ID: 1092476978

View in Genome Browser
Species Human (GRCh38)
Location 12:8828014-8828036
Sequence GTCCCAATGCTGGTGGCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 976
Summary {0: 1, 1: 13, 2: 147, 3: 267, 4: 548}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092476978_1092476984 26 Left 1092476978 12:8828014-8828036 CCTGTGGCCACCAGCATTGGGAC 0: 1
1: 13
2: 147
3: 267
4: 548
Right 1092476984 12:8828063-8828085 ACCGTACTGTGTCTCACCCAAGG 0: 1
1: 0
2: 17
3: 169
4: 418

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092476978 Original CRISPR GTCCCAATGCTGGTGGCCAC AGG (reversed) Intronic
900148067 1:1166938-1166960 GACCCAAAGCTGGTGGCTGCTGG + Intergenic
900980496 1:6043507-6043529 GCCCCAATTCTGGTGCCCACAGG + Intronic
901671357 1:10858067-10858089 GTCCCACTGCTGTGGCCCACTGG - Intergenic
903372347 1:22844775-22844797 GTCCCAAGGATGCTGGCCCCAGG - Intronic
903538422 1:24082491-24082513 GGCCCAGTCCTGGTGGCCAGTGG - Intronic
904364490 1:30001760-30001782 GCCCCAATGCTGGCAGGCACAGG - Intergenic
906826947 1:48992391-48992413 GTCCCAGTGGTGGTGGCCACAGG - Intronic
906915557 1:50005225-50005247 GTCCCAGTGCTGGTGGCCACAGG + Intronic
907522736 1:55035015-55035037 GTCCCGCTGCTGGGAGCCACAGG - Intergenic
909209611 1:72807380-72807402 ATCCCATTGCTGGTGGCCACAGG - Intergenic
909271411 1:73627725-73627747 GTCCCACTGGTGGTGACCATGGG + Intergenic
909309501 1:74129017-74129039 GTTCCAGTGGTGGTGGCCACAGG - Intronic
909316356 1:74224078-74224100 GCCCCAGTGGTGGTGGCCACAGG + Intronic
909361730 1:74767747-74767769 TTGCCAATGCTGGTGCCCACAGG - Intergenic
909431397 1:75591030-75591052 GTCATACTGGTGGTGGCCACAGG + Intronic
909615804 1:77606572-77606594 GTCCCAGTGGTGGTGGCCACAGG + Intronic
909870430 1:80731685-80731707 GTTCCAGTGGTGGTGGCCGCAGG + Intergenic
910379165 1:86608201-86608223 GTCATAGTGGTGGTGGCCACAGG - Intergenic
910384571 1:86666646-86666668 GTCCCAGTGATGGTGGCCACAGG + Intergenic
910515277 1:88053836-88053858 GTCCCAGTGGTGGTGGCTAGAGG - Intergenic
910643635 1:89490289-89490311 GTCCCAGTGGTGGTGGCCACAGG + Intergenic
910725023 1:90328830-90328852 GTCCCAGTGGTGGTGGCTGCAGG + Intergenic
911437282 1:97877247-97877269 GTCCCCATGATGGTGACCAGTGG + Intronic
911981230 1:104569132-104569154 GTCCCAGTGGTGGTGGCAACTGG + Intergenic
912015437 1:105028085-105028107 GTCCCAGTGGTGGTAGCTACAGG + Intergenic
912034898 1:105300819-105300841 GTCACAGTGGTGGTGGACACAGG - Intergenic
912041774 1:105399046-105399068 GTCCTAGTGGTGGTGGCCATAGG - Intergenic
912099771 1:106190801-106190823 GTCATAGTGGTGGTGGCCACAGG + Intergenic
912127421 1:106555901-106555923 GTCCCAGTATTGGTGGCTACAGG + Intergenic
912152863 1:106880814-106880836 GTCCCAGTGCTGGTGACTGCAGG + Intergenic
912316526 1:108671621-108671643 GTCCCAGTGGTGGTGACCACAGG + Intergenic
912633158 1:111266940-111266962 GTCCCAGCGGTGGTGGCCACAGG - Intergenic
912871685 1:113312177-113312199 GTCTCAGTGGTTGTGGCCACAGG + Intergenic
912899170 1:113629859-113629881 GTCCCAGTGGTGGTGGCCACAGG - Intronic
912899221 1:113630217-113630239 GGGCCAGTGTTGGTGGCCACAGG - Intronic
913416760 1:118617989-118618011 GTCCTAGTGGTGGTGGCCACAGG - Intergenic
914846887 1:151288389-151288411 CTCACATTGCTGGTGGCCCCAGG - Exonic
915593675 1:156884440-156884462 ATCCCAGTGCTGGAGGCCCCTGG - Intergenic
915752940 1:158228794-158228816 GTCCCAGTGGTGGTGGCCACAGG + Intergenic
915856946 1:159397981-159398003 GTCATAGTGATGGTGGCCACAGG + Intergenic
916360670 1:163963507-163963529 GTCCCAGTGGAGGTGGCCACAGG + Intergenic
917061595 1:171048067-171048089 GTCAGAGTGGTGGTGGCCACAGG - Intronic
917191481 1:172423216-172423238 GTCCCAGTAGTGGTGGCCACAGG + Intronic
917246239 1:173004445-173004467 GTCCCAGTGATGGTGGCCACAGG - Intergenic
917306370 1:173628867-173628889 GTCCTAGTGGTGGTGGCCACAGG + Intronic
917986504 1:180325933-180325955 GTCCCAGTGGTGGTGGCCACAGG - Intronic
918018639 1:180663552-180663574 GTCCCAGTGATGGTGGCCCAAGG - Intronic
918358108 1:183724903-183724925 GTCCCAGTGGTAGTGGCCACAGG + Intronic
918416134 1:184310542-184310564 GTCATAGTGGTGGTGGCCACAGG - Intergenic
918476138 1:184927562-184927584 GTCCCAGTGGTGGTGGTCACTGG - Intronic
918752782 1:188293114-188293136 GTCCTAGTGGTAGTGGCCACAGG + Intergenic
918756412 1:188344009-188344031 GTCATAGTGTTGGTGGCCACAGG - Intergenic
918915662 1:190633890-190633912 GTCCTAGTGGTGGTGGTCACAGG - Intergenic
918989841 1:191684572-191684594 TTCCCAGTGATGGTGGCCACAGG - Intergenic
919067867 1:192715271-192715293 GTCCCAGTGGTGGTAGCCACAGG + Intergenic
919169895 1:193939908-193939930 GTTCCAGTGGTGGTGGCCATAGG + Intergenic
919514807 1:198510317-198510339 ATCCCAGTGTTGGTGGCCAATGG - Intergenic
920397460 1:205657728-205657750 CTCCACCTGCTGGTGGCCACTGG + Intergenic
920596672 1:207279152-207279174 GTCCCAGTGCTGGTGGCTACAGG - Intergenic
921002393 1:211056626-211056648 GTATCAGTGTTGGTGGCCACAGG + Intronic
921011961 1:211150627-211150649 GTCCCAGTGGTGGTGGTCACAGG + Intergenic
921296052 1:213705029-213705051 GTCCCAGTGGTGGTGACCACAGG - Intergenic
921823227 1:219641171-219641193 ATCCCAGTGGTGGTGGTCACAGG + Intergenic
922045811 1:221945515-221945537 GTCACAGTGGTGGTGGCCACAGG - Intergenic
922225887 1:223645686-223645708 GGCACAAGGCTGGGGGCCACAGG + Intronic
922320383 1:224481662-224481684 ATCCCAGTGGTGGTGGCCACAGG - Intronic
922388708 1:225115217-225115239 GCTCCAGTGATGGTGGCCACAGG - Intronic
922642360 1:227246455-227246477 GTCCCAGTGATGGTGGCCACAGG + Intronic
922714494 1:227859868-227859890 GGCCCAATGCTGGAGTGCACAGG - Intergenic
923886511 1:238163970-238163992 GTCCCACTGGTGGTGACCATAGG - Intergenic
923960168 1:239072170-239072192 GTCCCAGTGGTGATGGCCACAGG + Intergenic
924501743 1:244644676-244644698 GACCCAGTGCTGGTAGACACAGG + Intergenic
924516075 1:244767630-244767652 GTCACAGTAGTGGTGGCCACAGG - Intergenic
924629310 1:245721886-245721908 GCCCCAGTGATAGTGGCCACAGG + Intergenic
1062765799 10:64157-64179 GTCTCAGTGGTGGTGGCCTCAGG - Intergenic
1063453696 10:6168548-6168570 GCCACCCTGCTGGTGGCCACTGG + Intronic
1064014207 10:11760273-11760295 GTCCCAAGCCTGCTGGGCACTGG - Intronic
1064987403 10:21225295-21225317 GTCCCAGTCATGGTGGTCACAGG - Intergenic
1065857511 10:29842294-29842316 CTCCCCAGGCTGGTGGCCAGGGG + Intergenic
1066142880 10:32525921-32525943 GTCTCAATGGTGGTGACCACAGG - Intronic
1066649608 10:37642269-37642291 CTCCCAATGGTGGCAGCCACAGG - Intergenic
1066708347 10:38204574-38204596 GTCCCAGTGGTGGTGGCCACAGG + Intergenic
1066981160 10:42418008-42418030 GTCACAGAGGTGGTGGCCACAGG - Intergenic
1067473189 10:46550467-46550489 GACCCAGTGCTGGAGGCCACTGG - Exonic
1067748731 10:48956251-48956273 GTCCCAAGGCCCATGGCCACAGG - Intronic
1069343591 10:67440567-67440589 GTCCCAGTATTGGTGGCCACAGG + Intronic
1069933459 10:71899481-71899503 GTCACAGTGCTGGTGGCCACAGG - Intergenic
1070059277 10:72966985-72967007 GTCCCAATAGTGGTGACCACAGG - Intergenic
1070393866 10:75994578-75994600 GTCCAAAGGGTGGTGGCCTCAGG - Intronic
1070895454 10:79980193-79980215 TTCCCAGCTCTGGTGGCCACAGG + Intronic
1070915147 10:80148686-80148708 GTCCTAGTGGTGGTGGCCACAGG + Intergenic
1071046735 10:81387958-81387980 GTCCTAGTGGTGGCGGCCACAGG + Intergenic
1071799324 10:89041987-89042009 GTCCCAGGGATGGAGGCCACAGG - Intergenic
1071899336 10:90101936-90101958 GTCTCAGTGATGGTGGCCACAGG + Intergenic
1072083713 10:92057685-92057707 GTCAGAGTGGTGGTGGCCACAGG + Intronic
1072492214 10:95919551-95919573 GTCCCAGTGGTGGTGGCCATGGG - Intronic
1072843125 10:98796759-98796781 GTCCCAGTGGTAGTGACCACAGG + Intronic
1072853644 10:98924281-98924303 GTCCCAGTGGTGGTGGCCACAGG - Intronic
