTGATGG + Intronic
987991487 5:25218062-25218084 TGCTGGATTTTGGACTTGAATGG - Intergenic
988016155 5:25562971-25562993 TGCTGTGTTTTGGACTTGCATGG - Intergenic
988038707 5:25860849-25860871 TGCTAGATTTTGGACTTGCATGG - Intergenic
988134939 5:27158505-27158527 TGCCAGATTTTGGACTTAGATGG + Intergenic
988142707 5:27264101-27264123 TGCTGGGTTTTGAATTTGCATGG + Intergenic
988272267 5:29032467-29032489 TGCTGGGTTTTGAGCTTGCATGG - Intergenic
988335958 5:29909487-29909509 TGCTGGATTTTGGACTTGTATGG - Intergenic
988366845 5:30310825-30310847 TGCTGGGTTTCGGACTTGCATGG + Intergenic
988426772 5:31073882-31073904 TGCTGGATTTTGGACTTGCATGG - Intergenic
988668863 5:33359898-33359920 TGCTGGATTTTGGACTTGCATGG - Intergenic
988740042 5:34061121-34061143 TGCTAGATTTTGGACTTGCATGG - Intronic
988745216 5:34128663-34128685 TGCTGGGTTTTGGATTTGGATGG + Intergenic
988750656 5:34188569-34188591 TGCTGGGTTTTGGACTTGCATGG + Intergenic
988759464 5:34297580-34297602 TTCTGGGTTTTGAACTTGCATGG + Intergenic
988764008 5:34350220-34350242 TGCTGGATTTTGGACTTGCATGG - Intergenic
988765196 5:34366090-34366112 TGCTGGGTTTTGGACTTGCATGG - Intergenic
988894370 5:35656096-35656118 TTCTAGGTTGTGCACCTGGATGG + Intronic
988927751 5:36006541-36006563 TGCTGGGTTTTGGACTTGTATGG - Intergenic
988928620 5:36014014-36014036 TTCTGGGTTTTGAACTTGCTTGG + Intergenic
989067717 5:37480986-37481008 TGCTGGGTTTTGGACTTGCATGG - Intronic
989228993 5:39065719-39065741 TGCTGGGTTTTGAACTTGCATGG - Intronic
989434745 5:41397860-41397882 TGCTGGGTTTTTGACTTGCATGG + Intronic
989778044 5:45232718-45232740 TGCTGGATTTTGGACTTGCATGG - Intergenic
990520248 5:56572822-56572844 TGCTGGGTTTTGAGCTTGCATGG - Intronic
990683043 5:58267646-58267668 TTCAAGGTTTTAAACTTTGAAGG + Intergenic
990789066 5:59455873-59455895 TGCTGGATTTTGGACTTGCATGG + Intronic
990844498 5:60121992-60122014 TGCTGGATTTTGAGCTTGCATGG - Intronic
990883680 5:60568467-60568489 TGCTGGGTTTTGGACTTACATGG - Intergenic
991105751 5:62840178-62840200 TGCTAGCTTTTGAATTTGTTTGG - Intergenic
991136333 5:63186192-63186214 TGCTGGGTTTTAAACTTGCATGG + Intergenic
991735797 5:69630494-69630516 TGCTGGGTTTTGGACTTGCATGG + Intergenic
991738925 5:69651782-69651804 TGCTGGGTTTTGGACTTGCATGG + Intergenic
991759273 5:69904649-69904671 TGCTGGGTTTTGGACTTGCATGG - Intergenic
991776423 5:70089919-70089941 TGCTGGGTTTTGAACTTGCATGG + Intergenic
991788063 5:70213473-70213495 TGCTGGGTTTTGGACTTGCATGG + Intergenic
991790500 5:70231523-70231545 TGCTGGGTTTTGGACTTGCATGG + Intergenic
991812291 5:70486133-70486155 TGCTGGGTTTTGGACTTGCATGG + Intergenic
991815250 5:70506610-70506632 TGCTGGGTTTTGGACTTGCATGG + Intergenic
991818386 5:70527899-70527921 TGCTGGGTTTTGGACTTGCATGG + Intergenic
991838502 5:70779715-70779737 TGCTGGGTTTTGGACTTGCATGG - Intergenic
991855710 5:70965366-70965388 TGCTGGGTTTTGAACTTGCATGG + Intergenic
991869725 5:71098144-71098166 TGCTGGGTTTTGAACTTGCATGG + Intergenic
991880510 5:71213837-71213859 TGCTGGGTTTTGGACTTGCATGG + Intergenic
991882947 5:71231858-71231880 TGCTGGGTTTTGGACTTGCATGG + Intergenic
992215915 5:74524505-74524527 TGCTAGATTTTGGACTTGCATGG + Intergenic
993309768 5:86314322-86314344 TGCTGGATTTTGGACTTGAATGG + Intergenic
993443016 5:87979173-87979195 TGCCGGGTTTTGGACTTGCATGG + Intergenic
993945983 5:94117159-94117181 TGCTGGATTTTGGACTTGCATGG + Intergenic
993985494 5:94592333-94592355 TGCCAGATTTTGGACTTGCATGG - Intronic
994073665 5:95628448-95628470 TGCTGGGTTTTGGACTTGCATGG - Intergenic
994285234 5:97956325-97956347 TGCTGGGTTTTGGACTTGCGTGG + Intergenic
994421079 5:99526922-99526944 TGCTGGGTTTTGGATTTGCATGG - Intergenic
994485962 5:100387392-100387414 TGCTGGGTTTTGGACTTGCATGG + Intergenic
994548806 5:101205458-101205480 TGCTGGATTTTGGACTTGCATGG + Intergenic
994580220 5:101632295-101632317 TGCTGGGTTTTGTACTTGTATGG - Intergenic
994592434 5:101789651-101789673 TGCTGGATTTTGGACTTGCATGG + Intergenic
994828611 5:104747561-104747583 AGCTAGATTTTGGACTTGCATGG + Intergenic
994925698 5:106114770-106114792 TGCTAGGTTTCAGACTTGCAAGG + Intergenic
994936128 5:106255643-106255665 TGCTAGGTTTTGAACTTGCATGG + Intergenic
995117799 5:108501044-108501066 TGCTGGGTTTTGAGCTTGCATGG + Intergenic
995120513 5:108531389-108531411 TGCTGGATTTCGAACTTGCATGG - Intergenic
995559370 5:113364292-113364314 TGCTGGGTTTTGGACTTGCATGG - Intronic
995572229 5:113492182-113492204 TGCTAGGTTTTGGACTTTCTTGG + Intergenic
