ID: 1092474261

View in Genome Browser
Species Human (GRCh38)
Location 12:8805845-8805867
Sequence GGCAAGTCCCGCTTTTGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092474257_1092474261 -2 Left 1092474257 12:8805824-8805846 CCCTTCTCCTTCACTCTTAGTGG No data
Right 1092474261 12:8805845-8805867 GGCAAGTCCCGCTTTTGTAGAGG No data
1092474260_1092474261 -9 Left 1092474260 12:8805831-8805853 CCTTCACTCTTAGTGGCAAGTCC No data
Right 1092474261 12:8805845-8805867 GGCAAGTCCCGCTTTTGTAGAGG No data
1092474256_1092474261 -1 Left 1092474256 12:8805823-8805845 CCCCTTCTCCTTCACTCTTAGTG No data
Right 1092474261 12:8805845-8805867 GGCAAGTCCCGCTTTTGTAGAGG No data
1092474259_1092474261 -3 Left 1092474259 12:8805825-8805847 CCTTCTCCTTCACTCTTAGTGGC No data
Right 1092474261 12:8805845-8805867 GGCAAGTCCCGCTTTTGTAGAGG No data
1092474254_1092474261 4 Left 1092474254 12:8805818-8805840 CCCAACCCCTTCTCCTTCACTCT No data
Right 1092474261 12:8805845-8805867 GGCAAGTCCCGCTTTTGTAGAGG No data
1092474250_1092474261 29 Left 1092474250 12:8805793-8805815 CCACCTTTCTGGGGGGCAAGAAA 0: 45
1: 26
2: 48
3: 193
4: 567
Right 1092474261 12:8805845-8805867 GGCAAGTCCCGCTTTTGTAGAGG No data
1092474251_1092474261 26 Left 1092474251 12:8805796-8805818 CCTTTCTGGGGGGCAAGAAACCC 0: 70
1: 42
2: 9
3: 11
4: 128
Right 1092474261 12:8805845-8805867 GGCAAGTCCCGCTTTTGTAGAGG No data
1092474255_1092474261 3 Left 1092474255 12:8805819-8805841 CCAACCCCTTCTCCTTCACTCTT No data
Right 1092474261 12:8805845-8805867 GGCAAGTCCCGCTTTTGTAGAGG No data
1092474252_1092474261 6 Left 1092474252 12:8805816-8805838 CCCCCAACCCCTTCTCCTTCACT No data
Right 1092474261 12:8805845-8805867 GGCAAGTCCCGCTTTTGTAGAGG No data
1092474253_1092474261 5 Left 1092474253 12:8805817-8805839 CCCCAACCCCTTCTCCTTCACTC 0: 54
1: 492
2: 158
3: 118
4: 1064
Right 1092474261 12:8805845-8805867 GGCAAGTCCCGCTTTTGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092474261 Original CRISPR GGCAAGTCCCGCTTTTGTAG AGG Intergenic
No off target data available for this crispr