1073708096 10:106010112-106010134 ATCCCAATGGTGGTGGTCACAGG - Intergenic
1073827005 10:107336112-107336134 GTCCCAGTAGTTGTGGCCACAGG - Intergenic
1073890191 10:108091753-108091775 TTCCCAGTGCTCGTGGCCACAGG + Intergenic
1074302052 10:112241881-112241903 GTCCCAGTGGTGGTGGCCACAGG - Intergenic
1074408583 10:113202382-113202404 GTCCCAGCGGTGGTGGCCACAGG + Intergenic
1074599512 10:114899620-114899642 GAACCAATCCTGGTGGCCCCAGG + Intronic
1074918481 10:117982683-117982705 GTTTCAGTGTTGGTGGCCACTGG + Intergenic
1075496482 10:122923522-122923544 GTCCCACTGCTGGTGGCCACGGG + Intergenic
1076524427 10:131102572-131102594 GCCCCCATGTTGGTGTCCACTGG - Intronic
1076619554 10:131778532-131778554 GTCCCCAGGCTGGTGGCCCCGGG + Intergenic
1077035324 11:491626-491648 GTCCAAGGGCTGGCGGCCACTGG + Intergenic
1077266705 11:1654516-1654538 GACTCCATGCTGGTGTCCACAGG - Intergenic
1077427542 11:2490510-2490532 GTCCCAGTGGTGGTGGCCACAGG + Intronic
1077835580 11:5924007-5924029 GTCCCAGTGCTGGTGGCCCAGGG + Intronic
1078071384 11:8113683-8113705 GGCCCAATGCTGGGGTCTACTGG - Intronic
1078672414 11:13376943-13376965 TTCCCAAAGCTGCTGGCCCCTGG + Intronic
1078992752 11:16665775-16665797 GTCGCAGTGGTGGTGGCCACAGG + Intronic
1079007480 11:16802233-16802255 GGCCAAATGTTGGTGGCCCCTGG + Intronic
1079183615 11:18215737-18215759 GTCACAGTGGTTGTGGCCACAGG + Intronic
1079473783 11:20807457-20807479 GTCCCAGTGGTGGTGACCACAGG - Intronic
1079517078 11:21281639-21281661 GTTCCAGTGGTGGTAGCCACAGG + Intronic
1079686968 11:23371051-23371073 ATCCCAGTGGTGGTGACCACTGG + Intergenic
1079723195 11:23845824-23845846 GTCCCAGCTGTGGTGGCCACAGG - Intergenic
1080096939 11:28419224-28419246 GTCCCAGTGGTGGTGACCATAGG + Intergenic
1080128683 11:28767325-28767347 GTCCTAGTGGTAGTGGCCACAGG + Intergenic
1080489725 11:32750253-32750275 GTCCCAGTGGTGGTCGTCACAGG - Intronic
1081049264 11:38316601-38316623 GTCCCAGTGGTGGTGACCACAGG + Intergenic
1081245797 11:40764671-40764693 GTCCCAGTGGTGGTGGCCACAGG + Intronic
1082823745 11:57562562-57562584 GTCCCAATTCTGGTGACCATGGG + Intronic
1082953889 11:58847920-58847942 GTCATAATGGCGGTGGCCACAGG + Intronic
1083473829 11:62902706-62902728 CTTCCACTTCTGGTGGCCACAGG - Intergenic
1083627380 11:64078584-64078606 GTCCCATGGGGGGTGGCCACAGG + Intronic
1084274191 11:68043357-68043379 GCCACAAAGCTGGCGGCCACGGG - Exonic
1084434961 11:69133986-69134008 GGCCAGCTGCTGGTGGCCACAGG - Intergenic
1084449983 11:69230959-69230981 TTCCCACTGCTGTTGGCCAGAGG + Intergenic
1084676880 11:70640472-70640494 CTCACAGTGCTGGAGGCCACAGG - Intronic
1084763742 11:71294074-71294096 GTCCCAGTGTTGGTGGCCACAGG - Intergenic
1085147433 11:74213566-74213588 GTCCTAGTGCTGGTGGCCACAGG + Intronic
1085178557 11:74511857-74511879 GTCCCAGTGGTAATGGCCACAGG + Intronic
1085572015 11:77568218-77568240 GTCCCAGTGGTGGTGACCACAGG - Intronic
1086033198 11:82384606-82384628 GTCTCAGTGGTGGTGGCCACAGG + Intergenic
1086068869 11:82776592-82776614 GTCCCATTAGTGGTGACCACAGG + Intergenic
1086261387 11:84945471-84945493 GTCCCAGTGGTGGTAGCCAGAGG - Intronic
1086468079 11:87075951-87075973 GTCCCAGGGATGGTAGCCACAGG - Intronic
1086847770 11:91773481-91773503 GTCCCAGGGGTGGTGGCCACAGG - Intergenic
1087178531 11:95119575-95119597 GTCCTAGCGGTGGTGGCCACAGG - Intronic
1087201438 11:95347846-95347868 GTCCTAGCGGTGGTGGCCACAGG + Intergenic
1087313272 11:96576556-96576578 GTCCCAGTGATGGTGGCCACAGG - Intergenic
1087370789 11:97280549-97280571 GTCTCAGTGGTGGTGGCCACAGG + Intergenic
1087402291 11:97683553-97683575 GTCCTAGGGTTGGTGGCCACAGG - Intergenic
1087720872 11:101664517-101664539 GTCCCAGTGCTGGTGGCCACAGG - Intronic
1087877047 11:103370556-103370578 GTACTAATGGTGGTAGCCACAGG + Intronic
1087887667 11:103498453-103498475 GTCCCAGTGTTGGTGGCCACAGG + Intergenic
1087950711 11:104218151-104218173 GTCCCAGTGGTGGTGGCCACAGG - Intergenic
1088105806 11:106205288-106205310 CTCCAAAGGCTGGTGGCCTCGGG + Intergenic
1088154747 11:106789914-106789936 GTCCTAGTGTTGGTGGCCACAGG - Intronic
1088406134 11:109480842-109480864 GTTCCAGTGGTGGTGGCCATAGG + Intergenic
1089578747 11:119468368-119468390 GTCCCAGTGGTGGTGGCTAAAGG - Intergenic
1090065143 11:123497328-123497350 GTCCCCATGGTGGTGGCGACAGG - Intergenic
1090111306 11:123911771-123911793 GTCCCAGTGGTGGTGGCCACGGG + Intergenic
1090210259 11:124916134-124916156 GTCTCAGTGATGGTGGCCACAGG - Intergenic
1090676791 11:129006638-129006660 GTCCCAGTGGTGGTGGCCACAGG - Intronic
1091264624 11:134261098-134261120 CTCCCAATTCTGTTGGCCACAGG - Exonic
1092476978 12:8828014-8828036 GTCCCAATGCTGGTGGCCACAGG - Intronic
1092938847 12:13389001-13389023 GTTCCAATACTGGGGACCACTGG - Intergenic
1093122995 12:15295298-15295320 GTTCCAGTGCTGGTGGCCACAGG + Intronic
1093608007 12:21118087-21118109 GTCCTAATGGTAGTGGACACAGG - Intronic
1093620160 12:21278474-21278496 GTCCCAGTGGTGGTGGCCACAGG + Intronic
1093903193 12:24660511-24660533 ATCCCAGTGGTGGTGGCCAAAGG - Intergenic
1093931908 12:24962071-24962093 GTCCCAGTGGTGGTGGCCACAGG + Intergenic
1094419879 12:30258860-30258882 GTCCCAGTTGTGGTGACCACAGG + Intergenic
1094559282 12:31535325-31535347 GTCCCAGTGGTGGTAGCCACAGG + Intronic
1094787265 12:33863302-33863324 GTCCCAGTGGTGCTGCCCACAGG - Intergenic
1094815982 12:34185516-34185538 GTCTCAGTGGTAGTGGCCACAGG - Intergenic
1095101131 12:38184759-38184781 GTCTCAGTGGTGGTGGCCACAGG + Intergenic
1095169804 12:39020460-39020482 GTCCTAGTGATGGTGGCCACAGG + Intergenic
1095639787 12:44475014-44475036 GTCATAGTGCTGGTGGCCACAGG - Intergenic
1097714712 12:62954348-62954370 ATCCCAGTGGAGGTGGCCACAGG - Intergenic
1097899162 12:64856591-64856613 GTCCCAGTGGTAGTGGCCACAGG - Intronic
1098060428 12:66555135-66555157 GTCCCAGTGATAGTGGCCACAGG + Intronic
1098333680 12:69380513-69380535 GTCCCAGTGGTGGTGGCTAAAGG - Intronic
1098395414 12:70011564-70011586 GTCCCAGTGGTGGTGGCCACAGG + Intergenic
1099024596 12:77448926-77448948 GTTCCAGTGGTGGTGACCACAGG + Intergenic
1099433885 12:82620296-82620318 GTCACAGTGTTGGTGGCCATGGG + Intergenic
1099562139 12:84192227-84192249 GTCCCAGTGTTGGTGGCCACAGG - Intergenic
1099609994 12:84856673-84856695 GTTCCAGTGGTGGTGACCACAGG - Intergenic
1099616215 12:84938812-84938834 GTCCCAGTGATGGTGGCCACAGG + Intergenic
1100477435 12:94947381-94947403 GTCTCAGTTCTGGAGGCCACAGG - Intronic
1100905010 12:99287136-99287158 GTCCCAGTGATGGTGACCATAGG + Intronic
1101026056 12:100608293-100608315 GTCTCAGTGGTGGTGGCCACAGG - Intronic
1101226776 12:102695121-102695143 ATCCTAGTGCTGGTGGCCAAAGG + Intergenic
1101251864 12:102945184-102945206 GTCCTAGTGGTGGTGACCACAGG - Intronic
1101607576 12:106259144-106259166 GTCTCAGTGGTGGTGGCCACGGG + Intronic
1101685271 12:107013279-107013301 GCCTCAATGCTGATGGCTACTGG - Intronic
1103461495 12:121108324-121108346 GTCCCAGTGGTGATGGCCACAGG + Intergenic
1103629340 12:122247087-122247109 GTCCCAAGGTTTGGGGCCACAGG + Intronic
1103679492 12:122681885-122681907 CCACCAATTCTGGTGGCCACAGG - Intergenic
1104079530 12:125417819-125417841 GTCCCAGTGCTGGTCACCACTGG + Intronic
1105336283 13:19473117-19473139 GTCACAGTATTGGTGGCCACAGG - Intronic
1105524457 13:21163511-21163533 TTTATAATGCTGGTGGCCACTGG - Intronic
1105558925 13:21472687-21472709 GTCCCAGTGATGGTAGCCACAGG - Intergenic
1106642563 13:31599836-31599858 ATCCCAATTCTGGGGGCCTCAGG + Intergenic
1107287697 13:38814565-38814587 GTTCCAACAGTGGTGGCCACAGG - Intronic
1107754156 13:43600759-43600781 ATCCCAATAATGGTGGCCACAGG + Intronic
1107807769 13:44171324-44171346 GTCATCGTGCTGGTGGCCACAGG - Intergenic