995591529 5:113705320-113705342 TGCTGGGTTTTGAACTTGCATGG - Intergenic
995698358 5:114905274-114905296 TGCTAGATTTTGGATTTGCATGG - Intergenic
995774551 5:115711520-115711542 TGCTGGATTTTGGACTTGCATGG - Intergenic
995997789 5:118322311-118322333 TGTTAGATTTTGGACTTGCATGG - Intergenic
996641699 5:125762207-125762229 TGCTGGATTTTGGACTTGCATGG + Intergenic
996792641 5:127309081-127309103 TGCTAGGACTTGAAAGTGGAAGG - Intronic
996829098 5:127720291-127720313 TGCTGAGTTTTGGACTTGCATGG - Intergenic
996839825 5:127836167-127836189 TGCTGGATTTTGGACTTGCATGG - Intergenic
996885250 5:128346168-128346190 TGGTCTGTTTTGAAGTTGGAGGG - Intronic
996971685 5:129377122-129377144 GGCTAGGTTTTGAAGTAGGAAGG - Intergenic
997036770 5:130202418-130202440 TGCTGGATTTTGGACTTGCATGG - Intergenic
997091499 5:130864136-130864158 TGCTGGATTTTGGACTTGGATGG - Intergenic
997246673 5:132355711-132355733 TGCTGGGTTTTGAATTTGCATGG + Intergenic
997789416 5:136743587-136743609 TGCTGGGTTTGGGACTTGCATGG + Intergenic
998144743 5:139720774-139720796 CGCTGGATTTTGAACTTGCATGG + Intergenic
998725164 5:145004208-145004230 TGCTAAGTTTTGAACTTGCTTGG + Intergenic
998728790 5:145049985-145050007 TGCTAGGCTTCCAACTTGGCTGG - Intergenic
999986152 5:157007402-157007424 TGCTGGGTTTTAGACTTGCATGG - Intergenic
1000053029 5:157578368-157578390 TGCTAGGTTTTGCACTTTTGGGG - Intergenic
1000270419 5:159678677-159678699 TGCTGGGTTTTGGACTTGCATGG - Intergenic
1000581107 5:163036055-163036077 TACTAGATTTTGGACTTGCATGG + Intergenic
1000717991 5:164670295-164670317 TTCTAGGTTTTGCACTTTGGGGG + Intergenic
1000751024 5:165097175-165097197 TGCTGGATTTTGGACTTGCATGG - Intergenic
1000777799 5:165441748-165441770 TGCTGGATTTTGGACTTGCATGG - Intergenic
1001294525 5:170489636-170489658 TGCTTGGTCTTGAAGTTGAAAGG + Intronic
1002328893 5:178428378-178428400 TGGTAGGTTTTGATCCAGGAAGG - Intronic
1003000308 6:2325620-2325642 TTCTGGGTTTTGGACTTGCATGG + Intergenic
1003402165 6:5799664-5799686 TGTTAGGTTTTGAACTTACCTGG - Intergenic
1003439321 6:6124409-6124431 TGCTGGGTTTCAAACTTGCATGG + Intergenic
1003442725 6:6158696-6158718 TGCTCGGTTGTGGACATGGAGGG + Intronic
1003484341 6:6562902-6562924 TGCTGGGTTTTGGACTTGCATGG - Intergenic
1003670390 6:8151920-8151942 TTCAAGGTTTGAAACTTGGAAGG - Intergenic
1004165802 6:13255655-13255677 TGCTAGGTTTAGGACTTACATGG - Intronic
1004245705 6:13973132-13973154 TGCTGGATTTTGGACTTGCATGG + Intronic
1004299866 6:14447556-14447578 TGCTAGGTTTTGAACCTGCTTGG - Intergenic
1004756662 6:18617916-18617938 TGCTGGGTTTTAAACTTGAGTGG - Intergenic
1005028893 6:21491130-21491152 TGCTTGGGTCTGAAGTTGGAAGG + Intergenic
1005300984 6:24470103-24470125 CGTTAGGTTTGGAACCTGGACGG + Intronic
1005543340 6:26836412-26836434 TGCTGGGTTTTGGATTTGGATGG + Intergenic
1005548728 6:26894874-26894896 TGCTGGGTTTTGGACTTGCATGG + Intergenic
1007014007 6:38444561-38444583 AGCTAGGATTTTAACTTGGGTGG - Intronic
1007265856 6:40595381-40595403 TGCTAGGTTTGGCAATTTGAAGG + Intergenic
1007964160 6:45988236-45988258 TGCTAGGTTTTGGACTTGCTTGG - Intronic
1008220801 6:48851810-48851832 TGCTGGATTTTGTACTTGCATGG - Intergenic
1008260935 6:49366106-49366128 TGCTAGGTTTTGGACTTGCATGG - Intergenic
1008637746 6:53428411-53428433 TGCTGGGTTTTGTTGTTGGATGG + Intergenic
1008871044 6:56272314-56272336 TGCCAGGTTTTGGACTTGAATGG + Intronic
1008930240 6:56931735-56931757 TGCTGGATTTTGGACTTGCATGG + Intronic
1009014164 6:57878582-57878604 TGCTGGGTTTTGGATTTGGATGG + Intergenic
1009019482 6:57935986-57936008 TGCTGGGTTTTGGACTTGCATGG + Intergenic
1009503224 6:64443212-64443234 TGCTGGATTTTGGACTTGCATGG + Intronic
1009538593 6:64923722-64923744 CGCTGGATTTTGAACTTGCATGG - Intronic
1009547124 6:65034077-65034099 TGCTGGGTTTTGAACTTGCACGG + Intronic
1009710296 6:67309066-67309088 TGCAGTGTTTTGAACTTGCATGG + Intergenic
1009732242 6:67622837-67622859 TGCTGGATTTTGGACTTGCATGG + Intergenic
1009878730 6:69538734-69538756 TGCAAGGTATGGAATTTGGAAGG + Intergenic
1009980376 6:70720212-70720234 TGCTGGATTTTGGACTTGCATGG - Intronic
1010005614 6:70992065-70992087 TGCCAGGTTTTGGACTTGAGTGG + Intergenic
1010366561 6:75058622-75058644 AGCCAGGTTTTGGACTTGGATGG - Intergenic
1010517332 6:76789561-76789583 TGCTGGATTTTGGACTTGCATGG - Intergenic
1010527817 6:76924894-76924916 TGCTGGGTTTTGGATTTGCATGG + Intergenic
1010531029 6:76967236-76967258 TGCTGGATTTTGGACTTGCATGG + Intergenic
1010643032 6:78354146-78354168 TGCTGGGGTTTGGACTTGCAAGG - Intergenic