1107808129 13:44174151-44174173 GTCCCAGTGATGCTGGCCTCAGG - Intergenic
1107969603 13:45628578-45628600 GCCCCAATGCTGGTGGCAATTGG + Intergenic
1108099349 13:46937107-46937129 GCCTCAGTGGTGGTGGCCACAGG + Intergenic
1108132897 13:47322604-47322626 GACCCATTGCTGGGGGCCCCAGG - Intergenic
1108962066 13:56246891-56246913 GTCCAAGTGCTGGTGGCCACAGG - Intergenic
1109045886 13:57409969-57409991 GTCCCAGTGATGGTGGCCACAGG + Intergenic
1109506824 13:63312458-63312480 GTCCCAGTGGTGGTGGCCACAGG + Intergenic
1110078837 13:71286110-71286132 GTTCCAGTGGTGGTGGCCAGAGG - Intergenic
1110376828 13:74803311-74803333 GTCCCAGTTGTGGTAGCCACAGG + Intergenic
1110448667 13:75617309-75617331 GTCCCAGTGGTGGTAGCCACAGG - Intergenic
1110665687 13:78115528-78115550 GTCCCAGTGGTGGTGGCCACAGG - Intergenic
1110901591 13:80831748-80831770 GTCCCAGTGGTGGTGGTCACAGG + Intergenic
1110916703 13:81030291-81030313 GCCCCAGTGGTGGTGACCACTGG - Intergenic
1111303350 13:86373567-86373589 GTCCCAGTGGAGGTGGCCACAGG - Intergenic
1111572346 13:90104659-90104681 GTGCCAATGGTGGTGGACAGGGG + Intergenic
1112618772 13:101034092-101034114 GTCATAATGATGGTAGCCACAGG - Intergenic
1113212836 13:108002747-108002769 GTCCCACTGGTGGTGGCCACAGG - Intergenic
1113254007 13:108486904-108486926 GTCCCCATGGTGGTGGCCACAGG + Intergenic
1113318973 13:109213684-109213706 ATACCATTGCTGCTGGCCACTGG - Intergenic
1113558757 13:111259318-111259340 GTCCCAATGGTGGTGACTACAGG + Intronic
1114251001 14:20960144-20960166 GTCCCAGTGGTGGTGACCACAGG + Intergenic
1114432306 14:22671790-22671812 GTCCTGATGGTGGTGGCCACAGG + Intergenic
1114761500 14:25321642-25321664 GTCTTAGTGGTGGTGGCCACAGG - Intergenic
1115476776 14:33822258-33822280 GTCCCAGTGGTGGTGGCCACAGG + Intergenic
1115821102 14:37212803-37212825 GTCATAGTGGTGGTGGCCACAGG + Intronic
1115948762 14:38695283-38695305 GTCCTAATGGTGGTGGACACAGG + Intergenic
1116086947 14:40253207-40253229 GTCGTAATGGTGGTGGCCACCGG - Intergenic
1116154803 14:41189594-41189616 GTCCCAGTGGTGGTGGCCACAGG + Intergenic
1116192694 14:41680350-41680372 TTCCTAATGGTGGTGGCCAGAGG + Intronic
1116413316 14:44650344-44650366 GGCCCAGTGGTGGTGGCCAGAGG + Intergenic
1116422238 14:44745673-44745695 GTCCTAGTGGTGGTGGCCACAGG + Intergenic
1116467973 14:45254970-45254992 GTCCCAATGTGAATGGCCACAGG + Intergenic
1116497688 14:45582651-45582673 GTCCCAGTGGTTGTGGCCATAGG - Intergenic
1116542018 14:46110706-46110728 GTCCCAATAGTGGTAGCCACAGG + Intergenic
1116766061 14:49071297-49071319 GTCCCAGTGCTTATGGCCACAGG + Intergenic
1116834996 14:49761952-49761974 GTCCCTGTGGTGGTGGCCACAGG - Intergenic
1116889227 14:50250634-50250656 GTCCCAGTGGTGGTGGCCACAGG + Intronic
1116930634 14:50687792-50687814 GTCAAAGTGGTGGTGGCCACAGG - Intergenic
1117159274 14:52973072-52973094 GTCAGAGTGATGGTGGCCACAGG - Intergenic
1117208354 14:53469428-53469450 GTCCCAGTGGTGGTGGCTACAGG - Intergenic
1117483006 14:56168080-56168102 GTCACAGTGGTGCTGGCCACAGG - Intronic
1117606311 14:57431969-57431991 GTCCCAGTGGTGGTGGCCACAGG + Intergenic
1117606891 14:57439592-57439614 GTCCCAGTGATCATGGCCACAGG - Intergenic
1118034115 14:61848485-61848507 GTCCCAATGGTGGTGGCCACAGG - Intergenic
1118084303 14:62398091-62398113 GTACCACTGGTAGTGGCCACAGG - Intergenic
1118097015 14:62547744-62547766 GATCCAGTGGTGGTGGCCACAGG + Intergenic
1118956752 14:70489640-70489662 GTCACAGTGGTGGTGGCCACAGG + Intergenic
1120275879 14:82371443-82371465 TCCCCAGTGATGGTGGCCACAGG + Intergenic
1120439573 14:84519854-84519876 GTCCCAGTGGTGGCAGCCACAGG - Intergenic
1121088475 14:91164750-91164772 GTCACAGTGGTGGTGGCTACAGG - Intronic
1121759652 14:96434501-96434523 GTCACAGTGGTGGTGGCTACAGG - Intronic
1122817019 14:104318918-104318940 GTGCCCATGCTGGTGGCCACAGG - Intergenic
1123139982 14:106066597-106066619 GTCCCAATGCTGTGGGACATTGG + Intergenic
1124081271 15:26500712-26500734 GTCCCAGTGGTGGTGGCCACTGG - Intergenic
1124267137 15:28246798-28246820 GAAGCAATGCTGGCGGCCACAGG + Exonic
1124347309 15:28931273-28931295 ATCCCGCTGCTGGTGGCCTCTGG + Intronic
1124633852 15:31352852-31352874 GTCCCAATGCCAGTGGGCTCTGG - Intronic
1126183883 15:45811675-45811697 GTCATAGTGATGGTGGCCACAGG + Intergenic
1126440655 15:48684208-48684230 GTCCCAGTGGCGGTGGCCAAAGG + Intergenic
1126572074 15:50163541-50163563 GTCTCTGTGGTGGTGGCCACTGG - Intronic
1126660620 15:51030095-51030117 GGGCCAGTGGTGGTGGCCACAGG - Intergenic
1126660726 15:51030762-51030784 TTCCCAACTTTGGTGGCCACAGG - Intergenic
1127035296 15:54909037-54909059 GTCATAGTGGTGGTGGCCACAGG + Intergenic
1127132709 15:55883617-55883639 TTCCCAGTGGTGGTGGCCACAGG + Intronic
1127140491 15:55970500-55970522 GTCCCAGTGATGGTGGCCACAGG + Intronic
1127663245 15:61119930-61119952 GTGCAAATGCTAGTGGCAACAGG + Intronic
1127971399 15:63965368-63965390 ATCCCAGTGGTGATGGCCACAGG - Intronic
1128900941 15:71422599-71422621 GTCCCAGTGGTGGTGGCCACAGG - Intronic
1129209716 15:74060666-74060688 GTCCCAGTGGTGGTGGCCATAGG + Intergenic
1129339224 15:74873888-74873910 GTCCCAAAGCTGATGGGCCCAGG - Intergenic
1129404315 15:75304754-75304776 GTCCCAGTGGTGGTAGCCATAGG - Intergenic
1129477348 15:75795131-75795153 GTCCCAGTGGTGGTGGCCATAGG - Intergenic
1129501173 15:76038845-76038867 GTCCCACTGGTGGTGGCTATAGG + Intronic
1129526895 15:76223863-76223885 GCCCCAAGGCAGGTGTCCACTGG + Intronic
1129835402 15:78702391-78702413 GTCTCAGTGGTGGTGGCCATAGG - Intronic
1129866835 15:78915367-78915389 GTACAATTGCTGGTGGCCTCTGG - Intergenic
1130441040 15:83954908-83954930 GTTCCAGTGTTGGTGGCCATAGG - Intronic
1130511908 15:84596209-84596231 GTCCCAGTGGTGGTGGCCATAGG + Intergenic
1131149347 15:90037133-90037155 GTCTCAATCCTGGTGCACACTGG + Intronic
1131945015 15:97609792-97609814 GTCCCAGTGGTTGTGGCCACAGG + Intergenic
1131945112 15:97610950-97610972 GTCCTGGTGGTGGTGGCCACTGG + Intergenic
1132504720 16:302045-302067 GCCCCAATGCCGCTGGCCTCAGG + Intronic
1132688065 16:1170539-1170561 ATCCCAAGGCTGACGGCCACTGG - Intronic
1133255166 16:4512161-4512183 GTCCCCAGGCCTGTGGCCACAGG - Exonic
1133566195 16:6996040-6996062 GTCCCCATGTTGATGGCCATGGG + Intronic
1133834054 16:9350943-9350965 GCCCCAGTGGTGGTGGTCACAGG - Intergenic
1134080494 16:11321445-11321467 GTGCCAGTGCTGCTGGCCCCAGG + Intronic
1135879653 16:26241407-26241429 GTCATAGTGGTGGTGGCCACAGG + Intergenic
1136676497 16:31913365-31913387 GTCCCAGTGGTGGGGGCAACAGG - Intronic
1136679315 16:31946435-31946457 TCCCCAGTGGTGGTGGCCACAGG + Intergenic
1138333532 16:56234250-56234272 TTCCCTAGGCTGGTGGCTACTGG - Intronic
1140020604 16:71234738-71234760 GCCCCATAGCTGCTGGCCACTGG - Intergenic
1140397884 16:74644625-74644647 GGACCAATGCTGGGGACCACCGG - Exonic
1140567010 16:76055549-76055571 GTCCCAGTTTTGGTGGCCACAGG - Intergenic
1140646527 16:77037768-77037790 GTCACAGTGGTGGTGTCCACAGG - Intergenic
1141485265 16:84334562-84334584 GTCCCAGTGGTGGTGGCTGCAGG + Intergenic
1142919678 17:3173124-3173146 GCCCTAGTGGTGGTGGCCACAGG + Intergenic
1143270599 17:5672159-5672181 GTGCCCCTGCTGGTGGCCATGGG + Intergenic
1144865500 17:18332919-18332941 GTCCTTATGCTGGTGACCAATGG + Intronic
1145069293 17:19789171-19789193 GTTCCAGTGGTGGTGGCCACAGG + Intronic
1145200907 17:20944035-20944057 GTCCCAGTGGTGGTAGCCAGAGG - Intergenic
1146242444 17:31243253-31243275 CTCCCAGTGCTGGTGTCCACAGG - Intronic
1146744957 17:35320210-35320232 GTCTCAGTGGTGGTGGCCTCAGG - Intergenic
1147743107 17:42679752-42679774 GTCGCACTGCTGGTGACCAGCGG - Exonic
1148043973 17:44731042-44731064 CTCCCTATGCTGGAGACCACCGG - Intronic
1149231381 17:54537693-54537715 GTTCCAGTGTTGGTGGCTACAGG + Intergenic
1149239884 17:54636291-54636313 GTCCCAATAGTAGTGACCACAGG + Intergenic
1150871136 17:68911671-68911693 ATCCTAGTGGTGGTGGCCACAGG + Intronic
1153074765 18:1149237-1149259 GTCCCAGTGGTAGTGGCCCCGGG + Intergenic
1153088721 18:1319027-1319049 GTCCCAGTGGTGGTGGCCACAGG + Intergenic
1153229456 18:2922121-2922143 GACCCAGTGCAGGTAGCCACGGG + Exonic
1153389099 18:4534313-4534335 GTCACAGTGATGGTGGCAACAGG - Intergenic
1153429587 18:5000802-5000824 GTCCCCGTGGTGCTGGCCACAGG + Intergenic
1153453941 18:5260045-5260067 GTCCTACTAATGGTGGCCACAGG + Intergenic
1155336116 18:24767062-24767084 CTCCCAATGCTGCTGTTCACAGG + Intergenic
1155533905 18:26795574-26795596 GTCCCCATGGTGGTGGCCACAGG + Intergenic
1155597404 18:27503240-27503262 ATCCTAGTGGTGGTGGCCACAGG + Intergenic
1155781967 18:29848927-29848949 GTCACAGTAGTGGTGGCCACAGG - Intergenic
1156055696 18:32999572-32999594 GTCCCAGTGGTGGTGGCCACAGG + Intronic
1156240655 18:35250773-35250795 GTCCTAATTCTGGTGAACACAGG + Intronic
1157937079 18:51884617-51884639 GTCCTAGTGGTGGTGGCCACAGG + Intergenic
1158481169 18:57823312-57823334 GTCCCAGTGGTGGTGGCCACAGG - Intergenic
1159080712 18:63732074-63732096 GTCTCAGTGGTGGTGGCCACAGG + Intergenic
1159394448 18:67838204-67838226 GTCCTAGTGGTGGTGGCCACTGG - Intergenic
1159565056 18:70038343-70038365 GTTCCAGTGGTGGTAGCCACAGG + Intronic
1159896387 18:74001059-74001081 GTCCTAGTGCTGGTGGCCACAGG - Intergenic
1160138371 18:76295620-76295642 GTCCCAGTGGTGGTTGCCATAGG - Intergenic
1160845242 19:1163409-1163431 GTCCCTGTCCTGGAGGCCACAGG - Intronic
1161087248 19:2340824-2340846 GTCCCAAGGGTGGTGGGCAGTGG + Intronic
1161346982 19:3773237-3773259 CTCCCTAGGCTCGTGGCCACTGG - Intergenic
1162666665 19:12219618-12219640 GTCACAGTGGTGGTGGCCACAGG - Intergenic
1162966981 19:14160661-14160683 GCCCCAAGGCTGGTAGACACTGG + Exonic
1164457027 19:28417531-28417553 GTCACAGTGATGGTGGCCACAGG - Intergenic
1164491184 19:28715410-28715432 GTCACAGTGGTGGTGGCCACAGG + Intergenic
1164495252 19:28754553-28754575 GGACCTATGGTGGTGGCCACTGG - Intergenic
1165119134 19:33547828-33547850 GGGCCAATCCTGGTGGCCACGGG + Intergenic
1165364791 19:35358876-35358898 GTATCCATGGTGGTGGCCACTGG - Exonic
1165366609 19:35371345-35371367 GTATCCATGGTGGTGGCCACTGG - Exonic
1165645531 19:37432260-37432282 GTCCCAGTGGTGGTAGCCACAGG + Intronic
1165749607 19:38252020-38252042 GCCCGAAGGCTGGTGGCCAAAGG + Intronic
1166360273 19:42250243-42250265 GACCCAATGCTTGTTCCCACAGG + Intronic
1166675418 19:44737931-44737953 TTTTAAATGCTGGTGGCCACAGG + Intergenic
1167295424 19:48646488-48646510 GTCTCCATGCTGGGGGCCGCCGG + Intergenic
1167715401 19:51139805-51139827 GTCCAGATCCTGCTGGCCACGGG - Intergenic
1168449069 19:56448894-56448916 GTCCCAGTGTTGGTGGCCATGGG + Intronic
925249551 2:2421094-2421116 GTCCTAGGGTTGGTGGCCACAGG - Intergenic
925269528 2:2592365-2592387 GTTCCAGTGGTGGTGGCCACAGG + Intergenic
925506232 2:4568496-4568518 GTCCCAGTGGAGGTGGCCACAGG - Intergenic
925698844 2:6612970-6612992 GTCCCAGTGTTGGTGGTTACAGG - Intergenic
926601018 2:14845138-14845160 ATCCCAATTGTAGTGGCCACAGG + Intergenic
926834055 2:16998514-16998536 ATCTAAATGATGGTGGCCACAGG - Intergenic
928383928 2:30847625-30847647 GTCCCAATTATGGTGGCCAAAGG + Intergenic
928458984 2:31451575-31451597 GTCCTAGTGGTGGTGGCCATAGG + Intergenic
928476411 2:31631832-31631854 GTCCCAATGATGGTCTACACTGG - Intergenic
928495563 2:31828556-31828578 GTCCCAGTGGTGGTGGTCACAGG - Intergenic
928557525 2:32443506-32443528 GTCCAAATGCTGGTTGACATGGG - Exonic
928715430 2:34055307-34055329 GTCCCAAGGGTGGTAGTCACAGG - Intergenic
928803006 2:35116415-35116437 GTCCTAGTGCTGGTGGCCAAAGG + Intergenic
929281621 2:40086834-40086856 GCCCCATTGGTGGTGGACACAGG - Intergenic
929529182 2:42736346-42736368 GTCCCAGTGGTAGTCGCCACAGG - Intronic
930159329 2:48138113-48138135 GTCATAGTGGTGGTGGCCACAGG + Intergenic
930717412 2:54605902-54605924 GACCCCATGCTGATGGCGACTGG - Intronic
930727513 2:54695966-54695988 GTCCCAGTGGTGGTGGCCACAGG + Intergenic
931085868 2:58830348-58830370 GTCCCAGTGGTGGTGGCCACAGG - Intergenic
931406806 2:61987594-61987616 GTGCCAGTGGTAGTGGCCACAGG - Intronic
931736652 2:65200131-65200153 GTCCCAGTGGTGGTGGCCACAGG + Intergenic
931849033 2:66234660-66234682 GGCCCAAAGCCAGTGGCCACAGG - Intergenic
932134139 2:69213888-69213910 GTCCCAAGGCTGCTGGCAATGGG - Intronic
932648693 2:73532153-73532175 GTCCCACTGGTGGTGGCCACAGG - Intronic
933053717 2:77634173-77634195 GCCCCAGTGATGGTGGCCACAGG - Intergenic
933097979 2:78211470-78211492 ATCCCAGTGGTGGTGGCCACAGG + Intergenic
933341545 2:81033029-81033051 GTCTCAGTGGTGGTGGCTACAGG - Intergenic
933523783 2:83410076-83410098 ATCTCAATGATGGTGGCCACAGG - Intergenic
933601080 2:84330853-84330875 ATCCCACTGGTGGTGGCCACAGG + Intergenic
934127453 2:88911225-88911247 ATCTCAATGCTGTTGGCTACTGG - Intergenic
934870683 2:97861962-97861984 GTTCCAGTGGTGGTGGCCACAGG + Intronic
934929101 2:98405456-98405478 GTCTCAGTGATGGTGGCCACAGG + Intergenic
935078506 2:99769908-99769930 GTCCCAGTCGTGGTAGCCACAGG - Intronic
935287761 2:101580399-101580421 GCCCCAATGCAGGTGGCTTCGGG + Intergenic
935576472 2:104716835-104716857 GTTCTAGTGGTGGTGGCCACAGG - Intergenic
935812937 2:106817641-106817663 TTCCCAGTGGTGGTGGCTACAGG + Intronic
935989544 2:108706486-108706508 GTCCCAGTGGTGGTGGCCACAGG + Intergenic
936276224 2:111100062-111100084 GTCCCAATGCAGGCAGGCACTGG - Intronic
936940286 2:117877889-117877911 GTACCAGTGCTGGTGGCCACAGG - Intergenic
937512601 2:122612495-122612517 GTCCCACTGGTGGTAGCCACAGG + Intergenic
937613751 2:123894717-123894739 TTTCCCATGCTGGTGGCCTCTGG - Intergenic
937736425 2:125296541-125296563 GTCCTAGTCATGGTGGCCACAGG - Intergenic
938594193 2:132769877-132769899 GTCCTCATGCTTGTGGCCTCTGG - Intronic
939144623 2:138397096-138397118 GTCCCACTGGTGGTGGCCACAGG + Intergenic
939273696 2:139971710-139971732 GTTCCAGTGGTGGTGGCCACAGG + Intergenic
939483326 2:142777587-142777609 GTCCTAGTAGTGGTGGCCACAGG - Intergenic
940315063 2:152319935-152319957 GTCCTTGTGGTGGTGGCCACAGG - Intergenic
940402251 2:153261591-153261613 GTCCAAGTAGTGGTGGCCACAGG - Intergenic
940503681 2:154526817-154526839 GCCCTAGTGCTGGTGGCCACAGG - Intergenic
940786247 2:157984655-157984677 GTCCTAAGGGTGGTAGCCACAGG - Intronic
940795504 2:158072564-158072586 GTCCCAGTGGTGGTGGCCACAGG + Intronic
940803135 2:158154807-158154829 GTCCCAGTGGTGGTGGTCATAGG + Intergenic
941227766 2:162869278-162869300 GTCATAGTGGTGGTGGCCACAGG + Intergenic
941516123 2:166481031-166481053 GTCTAAAGGCTGGTGGCCAATGG + Intronic
941528147 2:166631673-166631695 GTTCCAGTGATGGTGGCCACAGG - Intergenic
941851695 2:170190260-170190282 GTCTCAATGGTGGTGGCCATAGG - Intronic
942001479 2:171652544-171652566 GTCCCAGTGGTGGTGGCCCCAGG - Intergenic
942116692 2:172735665-172735687 GTCCCGCTGCTGGGGGACACTGG - Intronic
942294812 2:174507248-174507270 GTCCCATTAGTGGTGACCACAGG + Intergenic
942295037 2:174508553-174508575 GTCCCAGTGGTGGTGACCACAGG + Intergenic
942352435 2:175066176-175066198 GTCCTAGTGTTTGTGGCCACAGG + Intergenic
942882006 2:180872033-180872055 GTCCCAGTAGTGGTGGCCACAGG + Intergenic
943099428 2:183470824-183470846 ATCACAGTGATGGTGGCCACAGG - Intergenic
943208097 2:184927409-184927431 ATCCCAGTGGTGGTGGCCACAGG - Intronic
943831857 2:192473281-192473303 GTCCCAATGGTGGGGGCCACAGG + Intergenic
943933683 2:193886592-193886614 GTCCCAGTGGTGGTGGCCACAGG + Intergenic
944005231 2:194896770-194896792 GTCCCAGTGGTGGTGGCCCCAGG - Intergenic