1010920301 6:81672772-81672794 TGCTGGATTTTGGACTTGCATGG - Intronic
1010978244 6:82340899-82340921 TGCTGGGTTTAGGACTTGCATGG - Intergenic
1011080955 6:83489813-83489835 TGCTAGGTTTTGGACTTGCCTGG - Intergenic
1011263990 6:85496874-85496896 TGCTGGATTTTGGACTTGCATGG - Intergenic
1011311435 6:85983927-85983949 TGCTGGGTTTTGAACTTGAATGG - Intergenic
1011504576 6:88027957-88027979 TGCTGGGTTTTGATCTTGCATGG - Intergenic
1011835149 6:91421920-91421942 TGCTAGATTTTGGACTTGAATGG + Intergenic
1012120862 6:95365511-95365533 TGCTGGGTTTCGAATTTGCATGG - Intergenic
1012281120 6:97329041-97329063 TGCTGGATTTTGGACTTGCATGG + Intergenic
1012677639 6:102137351-102137373 TGCTAGGTTTCGAACTTGCGTGG - Intergenic
1012826290 6:104151198-104151220 TGCTGGATTTTGGACTTGCATGG - Intergenic
1012883364 6:104816934-104816956 TGCTAGGTTTCAGACTTGCATGG + Intronic
1013337314 6:109176986-109177008 TGCCAGATTTTGAACTTTCATGG + Intergenic
1013890458 6:115020749-115020771 TGCTGGATTTTGGACTTGCATGG - Intergenic
1014043031 6:116851222-116851244 TGCTGGATTTTGGACTTGCATGG + Intergenic
1014075541 6:117230624-117230646 TACTGGGTTTTGGACTTGCAAGG - Intergenic
1014133703 6:117864003-117864025 TGCTGGATTTTGGACTTGTATGG - Intergenic
1014374712 6:120658789-120658811 TGCTGGCTTTTGGACTTGCATGG - Intergenic
1014576598 6:123081760-123081782 TGCTGGATTTTGCACTTGCATGG - Intergenic
1014621616 6:123674538-123674560 TGCTGGATTTTGGACTTGCATGG - Intergenic
1014771011 6:125458180-125458202 TGCTGGATTTTGGACTTGCATGG - Intergenic
1014771862 6:125466124-125466146 TGCTAGATTTAGGACTTGCATGG + Intergenic
1014775746 6:125507613-125507635 TGCTAGGTTTTAGACTTGCTTGG + Intergenic
1014933852 6:127364313-127364335 TGACAGGTTTTGGACTTGCATGG + Intergenic
1014961737 6:127695146-127695168 TGGTAGGTTTTGGACTTGCCTGG - Intergenic
1015252655 6:131142946-131142968 TGCTAGGTTTTGGACTTATGTGG + Intronic
1015652581 6:135479464-135479486 TGCTGGGTTCTGGACTTGCATGG + Intronic
1015677031 6:135761931-135761953 TGCTGGATTTTGGACTTGCATGG - Intergenic
1016094565 6:140020044-140020066 TGCTGGATTTTGGACTTGCAGGG - Intergenic
1016126393 6:140408888-140408910 TGCTGAGTTTTGGACTTGCATGG + Intergenic
1016176392 6:141081843-141081865 TGCTGGATTTTGGACTTGTATGG + Intergenic
1016253277 6:142072368-142072390 TGCTGGATTTTGGACTTGCATGG + Intronic
1016359144 6:143249562-143249584 AGCTAAGTGTTGAACTTGGGAGG - Intronic
1016414710 6:143820477-143820499 TGTTGGGTTTTGAACTTGCATGG - Intronic
1016589566 6:145729535-145729557 TGCTAGGTTTTGGACTTGTGTGG + Intronic
1017654355 6:156613559-156613581 GGCTGGGTTTTGGACTTGCATGG - Intergenic
1018041079 6:159922603-159922625 TGCTGGATTTTGGACTTGCATGG + Intergenic
1018485605 6:164238277-164238299 TGCTAGGTTTTGAACTTGTTTGG + Intergenic
1018510601 6:164520383-164520405 TACTGGGTTTTAAACTTGCATGG + Intergenic
1018531019 6:164763448-164763470 TGCTAGGTTTTGGGCTTGCACGG + Intergenic
1020159504 7:5758638-5758660 TGCTGGGTTTTGGACTTGTGTGG + Intronic
1020388386 7:7632302-7632324 TGCTGGATTTTGGACTTGCATGG + Intergenic
1020456070 7:8374716-8374738 TGCTGGATTTTGGACTTGCATGG + Intergenic
1020470192 7:8526215-8526237 TGCTGGATTTTGGACTTGCATGG + Intronic
1020576011 7:9929402-9929424 TGCTAGGTTTTAAATTTGTCTGG - Intergenic
1020582734 7:10025805-10025827 TGCTAGGCTTTTGACTGGGATGG - Intergenic
1020616767 7:10468261-10468283 TGATGGGTTTTAAACTTTGAAGG - Intergenic
1020696616 7:11420905-11420927 TGCTGGGTTTTGGACTTGCATGG + Intronic
1020731668 7:11888498-11888520 TGCTAGATTTTACACTTGCATGG + Intergenic
1020754986 7:12190784-12190806 TGCTGGATTTTGGACTTGCATGG - Intergenic
1020885718 7:13816952-13816974 TGCTGGATTTTGGACTTGCATGG + Intergenic
1021538244 7:21728822-21728844 TGCTAAGTTTTGGACTTGCTTGG - Intronic
1021754113 7:23834229-23834251 TGCTGGCTTTTGAACTTGCATGG + Intergenic
1022549789 7:31227807-31227829 CGCTGGGTTTTGGACTTGCATGG + Intergenic
1022712504 7:32865016-32865038 TGCTGAGTTTTGGACTTGCATGG - Intergenic
1022735357 7:33070831-33070853 TACTGGGTTTTGGACTTGCATGG + Intergenic
1022861919 7:34376462-34376484 TGCTGGGTTTTGGACTTGTGTGG + Intergenic
1022910499 7:34895987-34896009 TGCTGGGTTTTGGACTTGCATGG + Intergenic
1023669444 7:42560583-42560605 CGCTGGGTTTTGGACTTGCATGG + Intergenic
1023690373 7:42779752-42779774 TGGTGGGTTTTGGACTTGCATGG + Intergenic
1024127741 7:46317943-46317965 TTATAGGTTATGCACTTGGAAGG + Intergenic
1024162227 7:46688489-46688511 TGCTGGGTTTCGGACTTGCATGG - Exonic