944133155 2:196369427-196369449 GTCCCAGTGGTGGTGACAACAGG - Intronic
944616276 2:201464501-201464523 GTCCTAGTGGTGGTGGCAACAGG - Intronic
944616416 2:201465173-201465195 TTCCCAACTGTGGTGGCCACAGG - Intronic
944955187 2:204799601-204799623 GACTCAGTGGTGGTGGCCACAGG + Intronic
945551735 2:211229166-211229188 TTCCCAGTTCTGGTGGCCACAGG + Intergenic
945754358 2:213828942-213828964 GTCTCAGTGGTGGTAGCCACAGG - Intronic
946697378 2:222372960-222372982 GTCCCAGTGGTCGTGGCCACAGG + Intergenic
947009038 2:225546093-225546115 GTCCCAGCGGTGGTGGCCACAGG - Intronic
947312236 2:228817593-228817615 GTCACAGTGGTGGTAGCCACAGG - Intergenic
947687048 2:232097325-232097347 GTCCCAGTGATAATGGCCACAGG - Intronic
948411713 2:237767797-237767819 TTCCCTTGGCTGGTGGCCACGGG - Intronic
948475389 2:238215768-238215790 CTCCCAGTGGTGGTGGCCACAGG - Intergenic
948854669 2:240724611-240724633 GACCCACTGAAGGTGGCCACGGG + Intronic
1168741959 20:199812-199834 GTCATAGTGTTGGTGGCCACAGG - Intergenic
1168917127 20:1499515-1499537 GTCCTAGCGGTGGTGGCCACAGG - Intergenic
1169628412 20:7598157-7598179 GTCTCAATGGTAGTGGCCACAGG + Intergenic
1170668484 20:18407193-18407215 GTCCCAATAGTGGTGGCCACAGG + Intronic
1171406944 20:24918012-24918034 ATCCCAGACCTGGTGGCCACAGG + Intergenic
1171777839 20:29387416-29387438 GTCTCAGTGGTGGTGGCCCCAGG - Intergenic
1171819597 20:29822728-29822750 GTCTCAGTGGTGGTGGCCACAGG - Intergenic
1171898226 20:30830454-30830476 GTCTCAGTGGTGGTGGCCACAGG + Intergenic
1173099021 20:40066080-40066102 GTCATAGTGCTGGTGGCCACAGG + Intergenic
1173122267 20:40304785-40304807 GCACCAAAGCTGGAGGCCACTGG - Intergenic
1173126988 20:40346197-40346219 GCCCCAGTGGTGGTGGCCACAGG + Intergenic
1173204110 20:40979347-40979369 GTCCCAGTGATGGTGACCACAGG - Intergenic
1174831743 20:53820018-53820040 GTCCTAGCGGTGGTGGCCACAGG - Intergenic
1174938659 20:54899115-54899137 ATCCCAGTGGCGGTGGCCACAGG + Intergenic
1175391118 20:58628060-58628082 GTCTCATTACTGGTGGCCAGTGG + Intergenic
1175599035 20:60257672-60257694 ATCCCCATGCTGGAGACCACTGG - Intergenic
1175734660 20:61376815-61376837 GTGCCAATGATCTTGGCCACCGG - Intronic
1176876735 21:14136803-14136825 GTCATAGTGTTGGTGGCCACAGG + Intronic
1176939821 21:14911250-14911272 GTATCAGTGGTGGTGGCCACAGG - Intergenic
1177023861 21:15896749-15896771 GTCCCAATAGTAGTGGCGACAGG + Intergenic
1177069524 21:16486134-16486156 GTCACAGTGGTGGTGGCCACAGG - Intergenic
1177105293 21:16946882-16946904 GTCCTAGTGGTGGTGGCCACAGG + Intergenic
1177275877 21:18912799-18912821 GTCCCAGTGGTGGTAGCTACAGG - Intergenic
1177740521 21:25148088-25148110 GTCCCAGTGGTGGTGGCCACTGG - Intergenic
1177771419 21:25519946-25519968 GTCCCAGTGGTGGTGGCCACAGG + Intergenic
1177849937 21:26333820-26333842 GTTCCAGTTGTGGTGGCCACAGG + Intergenic
1178894179 21:36545048-36545070 CTACCAATGCAGGTGGCCATAGG + Intronic
1180323593 22:11347419-11347441 GTCTCAGTGGTGGTGGCCACAGG - Intergenic
1180926155 22:19556347-19556369 GTCACAATGATGGTAGCAACAGG + Intergenic
1181030708 22:20147800-20147822 GTACCACTGCTGGAGGACACAGG - Exonic
1181512607 22:23395585-23395607 GTACCACTGCTGGAGGACACAGG + Intergenic
1183473260 22:38020998-38021020 GTCCCTTTGCTCATGGCCACTGG + Intronic
1183739291 22:39661230-39661252 GACCCCATGCTGGTGGCCCTGGG + Exonic
1183930844 22:41235274-41235296 CTCCCAATGCCCGTGGCCAGAGG - Exonic
1184887627 22:47356105-47356127 GTCCCAGCGCTGCTGGCCTCCGG - Intergenic
1185148613 22:49152162-49152184 TTCCCAATGCTGGTGGCTCCTGG - Intergenic
949158489 3:853934-853956 GTCCCAGTGCTGGTGGCCACAGG + Intergenic
950123145 3:10495160-10495182 GTCCCAATGCAACTGCCCACGGG - Intronic
950589667 3:13927677-13927699 GTCCAGATGCTGGTGGACAATGG + Intergenic
950695530 3:14698682-14698704 CTCCCAGTGGTGGTGGCCACAGG - Intronic
950800970 3:15551657-15551679 GTCCCAGTGGTGGTGGACATAGG - Intergenic
951029181 3:17862747-17862769 GTTGCAGTGGTGGTGGCCACAGG - Intronic
951172050 3:19554186-19554208 ATCCCAGTGGTGGTGGCCACAGG - Intergenic
951259818 3:20494888-20494910 GTCCCAGTGGTGATGGCCACAGG - Intergenic
951398798 3:22204071-22204093 ATCCCAATGGTGGTGGCCACAGG + Intronic
951423226 3:22511501-22511523 GTCCTAGTGGTGGTGTCCACAGG + Intergenic
952132707 3:30383823-30383845 GACCCAGTGCTGGTTTCCACAGG - Intergenic
952725846 3:36583188-36583210 GTCCCAGTGGTGGTGACCAAAGG + Intergenic
952912601 3:38203746-38203768 GTCCCAGTGCTGGTAGCCACAGG - Intronic
953229271 3:41050264-41050286 GTACTAGTGGTGGTGGCCACAGG - Intergenic
954713147 3:52514728-52514750 GGCCCCATGCTGGAGGCCCCTGG + Exonic
954880357 3:53831495-53831517 GTCCCAGTGTTGGTGGCCACAGG + Intronic
955585132 3:60470121-60470143 GTCCCAGTGGCGGTGGCCACAGG - Intronic
956549603 3:70442744-70442766 GTCCCAGTGGTAGTGGCCACAGG + Intergenic
957087348 3:75693229-75693251 GTCTCAGTGGTGGTGGCCCCAGG + Intergenic
957745726 3:84339837-84339859 GTCCTGGTGATGGTGGCCACAGG - Intergenic
957890089 3:86345646-86345668 ATCCCAGTTGTGGTGGCCACAGG - Intergenic
957925546 3:86805751-86805773 GTCCCATTGTTGGTGGCCACAGG + Intergenic
958682937 3:97353860-97353882 GTCCCAGTGGTGGTGGCCACAGG + Intronic
958756782 3:98259557-98259579 GTCATAGTGCTGGTGGCCCCAGG - Intergenic
958757684 3:98270721-98270743 GTCCTAAAGGTGGTGGCCACAGG - Intergenic
958765220 3:98360068-98360090 GTCCTAGTGGTGGTGGCCACAGG - Intergenic
958862158 3:99457504-99457526 GTCCTAGTAGTGGTGGCCACAGG - Intergenic
958876794 3:99625424-99625446 GTCACAGTGGTGGTGGCCACAGG + Intergenic
959042031 3:101432524-101432546 GTCACAATGCTGGTGGCCACAGG + Intronic
959448176 3:106466639-106466661 GTCCCAGCGGTGGTGGCCACAGG - Intergenic
959717135 3:109444893-109444915 GTCCCAGTGGTGGTGGCCCCAGG + Intergenic
959724909 3:109532646-109532668 GTCATAGTGGTGGTGGCCACAGG - Intergenic
959818882 3:110708519-110708541 GTCCCATTGGTGGTAGCCACAGG - Intergenic
959913605 3:111792949-111792971 GTCCCAGTGTTGGTGGCCACAGG - Intronic
959945019 3:112116911-112116933 GTCCCACTGTTGGAGGTCACTGG + Exonic
960207218 3:114917789-114917811 GTCTCAGTGGTGATGGCCACAGG - Intronic
960404259 3:117239433-117239455 GTCCCAGTGGTAGTGGCCATAGG + Intergenic
960565013 3:119123593-119123615 GTCCCAGTGGTGATGGCCACAGG + Intronic
960870138 3:122239651-122239673 GTCCCAGTGGTAGTGGCCACAGG + Intronic
961331128 3:126139100-126139122 GACACAATGCTGGTGGTCAGAGG - Intronic
962015261 3:131432328-131432350 GTCCCATTGGTGGGGGCCACAGG + Intergenic
962152048 3:132903288-132903310 CTCATAGTGCTGGTGGCCACCGG + Intergenic
962465622 3:135655311-135655333 GTTCCATTGGTGATGGCCACAGG + Intergenic
962688477 3:137869515-137869537 GTCATAGTGGTGGTGGCCACAGG + Intergenic
962998458 3:140653674-140653696 GTCCCAGTGGTGGTGGCCACAGG + Intergenic
963044735 3:141094267-141094289 GGCCCAGTGCTGGAGGCCAGAGG - Intronic
963154230 3:142078369-142078391 GTCCCAGTGGTGGTGGCCACAGG + Intronic
963179534 3:142339169-142339191 GTCCCAGTGGTGGTGGCCACAGG + Intronic
963310197 3:143700889-143700911 GTTCCATTGGTGGTGGCCACAGG + Intronic
963330633 3:143910737-143910759 CTCCCAGTGGTGGTGGCCACAGG + Intergenic
963448155 3:145440738-145440760 GTCACAGTGGTGGTGGCCATAGG + Intergenic
963571858 3:147008229-147008251 GTACCAGTGGTGGTGGCCAAGGG - Intergenic
963763248 3:149307254-149307276 GTCCCAGTATTGGTGGCCACAGG - Intergenic
963996044 3:151709653-151709675 GTCTCTGTGGTGGTGGCCACAGG + Intergenic
964021874 3:152022393-152022415 GTCCCAGAGCTGGTGGCCACAGG + Intergenic
964398329 3:156272114-156272136 ATCCCAGTGGTGGTAGCCACGGG - Intronic
964804170 3:160588280-160588302 GTCCCAGTGGTGGTGGCCACAGG + Intergenic
964904384 3:161701155-161701177 GTCATAGTGGTGGTGGCCACAGG + Intergenic
964964961 3:162481332-162481354 GTCCCAGTGGTGGTGGCCATGGG - Intergenic
964992799 3:162835204-162835226 GTCCCAGTGGTATTGGCCACAGG - Intergenic
965000004 3:162941160-162941182 GTCCCAGTGATGGTGGCTACAGG + Intergenic
965035024 3:163426617-163426639 GTCCCAGTGGTGGTGGCTATAGG + Intergenic
965045715 3:163573977-163573999 GTCCCAGTGGTGGTTGTCACAGG + Intergenic
965144892 3:164889273-164889295 GTCCCAGTGGTGGTGGCTAGGGG - Intergenic
965181143 3:165404956-165404978 GTCCCACTGGTGGTGCCCATAGG + Intergenic
965209512 3:165767461-165767483 GTCATAGTGGTGGTGGCCACAGG - Intergenic
965264396 3:166522214-166522236 GTCACAGTGATGGTAGCCACAGG - Intergenic
965317426 3:167209322-167209344 GTCCCAGTGCTGGTGGCCACAGG + Intergenic
965980407 3:174682489-174682511 GTCCCAGTTGTGGTGGCCACAGG + Intronic
966142042 3:176767662-176767684 GTCCCAGTGGTAGTGGCCACAGG + Intergenic
966151783 3:176874217-176874239 ATCCCAGGGGTGGTGGCCACAGG + Intergenic
966401046 3:179547053-179547075 GTCCCAGTGCTGGTGGCCACAGG + Intergenic
966463589 3:180204035-180204057 GTCCCAGTGGTGGTGGCCACAGG + Intergenic
967551212 3:190797447-190797469 GTCATAGTGGTGGTGGCCACAGG + Intergenic
967677585 3:192317815-192317837 GTCCCAGTGGTGGTGGCCACAGG + Intronic
968018125 3:195357564-195357586 GTCCCAACGATGGCGGCGACAGG + Intronic
968096370 3:195933515-195933537 GTCCCAGTGCTGGTGGCCACAGG + Intergenic
968985907 4:3874152-3874174 CTCCCAAGGCTGGTGGCCCGAGG - Intergenic
970442543 4:16094043-16094065 GTCTCAGTGGTGGTGGCCACAGG + Intergenic
970892912 4:21067698-21067720 GTCCCAGTGGTGGTGGCCATAGG + Intronic
971914420 4:32850255-32850277 GTTCAAGTGATGGTGGCCACAGG - Intergenic
972468661 4:39383503-39383525 GTCTTAGTGATGGTGGCCACAGG - Intergenic
972909644 4:43798167-43798189 GTCCCAGTGGTGGTGGCCACAGG + Intergenic
972915591 4:43874266-43874288 GTCCTAGTGGTGGTGGCCACAGG - Intergenic
972934342 4:44114017-44114039 GTCCCAGTGGTGGTGGCCACAGG - Intergenic
973074096 4:45901037-45901059 GTGCCAGTTGTGGTGGCCACTGG + Intergenic
973227546 4:47802847-47802869 GTCCCAGTGGTAGTGGCCATGGG + Intronic
973561222 4:52138225-52138247 GTCCTATTGCTATTGGCCACTGG + Intergenic
973619657 4:52713668-52713690 GTGACAATGCTGGTGGCAACAGG + Intergenic
973763289 4:54140173-54140195 GTGCTTATGGTGGTGGCCACAGG + Intronic
974267048 4:59598784-59598806 GTCCCAGTGGTGGTGGCTCCAGG + Intergenic
974292386 4:59948876-59948898 GTCCTAGTGGTGGTGGCCACAGG + Intergenic
974333243 4:60506324-60506346 GTCCCAGTGGTGGTGGCCACAGG + Intergenic
974337499 4:60569498-60569520 GTAATAATGGTGGTGGCCACAGG - Intergenic
974414878 4:61594672-61594694 GTCCCAGTGATGGTGGTCACAGG - Intronic
974469753 4:62303006-62303028 GTCCCAGTGCTGGTGGCCACAGG + Intergenic
975081093 4:70281232-70281254 GTCCCAGTAGTAGTGGCCACAGG + Intergenic
975335567 4:73171110-73171132 GTCCCAGTGGTGGTGACCACAGG + Intronic
976029922 4:80740530-80740552 GTCCCAGTGGTGATGGCCACAGG - Intronic
976082713 4:81374789-81374811 TTCCCAGTGCTGGTGGACACAGG - Intergenic
976171616 4:82310644-82310666 GTCCTAGTGGTGGTAGCCACAGG - Intergenic
976254082 4:83082898-83082920 GTCATAGTGGTGGTGGCCACAGG - Intergenic
976453830 4:85223015-85223037 ATCCCAGTGGTGGTGGCCCCAGG - Intergenic
976722159 4:88179129-88179151 GTCCCTGTGTTGGTGGCCACAGG + Intronic
976728395 4:88239293-88239315 GTCCCAGTGGTGGTGGCCACAGG - Intergenic
976908341 4:90267572-90267594 GTCCCAGTGGGGGTGACCACAGG + Intronic
976982157 4:91244409-91244431 GTCCCAGTAGTGGTGGTCACAGG + Intronic
977396976 4:96483682-96483704 GTCCCAGTGATGGTAGCCATAGG - Intergenic
977697747 4:99985553-99985575 CTCCCAATCCTGCTGGCCTCTGG - Intergenic
977985719 4:103380315-103380337 GTCCCAGAGGTGGTGGCCACAGG + Intergenic
978008535 4:103650251-103650273 GTTCCAGTGGTGGTGGCCACAGG - Intronic
978031022 4:103939798-103939820 GTCATAGTGGTGGTGGCCACAGG + Intergenic
978082833 4:104615939-104615961 GCCCCAGTGGCGGTGGCCACAGG - Intergenic
978112519 4:104979269-104979291 GTCCCAGTGGTGGTGGCCATAGG + Intergenic
978261834 4:106768886-106768908 GTCATAGTGGTGGTGGCCACTGG + Intergenic
978287915 4:107099698-107099720 GTCCCAGTGGTGATGGCCATAGG + Intronic
978520415 4:109609683-109609705 GTCCCAGTGGTGGTGACCATAGG - Intronic
978934504 4:114358905-114358927 GTCCCAGTGGTGTTTGCCACAGG - Intergenic
979073363 4:116240421-116240443 GTTCCAGTGCTGGTGGCCACAGG - Intergenic
979156154 4:117392826-117392848 GTTCCAATAGTGGCGGCCACAGG + Intergenic
979413567 4:120407513-120407535 GTCACAGTAGTGGTGGCCACAGG + Intergenic
979573101 4:122252887-122252909 GTTCCACTGGTGGTAGCCACAGG + Intronic
979945943 4:126830922-126830944 GTCCCAGTGGTGGTAGCCACTGG + Intergenic
979982098 4:127269691-127269713 TTCCCCATGCTGTTGGCCCCAGG - Intergenic
980442605 4:132867968-132867990 GTCCCACTGGTGGTGGTCATAGG + Intergenic
980646918 4:135653781-135653803 ATCCCAGTGGTGGTGTCCACAGG + Intergenic
980683013 4:136187931-136187953 GTTCCAATGATAGTGGCCACAGG + Intergenic
981140335 4:141260076-141260098 GTCCCAGTGGTGGTGGTCACAGG + Intergenic
981286548 4:143025242-143025264 GACCCAGTGGTGGTGGCCACAGG + Intergenic
981394796 4:144234616-144234638 GTTCCAGTGATGGTGGTCACAGG + Intergenic
981751102 4:148092934-148092956 GTCTCAATGCTGATGCCCACTGG + Intronic
981895756 4:149796647-149796669 GTCATAGTGGTGGTGGCCACAGG + Intergenic
982194663 4:152898989-152899011 GTCCAAAAGCTGGTGAGCACAGG + Intronic
982339945 4:154285956-154285978 GTCCCAGTGGTGGTGGTCACAGG + Intronic
982622879 4:157728465-157728487 GTTCCAGTGGTGGTGGCCACAGG + Intergenic
982719853 4:158848222-158848244 GTCTCAATGGTGGTGGTCACAGG + Intronic
982828195 4:160026909-160026931 TTCCCAGTGCTGGTGGCTACAGG - Intergenic
982899421 4:160980257-160980279 GTTCCAGTGGTGGTGGCCACAGG - Intergenic
982932793 4:161429449-161429471 GTCCCAGTGGTGTTGGCCACTGG + Intronic
983165861 4:164477000-164477022 GTCCCAATGGTGGTGGCAACAGG - Intergenic
983389017 4:167103825-167103847 GTCCCACTGGTTGTGGCCACAGG + Intronic
983456380 4:167969362-167969384 GTCATAGTGGTGGTGGCCACAGG + Intergenic
984396729 4:179211376-179211398 GTCCCAGTGTTGGTGGCCACAGG - Intergenic
985229594 4:187799966-187799988 GTCTCAGTGGTGGTGGCCACAGG + Intergenic
986046742 5:4045128-4045150 GTCCCAGTGGTGGCGGCCATAGG + Intergenic
986544335 5:8879522-8879544 GTCACAGTGGTGGTGGCCACAGG - Intergenic
986548434 5:8924992-8925014 GTCCCAGTGGTGGTGGTGACAGG + Intergenic
986652405 5:9977688-9977710 GTCCCAATTCTGGTAACTACTGG - Intergenic
986657471 5:10030017-10030039 GTCCTAATGGTGGTGGCCACAGG - Intergenic
986756424 5:10840450-10840472 GTCTCAGTGGTGGTGGCCATGGG + Intergenic
986913359 5:12585437-12585459 GCCCTAATAGTGGTGGCCACAGG - Intergenic
987616208 5:20277238-20277260 GTCCCAGTGGTGATGGCCATGGG + Intronic
987645972 5:20672626-20672648 GTCCCAGTGGTGGCAGCCACAGG + Intergenic
988015861 5:25558857-25558879 GACCAAATGCTGGTGAACACCGG - Intergenic
988039747 5:25874199-25874221 ATCCCAGTGGTGGTAGCCACAGG - Intergenic
988064863 5:26220120-26220142 GTCCCAGTGCCGGTGGCCACAGG + Intergenic
988082837 5:26434468-26434490 GTACCAGTGGTGTTGGCCACAGG + Intergenic
988117945 5:26920573-26920595 GTCCCAGTGGCGGGGGCCACAGG + Intronic
988265226 5:28941266-28941288 GTCCCAGTGGTGGTGGACACAGG - Intergenic
988376333 5:30440013-30440035 GTCCCAGTGATGGTGACCACAGG + Intergenic
988384307 5:30540532-30540554 GTCCCATTGGTGGTGGCCACAGG + Intergenic
988939448 5:36127988-36128010 GTCCCAGTGATGGTGACCACAGG + Intronic
989472133 5:41832266-41832288 GTCCCAGTGGTGGTGGCCATAGG + Intronic
990214123 5:53512629-53512651 GTCCCAGTGGTGATGGCAACAGG - Intergenic
990579685 5:57156110-57156132 GTCCCAGTGGTGGTGGCTGCAGG + Intergenic