1024245273 7:47464998-47465020 TGATAGGTTTTGTGCATGGAAGG - Intronic
1024383117 7:48722471-48722493 TGCTGGGTTTTGAACTTGCATGG - Intergenic
1024413704 7:49078545-49078567 TGCTGGATTTTGGACTTGCATGG - Intergenic
1024415173 7:49097388-49097410 TGCCATGTTTTGGACTTGCATGG - Intergenic
1024424683 7:49212201-49212223 TGCTGGATTTTGGACTTGCATGG - Intergenic
1024487252 7:49932450-49932472 TGCTGGATTTTGGACTTGCATGG + Intronic
1024926259 7:54618724-54618746 TGCTGGGTTTTGAACTTCCATGG - Intergenic
1027341068 7:77209294-77209316 TGCTGGGTTTTGGATTTGCATGG - Intronic
1027519027 7:79180890-79180912 TGCTAGATTTTGGACTTGCGTGG - Intronic
1027677846 7:81181446-81181468 TACTGGGTTTTAAACTTGCATGG + Intronic
1027937909 7:84632747-84632769 TGCTGGATTTTGGACTTGCATGG + Intergenic
1028011309 7:85648346-85648368 TGCTGGATTTTGGACTTGCATGG - Intergenic
1028126179 7:87115497-87115519 TGCTGGATTTTGGACTTGCATGG + Intergenic
1028134380 7:87210566-87210588 TGCTGGGTTTTAGACTTGCATGG - Intronic
1028138423 7:87246227-87246249 TGCTGGATTTTGGACTTGCATGG + Intergenic
1028207303 7:88032361-88032383 TGCTGGGTTTTGGACTTGCGTGG + Intronic
1028624451 7:92862653-92862675 TGCTGGATTTCGAACTTGCATGG - Intergenic
1028875396 7:95817340-95817362 TGCTAGGTTTTTACCTAGGCAGG + Intronic
1030072697 7:105711543-105711565 TACTAGGTTTCAAACTTGCATGG - Intronic
1030144608 7:106340857-106340879 TGCTGGATTTTGGACTTGCATGG - Intergenic
1030276496 7:107727063-107727085 TGCTAAGTTTTGGACTTGCTTGG - Intergenic
1030357245 7:108556502-108556524 TGCTTGGTTTTGGACTTGCATGG - Intronic
1030406054 7:109114988-109115010 TGGTAACTTTTGAAGTTGGAAGG + Intergenic
1030510828 7:110480570-110480592 TGCTGGATTTTGGACTTGCATGG - Intergenic
1030548922 7:110933876-110933898 TGCTAGCTTTTGAATTTGTCTGG + Intronic
1030784212 7:113640491-113640513 TGCTGGATTTTGGACTTGCATGG - Intergenic
1030786674 7:113671358-113671380 CGCTGGATTTTGAACTTGCATGG + Intergenic
1030817248 7:114053087-114053109 TGCTAGGTTTTGGATTTGCTTGG + Intronic
1030848158 7:114448081-114448103 TAGTATGTTTTGAACTTGGAGGG + Intronic
1030930820 7:115521707-115521729 TGCTGGGTTTAGAACTTGTGTGG - Intergenic
1031175120 7:118339594-118339616 TGCTGGATTTTGGACTTGCATGG + Intergenic
1031182245 7:118433378-118433400 TGCTGGGTTTTGGACTTGCATGG + Intergenic
1031208419 7:118792222-118792244 TGCTGGGTTTTGGACTTGCATGG - Intergenic
1031262073 7:119533593-119533615 TGCTGGGCTTTAAACTTGCATGG + Intergenic
1031360602 7:120844562-120844584 TGCTGGGTTTGGGACTTGCATGG - Intronic
1031732937 7:125320412-125320434 TTCTGGGTTTTGGACTTGCATGG + Intergenic
1031749613 7:125555986-125556008 TGCTAGGTTTCAGACTTGCATGG - Intergenic
1031796073 7:126175745-126175767 TGCTGGGTTTTGGAATTGCAAGG + Intergenic
1031806739 7:126316641-126316663 TGCAGGGTTTTGGACTTGGGTGG - Intergenic
1032053233 7:128662878-128662900 TGCTGGATTTTGGACTTGCATGG + Intergenic
1033063382 7:138129101-138129123 TGCTGGGTTTTGGACTTACATGG - Intergenic
1033721289 7:144061763-144061785 TGCTAGAGTTTGGACTTGCATGG + Intergenic
1033730308 7:144171688-144171710 TGCTGGATTTTGGACTTGCACGG + Intergenic
1033805755 7:144952965-144952987 TGCTGGGTTTCAAACTTGAATGG - Intergenic
1033998662 7:147385532-147385554 TGCTGGATTTTGGACTTGCATGG - Intronic
1034710309 7:153185422-153185444 TGTTGGGTTTTGAACTTGCATGG - Intergenic
1034851982 7:154502053-154502075 TGCTAGATTTTGGACTTGCATGG + Intronic
1035180404 7:157085196-157085218 TGCTGGGTTTTGGACTTGCATGG + Intergenic
1035308516 7:157950244-157950266 TGCTAGGTTTGGAATTTTCAAGG - Intronic
1037364120 8:18104249-18104271 TGCTGGGTATAGAACTTGCATGG + Intergenic
1037648324 8:20814010-20814032 TGCTAGGTTTTCAAATTTCAGGG - Intergenic
1038403536 8:27304969-27304991 TGCTGGGATTTGAACCTGGTCGG - Intronic
1038631260 8:29246681-29246703 TAGTAAGTTTTGAAATTGGAGGG - Intronic
1038965953 8:32572475-32572497 TGCTAGGATTAGAACTGTGACGG - Intronic
1039631956 8:39121935-39121957 TGCTAGGTTTTGGACTTTGTTGG + Intronic
1039632304 8:39125285-39125307 TGCTAGGTTTTGGACTTTGTTGG + Intronic
1039642673 8:39241090-39241112 TGCTGGATTTTGGACTTGCATGG - Intronic
1040078001 8:43259797-43259819 TGCTGGGTTTTAGACTTGCATGG - Intergenic
1040103494 8:43525297-43525319 TGCTGGGTTTTGGACTTGGAAGG + Intergenic
1040104215 8:43531206-43531228 TGCTAGGATTTAGACTTGCATGG + Intergenic
1040520999 8:48176020-48176042 TGCTATGTTTTGAATGTAGATGG + Intergenic
1040613694 8:49013071-49013093 TTTTAGTTTGTGAACTTGGAGGG + Intergenic
1040679584 8:49792532-49792554 TCCTAGGTTTTGGACTTGTTTGG - Intergenic
1040925919 8:52682234-52682256 TGCTGGATTTCGAACTTGCATGG + Intronic
1040945862 8:52883464-52883486 TGCTGGGTTTTGGACTTGCATGG - Intergenic
1041126350 8:54644225-54644247 TGCTAGGTTTCTAACTTGCTTGG - Intergenic
1041392604 8:57360142-57360164 TGCTGGGTTTTGAACTTGCATGG + Intergenic
1041682301 8:60605675-60605697 TGCTGGGTTTTGAACTTGTATGG + Intronic
1042071551 8:64941007-64941029 TGCCAGGTTTTGAACTTGCATGG - Intergenic
1042132200 8:65598496-65598518 GGCTAGGTTTTTAATTTTGATGG - Intergenic
1042324233 8:67512136-67512158 AGCCAGAATTTGAACTTGGAAGG + Intronic
1042412593 8:68481685-68481707 TGCTGGATTTTGGACTTGCATGG + Intronic
1042605532 8:70541995-70542017 TGCTGGGTTTTGGACTTGCATGG + Intergenic
1042635346 8:70867961-70867983 TGCTGGATTTTGGACTTGCATGG - Intergenic
1043033491 8:75168636-75168658 TGCTGGGTTTTGAACTTGCATGG - Intergenic
1043065648 8:75567451-75567473 TGCCTGGTTTTGGACTTGCATGG - Intergenic
1043085615 8:75827696-75827718 TGTTTGGTTTTGTACTTGCATGG + Intergenic
1043205013 8:77426776-77426798 TGCTGGGTTTTGGACTTGCATGG + Intergenic
1043222752 8:77687409-77687431 TGCTGGGTTTTGGACTTTGATGG + Intergenic
1043303530 8:78764913-78764935 TGGTAGGTTTTGAAATTGAGTGG - Intronic
1043533565 8:81176070-81176092 TGCTGCGTTTTGAACTTGTACGG - Intergenic
1043623843 8:82230191-82230213 TGCTGGGTTTTCGACTTGCATGG + Intergenic
1044193985 8:89352944-89352966 TGCTGGATTTTGGACTTGTATGG - Intergenic
1044370017 8:91399470-91399492 TGGTAGGTTTTGGACTTGCTTGG - Intergenic
1044504611 8:93003814-93003836 TGCTGAGTTTTGAATTTGCATGG - Intronic
1044887374 8:96793839-96793861 TGCTGGATTTTGGACTTGCATGG - Intronic
1045050420 8:98319570-98319592 TGCTGGATTTTGGACTTGCATGG - Intergenic
1045207495 8:100057133-100057155 TGCTGGATTTTGGACTTGCATGG + Intronic
1045438845 8:102190397-102190419 GGCTGGGTTTTGAACTTCCACGG - Intergenic
1045561493 8:103268223-103268245 TGATTGGTTTTGAACTTGAATGG - Intergenic
1045784235 8:105902361-105902383 TGCTGGGTTTTGGACTTGCATGG - Intergenic
1045785824 8:105919040-105919062 TGCTATATTTTGGACTTGCATGG + Intergenic
1046107492 8:109683398-109683420 TATTGGATTTTGAACTTGGATGG + Intronic
1046146895 8:110172256-110172278 TGCTGGTTTTTGGACTTGGGTGG + Intergenic
1046243691 8:111531719-111531741 TGCTGGGTTTTGGACTTGCATGG - Intergenic
1046267160 8:111846105-111846127 TTCTGGGTTTTGAACTTACATGG - Intergenic
1046372263 8:113324955-113324977 TGCTGGATTTTGAACTTGCATGG + Intronic
1046481177 8:114821019-114821041 TCTTAGGTTTTGGACTTGCATGG - Intergenic
1046618036 8:116499204-116499226 TGCTGGATTTTGAACTTGCGTGG - Intergenic
1046839585 8:118841840-118841862 AGCCAGGTTTTGGACTTGTAAGG + Intergenic
1046877978 8:119277366-119277388 TGCTGAGTTTTGAACTTGCATGG - Intergenic
1047116036 8:121842744-121842766 TGCTGGATTTTGGACTTGCATGG + Intergenic
1047565659 8:126040949-126040971 TGCTGGATTTTGGACTTGCATGG + Intergenic
1047649099 8:126900477-126900499 TGCCAAGTTTTGGACTTGCATGG + Intergenic
1047865937 8:129024222-129024244 TGCTGGATTTTGGACTTGCATGG + Intergenic
1047917976 8:129603434-129603456 TCCTGGGTTTTGGACTTGCATGG - Intergenic
1047931822 8:129735761-129735783 TGCTAGCTTTTGAATTTGTTTGG - Intergenic
1047937668 8:129798209-129798231 TGCTGGGTTTTGGTCTTGCATGG - Intergenic
1048153382 8:131916256-131916278 TGGTGGGCTTTGGACTTGGATGG + Intronic
1048755532 8:137733591-137733613 TGCTAGGTTCTGGATTTGGATGG + Intergenic
1048892626 8:138961392-138961414 TGCTAGGTTTTGGATTTGCTTGG + Intergenic
1048895708 8:138990441-138990463 TGCTGGATTTTGGACTTGCATGG - Intergenic
1049825664 8:144666127-144666149 TGCTGGATTTTGAACTTGCAAGG + Intergenic
1050109460 9:2199968-2199990 TGCTGGGTTTTGGACTTGCATGG - Intergenic
1050678412 9:8082493-8082515 TGCTAGCTTTTGAATTTGTTTGG + Intergenic
1050849379 9:10264487-10264509 TGCTGGATTTTGGACTTGCATGG + Intronic
1050894695 9:10872302-10872324 TGCTAGATTTTGGACTTGCATGG - Intergenic
1050996841 9:12231601-12231623 TGCTGGATTTTGGACTTGCATGG - Intergenic
1051807009 9:21005817-21005839 TGCTAGGTTTTGGACTTGCTGGG + Exonic
1051919730 9:22251008-22251030 TGCTGGGTTTTAGACTTGCACGG - Intergenic
1051920769 9:22260747-22260769 TGCTGGGTTTTGAAATTTCATGG + Intergenic
1051946304 9:22573434-22573456 TGCTGGATTTTGGACTTGCATGG + Intergenic
1051975353 9:22941841-22941863 TGCTGGATTTTGGACTTGCATGG - Intergenic
1052179302 9:25505152-25505174 TGGTGGGTTTTGGACTTGCATGG - Intergenic