990774319 5:59287648-59287670 GTCCCAGTGGTGGTGGCCACAGG + Intronic
990900060 5:60739901-60739923 GTCCCAGTCATGGTGGCCACAGG + Intergenic
991107362 5:62860374-62860396 ATCCCAGTGGTGGTGGCCACAGG - Intergenic
991180491 5:63746183-63746205 GTCATAATAATGGTGGCCACAGG - Intergenic
991395193 5:66197933-66197955 GTCCCAGTAGTGGTGGCCACAGG - Intergenic
991682019 5:69149472-69149494 GTCCTAGTGGTGGTGGCCACAGG - Intergenic
992285068 5:75226413-75226435 GTCCCAGTGGTGGTAGCCACAGG + Intronic
992291482 5:75283981-75284003 GTCCCAGTGGTGGTGGCCACAGG + Intergenic
992692601 5:79255842-79255864 GTCCCAGTGGTGATGGCCACAGG - Intronic
993206967 5:84894716-84894738 GTCCCAGTGGTGGTGGCCACAGG - Intergenic
993278759 5:85898084-85898106 GTCCTAGTGGTGGTGGCCACAGG - Intergenic
993287253 5:86015766-86015788 GTCACAGTGCTGGTGGTCACAGG - Intergenic
993582402 5:89678325-89678347 GTCACAGTGGTGGTGGCCACAGG + Intergenic
993891415 5:93479135-93479157 GTCCCCATGCTGCTTTCCACAGG - Intergenic
993981372 5:94546452-94546474 GTTCTAGTGGTGGTGGCCACAGG + Intronic
994233988 5:97340122-97340144 GTCTCAGTGATGGTGGCCACAGG + Intergenic
994310886 5:98268687-98268709 GTCCCAGAGGTGGTGGCCATAGG + Intergenic
994660109 5:102642596-102642618 GTCCCAGTGGTGATGGCCATGGG + Intergenic
994889024 5:105605343-105605365 GTCCTAACAGTGGTGGCCACAGG + Intergenic
994974205 5:106780702-106780724 GTCCCAGTGTTGGTGGCCACAGG + Intergenic
995096470 5:108240794-108240816 GTCCCAATGGTGGTGGTCACAGG + Intronic
995697693 5:114898994-114899016 GTCCTAGTGGTGTTGGCCACAGG - Intergenic
995777876 5:115745340-115745362 GTCATAGTGATGGTGGCCACAGG - Intergenic
996259412 5:121446855-121446877 GTCCCAGTGGTGTTGGCCACTGG + Intergenic
996459640 5:123726103-123726125 GTCCCAGTGGCAGTGGCCACAGG + Intergenic
996594596 5:125185953-125185975 GTCACAGTGGTGGTGGCCACAGG + Intergenic
996666662 5:126067304-126067326 GTGCCAGTGGTGGTAGCCACAGG + Intergenic
996931556 5:128895677-128895699 ATCCCAGTGGTGGTGGCCACAGG - Intronic
997003153 5:129785477-129785499 GTCTCAGTGGTGGTGGCCATGGG + Intergenic
997180511 5:131824075-131824097 GTCCCATTGGTGGTGGTCACAGG - Intronic
998695316 5:144631372-144631394 GTCACAATGGTGCTGGCAACAGG + Intergenic
999345754 5:150817510-150817532 GTCATAGTGGTGGTGGCCACAGG + Intergenic
999478701 5:151925239-151925261 GTCCCATTGCTCGGGGCCGCAGG + Intergenic
1000399579 5:160811929-160811951 GTCTCAGTGGTGGTGGCCACAGG + Intronic
1000433625 5:161180680-161180702 GTCCCAGTGTTGGTGGCCACAGG + Intergenic
1003475242 6:6475647-6475669 CTCCAGCTGCTGGTGGCCACAGG + Intergenic
1003952221 6:11127045-11127067 GTCCCAGCAGTGGTGGCCACAGG - Intronic
1005037290 6:21568971-21568993 GTTCCAGTGGTGGTGGCCATAGG - Intergenic
1005156972 6:22818739-22818761 GTCACAGTGGTGGTGGTCACAGG - Intergenic
1005809133 6:29502936-29502958 CTCCCAATTCTGGAGGCCAGAGG + Intergenic
1006457441 6:34139979-34140001 GTCCCAAAGCGGGTGGGCACAGG + Intronic
1006505002 6:34483468-34483490 GACCCAACTCTGGTGCCCACCGG - Intronic
1006547759 6:34793233-34793255 CTCCCAATTTTTGTGGCCACTGG - Intronic
1006963840 6:37961589-37961611 GTCCTAGAGCTGGTGGCCATAGG + Intronic
1008060737 6:46993954-46993976 ATCCCTATGCTGGTGACCCCAGG + Intergenic
1008192465 6:48476222-48476244 GTCCCAGTAGTGGTGGACACAGG + Intergenic
1008215198 6:48779211-48779233 GTCACAGTGGTGGTGGCCACAGG + Intergenic
1008848419 6:55995895-55995917 GTCCCAGTGGTGGTGGCCACAGG - Intergenic
1008880874 6:56378812-56378834 GTCATAGTGGTGGTGGCCACAGG + Intronic
1009039248 6:58157737-58157759 GTCCCAGTGGTGGTGGCCACAGG - Intergenic
1009215147 6:60912580-60912602 GTCCCAGTGGTGGTGGCCACAGG - Intergenic
1009266415 6:61561278-61561300 GTCACAGTGATGGTAGCCACAGG - Intergenic
1009353053 6:62706980-62707002 GTGACAGTGGTGGTGGCCACAGG - Intergenic
1009373430 6:62937991-62938013 GTCACAGTGGTGATGGCCACAGG - Intergenic
1009388140 6:63111620-63111642 TTCCAAATGGTGGTGGCTACAGG - Intergenic
1009744942 6:67799695-67799717 GTCCCAGTGGTGGTAGCCACAGG + Intergenic
1010343320 6:74782171-74782193 GTTCCAGTAATGGTGGCCACAGG + Intergenic
1010483473 6:76381991-76382013 GTCAGAGTGGTGGTGGCCACAGG - Intergenic
1010529003 6:76942839-76942861 GTCATAGTGGTGGTGGCCACAGG + Intergenic
1010548113 6:77183943-77183965 GACCCAGTGGTGGTGGCCACAGG + Intergenic
1010558607 6:77318000-77318022 GTACCACTGCCGGTGGACACTGG - Intergenic
1010560189 6:77340096-77340118 ATCCTATTGGTGGTGGCCACAGG - Intergenic
1010838918 6:80623995-80624017 GTTCCAGTGGTGGTGGCCACAGG + Intergenic
1011102822 6:83743515-83743537 GCCCCAGTGGTGGTGGCCACTGG - Intergenic
1011291073 6:85778343-85778365 GTCCCAGTGGTAGTGGCCACAGG - Intergenic
1011322743 6:86115349-86115371 CTCCCAGTGGTGGTGGCCACAGG - Intergenic
1011333131 6:86232970-86232992 GTCCTAATGGTGGTGGCTCCAGG - Intergenic
1011386179 6:86801299-86801321 GTCTCAGTGGTGGTGGGCACAGG - Intergenic
1011791749 6:90906644-90906666 GCCCCAGTGGTGGTGGCCCCAGG - Intergenic
1012028717 6:94030352-94030374 ATCCCAGTGGTGGTGGCCACTGG + Intergenic
1012123740 6:95400038-95400060 GTCACAATGATGGTGTCAACAGG - Intergenic
1012807003 6:103907871-103907893 GTCCCACTGGTGGTGGCCACAGG - Intergenic
1012892219 6:104908948-104908970 GTCCCAGTGGTGGCAGCCACAGG + Intergenic
1012940579 6:105410398-105410420 GTCCCAGTGGTGGTGACCACAGG + Intergenic
1013673334 6:112429607-112429629 GTCCCAGTGGTGATGGCCACAGG - Intergenic
1014073825 6:117214770-117214792 GTCCCAGTGGTTGTAGCCACAGG - Intergenic
1014542322 6:122692102-122692124 GTCCCAGCACTGGTGGTCACAGG - Intronic
1014583151 6:123162521-123162543 GTCATAGTGGTGGTGGCCACAGG + Intergenic
1014692532 6:124578793-124578815 GTCCCAGTGGTGGTGGCCAGAGG + Intronic
1014855457 6:126395946-126395968 GTCCCAGTGGTGGTGGCCACAGG - Intergenic
1016061477 6:139635823-139635845 GTCCCAGTGCTGGTGGCCACAGG - Intergenic
1016136779 6:140554330-140554352 GTCCTGGTGGTGGTGGCCACAGG - Intergenic
1016457267 6:144244571-144244593 GTCCCAGTGGTGGTGGCCACAGG - Intergenic
1017387481 6:153902272-153902294 GTCCCACTGGTGGTGGCTACAGG + Intergenic
1017924715 6:158901125-158901147 GTCCCAGTGGTGATGGCCACGGG - Intronic
1018316667 6:162562917-162562939 GTCATAGTGGTGGTGGCCACAGG + Intronic
1018917506 6:168145820-168145842 GTCCCAGTGGTGGTAGCCATAGG - Intergenic
1019044486 6:169132584-169132606 GTACCAGTGGTGGTGGTCACAGG + Intergenic
1020485279 7:8713876-8713898 GTTCCAGTGGTGGTGGCCAAAGG - Intronic
1020624325 7:10558749-10558771 GTTCCAATGTTGGTGGCCACAGG + Intergenic
1020812757 7:12865508-12865530 GTCCCAGTGGTGGTGGCCACAGG + Intergenic
1021034906 7:15785533-15785555 GTCCCAGTGATGGTGGCCACAGG + Intergenic
1021353832 7:19628877-19628899 GTCCTAGGGGTGGTGGCCACAGG + Intergenic
1021382306 7:19983210-19983232 GTCACAGTGCTGGTGGCCACAGG - Intergenic
1022348359 7:29539806-29539828 GTCATAGTGGTGGTGGCCACAGG + Intergenic
1022758839 7:33325899-33325921 CTCCCATTGGTGGTGGCCATGGG - Intronic
1024170386 7:46778725-46778747 GTCCTAGTGCTGGTGGCCACAGG + Intergenic
1024415122 7:49097016-49097038 GTCCTAATGGTGGTAGCCACAGG + Intergenic
1024662317 7:51510431-51510453 ATTCCAGTGATGGTGGCCACAGG - Intergenic
1024782275 7:52865124-52865146 GCCCCACTGCTGGAGGGCACTGG - Intergenic
1024946388 7:54811932-54811954 GTCCCTCTGCTGAGGGCCACAGG + Intergenic
1024956612 7:54927323-54927345 GTCCTAGTGTTGGTGACCACAGG + Intergenic
1025160571 7:56655664-56655686 GTCCTAGTGATGGTGGCCACAGG + Intergenic
1025718301 7:63983995-63984017 GTCCTAGTGATGGTGGCGACAGG + Intergenic
1025726157 7:64063538-64063560 GTCCTAGTGATGGTGGCCACAGG - Intronic
1025754913 7:64329672-64329694 GTCCTAGTGATGGTGGCCACAGG - Intronic