1052267361 9:26590216-26590238 TGCTGGATTTTGAACTGGCATGG - Intergenic
1052522289 9:29563373-29563395 TGCTGGATTTTGGACTTGCATGG + Intergenic
1052689785 9:31802422-31802444 TGCTGGGTTTTGGATTTGCATGG + Intergenic
1052702129 9:31950296-31950318 TGCTGTGTTTTGGACTTGCATGG - Intergenic
1052878727 9:33586925-33586947 TGCTAGGTTTTTGACTTGCATGG + Intergenic
1053125951 9:35580892-35580914 TGCTGGGTTTTGGACTTGCATGG + Intergenic
1053264167 9:36698534-36698556 TGTTGGGTTTTGGACTTGCATGG - Intergenic
1053332676 9:37229468-37229490 TCCTAGGGTATGAACTTGTACGG + Intronic
1053496817 9:38554207-38554229 TGCTGGGTTTTTGACTTGCATGG - Intronic
1053497250 9:38557284-38557306 TGCTAGGTTTTTGACTTGCATGG - Intronic
1053648565 9:40140489-40140511 TGCTGGGATTTGAACTTGTGTGG - Intergenic
1053666269 9:40320009-40320031 TGCTGGGTTTTTGACTTGCATGG + Intronic
1053757180 9:41323353-41323375 TGCTGGGATTTGAACTTGTGTGG + Intergenic
1053793508 9:41703982-41704004 TGCTGGATTTTGGACTTGCATGG + Intergenic
1053887337 9:42653994-42654016 TGCTTGGATTTGCTCTTGGATGG - Intergenic
1053915849 9:42945056-42945078 TGCTGGGTTTTTGACTTGCATGG + Intergenic
1054151669 9:61610848-61610870 TGCTGGATTTTGGACTTGCATGG - Intergenic
1054181918 9:61915997-61916019 TGCTGGATTTTGGACTTGCATGG + Intergenic
1054226359 9:62461445-62461467 TGCTTGGATTTGCTCTTGGATGG - Intergenic
1054377422 9:64460037-64460059 TGCTGGGTTTTTGACTTGCATGG + Intergenic
1054471437 9:65541987-65542009 TGCTGGATTTTGGACTTGCATGG - Intergenic
1054518340 9:66056274-66056296 TGCTGGGTTTTTGACTTGCATGG - Intergenic
1054536018 9:66235681-66235703 TGCTGGGATTTGAACTTGTGTGG + Intergenic
1055083376 9:72289968-72289990 TGCTGGATTTTGGACTTGCATGG - Intergenic
1055167962 9:73219710-73219732 TGCTGGATTTTGGACTTGCATGG + Intergenic
1055334906 9:75223847-75223869 TTCTGGGTTTTGGACTTGCATGG - Intergenic
1055570131 9:77608190-77608212 TGCTAGGTTTTGGACTTGCTTGG + Intronic
1055579226 9:77690641-77690663 TGCTGGATTTTGGACTTGCATGG - Intergenic
1055698718 9:78917710-78917732 TGCCAGGTTTTGGACTTGCATGG + Intergenic
1055975957 9:81955463-81955485 TGCTGGATTTTGGACTTGCATGG - Intergenic
1056021345 9:82441255-82441277 TGCTGGGTTTTGAACTCACATGG + Intergenic
1056325605 9:85475717-85475739 TGCTGGATTTTGGACTTGCAAGG + Intergenic
1056527200 9:87454636-87454658 TGCTGGGTTTTAGACTTGCATGG - Intergenic
1056630585 9:88289956-88289978 TGCAAGGTTTTGAAAATGAAAGG - Intergenic
1057287845 9:93774680-93774702 TGCTAGGTTTTGGACTTTCTTGG + Intergenic
1058076602 9:100657680-100657702 TGCTGGGTTTTGGACTTGCATGG + Intergenic
1058288501 9:103209558-103209580 TGCTGGGTTTTGGACTTGAATGG - Intergenic
1058385430 9:104429869-104429891 TGCTGGGTTTTGGATTTGCATGG + Intergenic
1058813139 9:108660248-108660270 TGCTGGGTTTTGAACTTGCATGG + Intergenic
1058936099 9:109771197-109771219 TGCTATGTTTGGAATTAGGAGGG + Intronic
1060307179 9:122424453-122424475 TCCTACTTTTTGGACTTGGAAGG - Intergenic
1060308237 9:122435466-122435488 TGCTGGATTTTGGACTTGCATGG + Intergenic
1060622785 9:125082734-125082756 TGCTGGATTTTGGACTTGCATGG + Intronic
1061464681 9:130768294-130768316 TGCTAGGTCTGTAACTTGGGAGG + Intronic
1061891726 9:133625108-133625130 CGCTGGGTTTTGGACTTGTATGG - Intergenic
1202796328 9_KI270719v1_random:123787-123809 TGCTGGGATTTGAACTTGTGTGG - Intergenic
1203545319 Un_KI270743v1:123854-123876 TGCTGGGTTTTTGACTTGCATGG - Intergenic
1203545803 Un_KI270743v1:127280-127302 TGCTGGGTTTTTGACTTGCAGGG - Intergenic
1186053397 X:5624108-5624130 GGCTGGGTTTTGGACTTGCACGG + Intergenic
1186165223 X:6820604-6820626 TGCTGGATTTTGGACTTGCATGG - Intergenic
1186316696 X:8378311-8378333 TGGGAGGTTTTGAACAGGGAAGG + Intergenic
1186500119 X:10044336-10044358 TGCTAGGTTTTGTACTGGCTTGG - Intronic
1186980706 X:14954837-14954859 TGCTGGATTTTGGACTTGCATGG - Intergenic
1187181612 X:16947542-16947564 TGCTGGGATTTCAACTTGAAGGG + Intronic
1187214993 X:17267481-17267503 TGCTGAGATTTGAACTTGGGAGG + Intergenic
1187603835 X:20861876-20861898 TGCTGGGTTTTGGACTTGCATGG + Intergenic
1187628643 X:21143929-21143951 TGCTGGGTTTCGGACTTGCATGG - Intergenic
1187667324 X:21628106-21628128 TGCTGGATTTTGGACTTGCATGG - Intronic
1187843258 X:23510105-23510127 TGCTGGGTTTTAGACTTGCATGG + Intergenic
1187894296 X:23966248-23966270 TGCTAGATTTTGGACTTGTATGG - Intergenic
1188105507 X:26143390-26143412 TGCTAGGTTTCTGACTTGCATGG - Intergenic
1188305650 X:28557741-28557763 TGCTAGGTTTCAGACTTGCATGG - Intergenic
1188325453 X:28796521-28796543 TGCTAGATTTTGGACTTGCATGG - Intronic
1188427467 X:30065638-30065660 TGTTAGGATTTGAGCTAGGAAGG - Intergenic
1188519335 X:31020460-31020482 TGTTAGGTTTTGGACTTGCTTGG + Intergenic
1188807775 X:34613339-34613361 CGCTAGGTTTTGGACTTGCATGG - Intergenic
1188833331 X:34928015-34928037 TGCTGGGTTTCGGACTTGCATGG - Intergenic
1188925879 X:36043525-36043547 TGCTAGGTTTCAGACTTGCATGG - Intronic
1188964804 X:36537596-36537618 TGCTTGGTTTTGGACTTGCATGG + Intergenic
1189011874 X:37053888-37053910 TGCTGGGTTTTGAACTTGCATGG + Intergenic
1189036832 X:37502399-37502421 TGCTGGGTTTTGAACTTGCATGG - Intronic
1189213442 X:39303621-39303643 TGCTGGGTTTAGAACTTGCATGG + Intergenic
1189594309 X:42548095-42548117 TGCTAGGTTTCAAACTTGCATGG - Intergenic
1189652838 X:43208589-43208611 TGTTGGGTTTTGGACTTGCATGG + Intergenic
1190130355 X:47742264-47742286 TGCTGGGTTTTGGACTGGCATGG - Intergenic
1190240483 X:48654378-48654400 TGCTAGGTTTTGGACTTGCTTGG - Intergenic
1190513212 X:51195246-51195268 TGCTGGATTTTGGACTTGCATGG - Intergenic
1190531739 X:51385791-51385813 TGTTAGATTTTGGACTTGCATGG - Intergenic
1190703518 X:53006111-53006133 TGCTGGGTTTTGGACTTGCTTGG - Intergenic
1191597662 X:62963722-62963744 TGCTAGCTTTTGAATTTGTTTGG + Intergenic
1191734815 X:64377512-64377534 TGCTGGGTTTCAAACTTGCATGG + Intronic
1191735444 X:64384103-64384125 TGCTGGGTTTTGTACTTGCATGG - Intronic
1191873415 X:65769568-65769590 TGCTGGGTTATGGACTTGCATGG + Intergenic
1191877802 X:65813529-65813551 TGCTGGGTTTTGGACTTGCATGG + Intergenic
1192071025 X:67941413-67941435 TGCTGGGTTTTGAACTTGCATGG - Intergenic
1192527667 X:71861688-71861710 TGCTGGATTTTGGACTTGTATGG - Intergenic
1192565289 X:72158384-72158406 TGCTGGATTTTGAACTTGTATGG - Intergenic
1192846360 X:74910358-74910380 TGCTGGATTTTGGACTTGCATGG + Intronic
1193029043 X:76878603-76878625 TTCTGGGTTTTGGACTTGCATGG - Intergenic
1193115706 X:77773295-77773317 TGGTTGGTTTTGAACTTTGGGGG + Intronic
1193205145 X:78739422-78739444 TGCTGGGTTTTAAACTTGCAAGG - Intergenic
1193271454 X:79534294-79534316 TGCTAGGATTTAGACTTGCATGG - Intergenic
1193271892 X:79538119-79538141 TGCTGGATTTTGGACTTGCATGG + Intergenic
1193449256 X:81645774-81645796 TGCTGGATTTTGGACTTGCATGG + Intergenic
1193466384 X:81852780-81852802 TGCTGGGTTTCAAACTTGCATGG - Intergenic
1193485156 X:82078389-82078411 TGCTGGATTTTGGACTTGCATGG - Intergenic
1193557562 X:82975019-82975041 TGCAAGGTTTTGGACTTACATGG + Intergenic
1193638105 X:83977995-83978017 TGATAGGTTTTTAACTGGTAGGG + Intergenic
1193777242 X:85657888-85657910 TGCTGGGTTTTGGACTTGACTGG + Intergenic
1193795369 X:85866799-85866821 GGCTGGGTTTTGGACTTGCATGG + Intronic
1193841964 X:86418002-86418024 TGCTAGATGTTGGACTTGCATGG - Intronic
1193850564 X:86532014-86532036 AGCTGGGTTTTGGACTTGCATGG + Intronic
1193865902 X:86729257-86729279 TGCAGGGTTTTGAACTTGCGTGG + Intronic
1193871515 X:86804753-86804775 TGCTAGGTTTCAGACTTGCATGG - Intronic
1193900188 X:87167246-87167268 TGCTTGGTTTCAAACTTGCATGG - Intergenic
1193938428 X:87651569-87651591 TGCTGGATTTTGGACTTGCACGG - Intronic
1193948127 X:87763839-87763861 TGCTGGGTTTTGGACTTGCATGG - Intergenic
1193965214 X:87976372-87976394 TGCTGGGTTTTGGTCTTGCATGG + Intergenic
1193988485 X:88275973-88275995 TGCCAGATTTTGTACTTGCATGG + Intergenic
1193998802 X:88400749-88400771 TGCTGGGTTTTAAACTTGTGTGG + Intergenic
1194038784 X:88914763-88914785 TGCTGGGTTTTGCATTTGCATGG - Intergenic
1194093399 X:89604512-89604534 TGTTAGGTTTTAGACTTGCATGG + Intergenic
1194107711 X:89792493-89792515 GGCCAGGTTTTGGACTTGCACGG - Intergenic
1194120063 X:89950614-89950636 TGATGGGTTTTGAACTTGCATGG - Intergenic
1194145242 X:90254431-90254453 TGCTAGATTTTGGACTTGCATGG - Intergenic
1194216460 X:91135223-91135245 TGCTGGATTTTGGACTTGCATGG + Intergenic
1194235997 X:91383670-91383692 TGCTGGGCTTTGAACTTGCATGG + Intergenic
1194244293 X:91492839-91492861 TGCTTGGTTTTGGACATGCATGG - Intergenic
1194300663 X:92182214-92182236 TGCTGGATTTTGGACTTGCATGG + Intronic
1194503740 X:94708152-94708174 TGCTGGATTTTGGACTTGCATGG - Intergenic
1194563046 X:95446937-95446959 AGCTGGGTTTTGGACTTGCATGG - Intergenic
1194603882 X:95957682-95957704 TGCTGGCTTTTGTACTTGCATGG + Intergenic
1194779906 X:98011336-98011358 TGCTGGATTTTGGACTTGCATGG + Intergenic
1194855204 X:98919192-98919214 TGCTGGGTTTTGGACTTTCATGG + Intergenic
1194864982 X:99054353-99054375 TGCTGGATTTTGGACTTGCATGG + Intergenic
1194982400 X:100453725-100453747 TGCTGGATTTTGGACTTGCATGG + Intergenic
1195195153 X:102490155-102490177 TGCTGGGTTTTGGACTTGCATGG - Intergenic
1195207013 X:102611259-102611281 TGCTGGATTTCGGACTTGGATGG + Intergenic
1195428443 X:104761766-104761788 TGCTGGATTTTGGACTTGCATGG - Intronic
1195522692 X:105849683-105849705 CGCTGGATTTTGAACTTGCATGG - Intronic
1195525850 X:105889199-105889221 TGCTGGATTTTGGACTTGCATGG - Intronic
1195768696 X:108324864-108324886 TGCTGGGTTTTGTACTTTGTAGG - Intronic
1195814146 X:108867284-108867306 TGCTGGGTTTTGGACTTGCATGG - Intergenic
1196036305 X:111149104-111149126 TGCTGGATTTTGGACTTGCATGG - Intronic
1196266870 X:113659966-113659988 TGCTAGCTTTTGAATTTGTTTGG - Intergenic
1196348324 X:114694866-114694888 TGCTATATTTTGATATTGGAGGG + Intronic
1196518235 X:116639980-116640002 TGCTAGGCTTTAGACTTGCATGG - Intergenic
1196973804 X:121137510-121137532 TGCTGGATTTTGGACTTGCATGG - Intergenic
1197035083 X:121863810-121863832 TGGTAGATTTTGAAATTGCAAGG + Intergenic
1197041983 X:121948430-121948452 TGCTTGGTTTTTAACTTGCATGG - Intergenic
1197074679 X:122340629-122340651 TGCTGGATTTTGGACTTGCATGG - Intergenic
1197094215 X:122574390-122574412 TGCTGGGTTTCAAACTTGCATGG - Intergenic
1197265256 X:124362418-124362440 TGCTAGGTTTTGGACTTGCTTGG + Intronic
1197372854 X:125646259-125646281 TGCTGGGTTTAGGACTTGCATGG - Intergenic
1197379498 X:125722113-125722135 TGCTGGATTTTGGACTTGTATGG + Intergenic
1197426698 X:126305561-126305583 TGCTGGATTTTGGACTTGCATGG + Intergenic
1197551982 X:127902405-127902427 TGCTGGGCTTTGGACTTGCATGG + Intergenic
1197569579 X:128132181-128132203 TGCTGGGTTTTGAACGTGCATGG + Intergenic
1197583133 X:128310481-128310503 TGCTGGATTTTGGACTTGCATGG - Intergenic
1197689725 X:129485300-129485322 TGCTGGGTTTTGGACTTGCATGG + Intronic
1197719247 X:129733730-129733752 TGCTGGGTTTCAAACTTGCATGG + Intergenic
1197727187 X:129784150-129784172 TGCCAGGCTTTGAACTTACAGGG + Intronic
1197914648 X:131521502-131521524 TGCTGGATTTTGGACTTGCATGG + Intergenic
1198078970 X:133220721-133220743 TGCTAGGTTTTGGACTTGCTTGG - Intergenic
1198497083 X:137203778-137203800 TGCTGGATTTTGGACTTGCATGG - Intergenic
1198707297 X:139462765-139462787 TGCTGGATTTTGAACTTGCATGG + Intergenic
1198709164 X:139482640-139482662 TGCTTGGTTTTGAACATGTTGGG - Intergenic
1198995207 X:142566670-142566692 TTCTAGGATTTGGACTTGGACGG - Intergenic
1199063683 X:143389179-143389201 TGCTGGGTTTTGGACTTGCATGG + Intergenic
1199078679 X:143552098-143552120 TGCTGGGTTTTGGATTTGCATGG + Intergenic
1199127333 X:144138706-144138728 CGCTAGATTTCGAACTTGCATGG - Intergenic
1199203747 X:145123861-145123883 TGCTTGGTTTTGAAATGTGAGGG - Intergenic
1199203786 X:145124105-145124127 TGCTGGATTTTGGACTTGCATGG - Intergenic
1199250848 X:145659950-145659972 TGTTGGTTTTTGAACTTGCATGG + Intergenic
1199289577 X:146090793-146090815 TGCTGGGTTTTGAACTTGTGTGG + Intergenic
1199309976 X:146311031-146311053 TGCTGAATTTTGGACTTGGATGG - Intergenic
1199329474 X:146542511-146542533 TGCTTGGTTTCAAACTTGCATGG - Intergenic
1199349902 X:146788120-146788142 TGCCAGGTTTCAAACTTGCATGG + Intergenic
1199421631 X:147650829-147650851 TGCTGGGTTTTGAACTTGATTGG + Intergenic
1199480987 X:148298133-148298155 TGCTGGATTTTGGACTTGCATGG + Intergenic
1199515182 X:148668104-148668126 TGCTGGATTTTGGACTTGCATGG - Intronic
1199806415 X:151305192-151305214 TACTGGGTTTTGGACTTGCATGG - Intergenic
1199823131 X:151470961-151470983 GGCTGGGTTTTGGACTTGCATGG - Intergenic
1199931760 X:152530520-152530542 TTCCAGGTTTTGGACTTGCATGG - Intergenic
1200255801 X:154582115-154582137 TGTTGGGTTTTGGACTTGCATGG + Intergenic
1200261968 X:154622288-154622310 TGTTGGGTTTTGGACTTGCATGG - Intergenic
1200353832 X:155526828-155526850 TGTTGGGTTTTGAACTTGCATGG + Intronic
1200446029 Y:3260621-3260643 TGTTAGGTTTTAGACTTGCATGG + Intergenic
1200472925 Y:3608132-3608154 TGATGGGTTTTGAACTTGCATGG - Intergenic
1200491003 Y:3823726-3823748 TGCTAGATTTTGGACTTGCATGG - Intergenic
1200563273 Y:4734137-4734159 TGCTTGGTTTTGGACATGCATGG - Intergenic
1200758452 Y:7013815-7013837 TGCTGGGTTTTGGACTTGCATGG + Intronic
1200925277 Y:8648734-8648756 GACTAGGATTTGTACTTGGAGGG + Intergenic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic
1201734411 Y:17242487-17242509 TGCTAGGTTTTGAATGTGTTTGG + Intergenic
1201921649 Y:19240186-19240208 TGCTGGGTTTTGGACTTTCATGG + Intergenic
1202030018 Y:20561616-20561638 TGCTAGCTTTAGAACTTGCATGG - Intergenic