1026247513 7:68634299-68634321 GTCCCAAAGCTGCTGGCCTGTGG - Intergenic
1026467644 7:70668310-70668332 GTGCCAGTGCTGCTGGCCCCAGG + Intronic
1027122709 7:75533406-75533428 TTCCCAGGGCAGGTGGCCACTGG - Exonic
1028037122 7:85998988-85999010 GTACCAGTGCTAGTGGTCACTGG - Intergenic
1028181586 7:87730797-87730819 GTCCCAATACTGGTGCTCACAGG + Intronic
1028186343 7:87790113-87790135 GTCCCAGTGATGGTGGCCATAGG + Intronic
1028266469 7:88732920-88732942 CTCCCAGTGGTGGTGGCCACAGG - Intergenic
1028929429 7:96397039-96397061 ATCCCAGTGTTGGTGGCCACAGG - Intergenic
1028972703 7:96876195-96876217 GTCCCACTGGTAGTAGCCACAGG + Intergenic
1029367809 7:100127627-100127649 GGCCCCATCCTGGTGGACACCGG + Exonic
1030431502 7:109454958-109454980 GTCCCAGTGGTGGTGGACTCAGG - Intergenic
1030488555 7:110203441-110203463 GTTCCAGTGCTGGTGGCCACAGG - Intergenic
1030598993 7:111571309-111571331 GTCTTAGTGGTGGTGGCCACAGG + Intergenic
1030662806 7:112239463-112239485 GTCCCAGTGGTGGTGACCACAGG + Intronic
1030966398 7:115997169-115997191 GTCCCATTGGAGGTGGCCAGAGG + Intronic
1031098585 7:117449484-117449506 GTCCCAGTGGTGGTGGCCACAGG + Intergenic
1031231515 7:119113892-119113914 GTTACAGTGGTGGTGGCCACAGG - Intergenic
1031260173 7:119507844-119507866 GTCCCACTACTGGTGCTCACAGG + Intergenic
1031412410 7:121456243-121456265 GTCCCAGTGGTGGTAGCCACAGG - Intergenic
1031442661 7:121812673-121812695 ATCTCAGTGGTGGTGGCCACAGG + Intergenic
1031639010 7:124139679-124139701 GTTATAGTGCTGGTGGCCACAGG - Intergenic
1031753917 7:125613312-125613334 GCCCCAGTGCTGGTGGCCACAGG + Intergenic
1031862391 7:126994978-126995000 GTCCCAGTGGTGGTGGCCACAGG + Intronic
1032138682 7:129307012-129307034 GTCCCAGTGTTGGTGGCCACAGG - Intronic
1032939215 7:136768860-136768882 GTTCCAGTGTTGGTGGCCACAGG + Intergenic
1033499993 7:141937761-141937783 GTCCCAGTGGTGGTGGTCACAGG + Intronic
1033591234 7:142809960-142809982 GGCCACATGCTGGTGGCCAGAGG - Intergenic
1033867678 7:145713028-145713050 GTCCCAGTGGTGGTGGTCACAGG - Intergenic
1034398177 7:150843098-150843120 GTCCCAGTGGCGGTGGCCACAGG + Intronic
1035084419 7:156246335-156246357 GTCCTAGTGGTGTTGGCCACAGG - Intergenic
1035139196 7:156739530-156739552 GTCCCAGTGTTGGTGGCCACAGG + Intronic
1037295749 8:17397807-17397829 GTCCCAGTGGTGGTGGCCACAGG + Intronic
1037431066 8:18813707-18813729 GTCCCAGAACTGGTGACCACTGG - Intronic
1038671380 8:29585831-29585853 TTCCCACTGCTGGTGACTACAGG - Intergenic
1040485733 8:47869590-47869612 TTCCCAGTTGTGGTGGCCACAGG + Intronic
1040511397 8:48099606-48099628 GTCCTAGTGCTGGTGGCCACAGG - Intergenic
1040742995 8:50603879-50603901 GTCCTAATGATGGTGGCCACAGG - Intronic
1041500294 8:58532914-58532936 GTCCCAGTATTGGTGGCCACAGG - Intergenic
1041579805 8:59446280-59446302 GTCCCAGTGGTTGTGGCCACAGG - Intergenic
1041663903 8:60424179-60424201 GTCCCAATGAGGGTGTACACCGG + Intergenic
1042082441 8:65070470-65070492 GTCCCAGTGGTAGTGGCCACAGG - Intergenic
1043215045 8:77574719-77574741 GTCCCAGTGGTAGTGGCCACAGG + Intergenic
1043323266 8:79017562-79017584 GTCCCAGTGCTGATGGCCACAGG - Intergenic
1043567441 8:81563013-81563035 GACCCAGTGGGGGTGGCCACAGG + Intergenic
1044124364 8:88438756-88438778 GTCCCAGTGATGGTGGCCACAGG + Intergenic
1044467769 8:92526514-92526536 GTGCCAATGGTGGTGGCAGCGGG - Intergenic
1045041202 8:98226674-98226696 GTCCCAGTGGGAGTGGCCACAGG - Intronic
1045171562 8:99676241-99676263 GTGCCAACCTTGGTGGCCACGGG - Intronic
1045590065 8:103583022-103583044 GTCATAGTGGTGGTGGCCACAGG + Intronic
1045598931 8:103692116-103692138 GTCTCATTGGTAGTGGCCACAGG - Intronic
1045995018 8:108352292-108352314 GTCCCAGTGGTGGTGGCCACAGG + Intronic
1046268085 8:111858226-111858248 GTCATAGTGGTGGTGGCCACAGG - Intergenic
1046384013 8:113486013-113486035 GTTTCAGTGGTGGTGGCCACAGG - Intergenic
1046463180 8:114569428-114569450 GTACAAGTGGTGGTGGCCACAGG - Intergenic
1046767149 8:118082049-118082071 GTCCCCATGATTGTGGCCGCAGG - Intronic
1047933738 8:129754234-129754256 GAGCCAGTGGTGGTGGCCACAGG + Intronic
1048029781 8:130620661-130620683 GTCCCAGTCGTGGTGGCCACAGG - Intergenic
1048118875 8:131556163-131556185 GTCCCAGTGGTGGTGGCCACGGG + Intergenic
1048646760 8:136429019-136429041 GTCACAGTGATGGTGGACACAGG + Intergenic
1049418474 8:142506205-142506227 GTCCCAATGGTGGCGGTCACTGG + Intronic
1049695760 8:143983652-143983674 GCCACAGTGCTGGGGGCCACAGG + Exonic
1050316121 9:4402133-4402155 GTCCCAGTGGTGGTGGCCACAGG + Intergenic
1050355980 9:4782772-4782794 GTACCCGTGGTGGTGGCCACAGG + Intergenic
1050676559 9:8062557-8062579 GCCCCAATGCTGGGGGCAGCAGG + Intergenic
1050722072 9:8601472-8601494 GTCCCAGTGGTGATGGCCACAGG + Intronic
1050930084 9:11311926-11311948 GTCCCAGTGGTGGTGGCAATGGG - Intergenic
1051306827 9:15718561-15718583 GTCCTACTGGTGGTGGCCACAGG + Intronic
1051455050 9:17246457-17246479 TTTCCAATGTTGGTGGTCACAGG - Intronic
1051465171 9:17368584-17368606 GTCCCAGTGGTGGTGGCCACAGG + Intronic
1051990984 9:23152882-23152904 GTCATAGTGGTGGTGGCCACAGG - Intergenic
1052119915 9:24701404-24701426 GAACCAATGCTTGTGGCCAGTGG - Intergenic
1052732998 9:32311260-32311282 GTCCCACTGGTGGTGACCACAGG + Intergenic
1053028115 9:34748463-34748485 GTCCTAGTTGTGGTGGCCACAGG + Intergenic
1053040168 9:34863361-34863383 GTCCCAGTGGTGGTGGCCACAGG + Intergenic
1054334993 9:63799019-63799041 GTCTCAGTGGTGGTTGCCACAGG - Intergenic
1054956303 9:70914684-70914706 GTCCTAGTGCTGGTGGTCACAGG + Intronic
1055181121 9:73388388-73388410 GTCCCAGTGATGGTGGCCCCAGG - Intergenic
1055339138 9:75263180-75263202 GTCATAGTGGTGGTGGCCACAGG - Intergenic
1055387368 9:75776541-75776563 GTCCCAGTGGTGGTGGCCACAGG + Intergenic
1055579857 9:77697627-77697649 TTCCCAGTGGTGGTGGCCATGGG - Intergenic
1055782096 9:79831139-79831161 ATCCTAATGCAGTTGGCCACAGG - Intergenic
1055886365 9:81068831-81068853 GTCCCACTGGTGGTGGCCACAGG - Intergenic
1056230471 9:84538340-84538362 GTCCCAGTGGTGGTGGCCACAGG - Intergenic
1056338934 9:85604203-85604225 GTACCAGCGGTGGTGGCCACAGG + Intronic
1057078684 9:92155635-92155657 GCCCCCATGTTGGTGTCCACTGG - Intergenic
1057644547 9:96860357-96860379 GTCCCAGTGGTGGTGGCTACAGG + Intronic
1058004056 9:99896379-99896401 GTCCCAGTGGTGGTGGTTACGGG + Intergenic
1058248976 9:102668298-102668320 GTCCCTGTGGTGGTGGCCCCAGG - Intergenic
1058285161 9:103168762-103168784 GTCCCAGTGGTGGTGGCCACAGG - Intergenic
1059555356 9:115275618-115275640 GTTCCAGTGGTGGTGGCCACAGG - Intronic
1059873331 9:118602581-118602603 ATGCCTATGCTGGTGGCCAGAGG + Intergenic
1060084018 9:120680537-120680559 GTCCCAGTGGTGGTGGCCACAGG - Intronic
1060166591 9:121422451-121422473 GTCTCAGTGGTGGTGGACACAGG - Intergenic
1060304597 9:122399133-122399155 GTCCCAGTGGTGGTGGCCACAGG + Intergenic
1060414177 9:123419125-123419147 GTACAGATGCTGGAGGCCACAGG + Intronic
1061290026 9:129645435-129645457 CTCCCACTCCTGGTGACCACAGG + Intergenic
1062211178 9:135365122-135365144 GCCCCACTGCTGAGGGCCACTGG - Intergenic
1062555785 9:137112886-137112908 GTCCCGAGGCTGGTGGTCAGCGG - Intronic
1203371268 Un_KI270442v1:307994-308016 GTCTCAGTGGTGGTGGCCACAGG - Intergenic
1186163383 X:6801649-6801671 TTCAGAACGCTGGTGGCCACAGG - Intergenic
1186691888 X:11986129-11986151 GTCCCAGTGTTGATGGCCACAGG + Intergenic
1186911567 X:14173605-14173627 GTCTCAGTGGTGGTGGTCACAGG - Intergenic
1187132878 X:16519030-16519052 GTCCCAGTGGTGGTGGCCACAGG + Intergenic
1187314929 X:18184095-18184117 GTCCCAGTGGTGGTGTCCACAGG + Intronic
1187579228 X:20591214-20591236 GTCCCAGTGGTGGTGGCAAAAGG - Intergenic
1187588386 X:20689471-20689493 GTCCCAGTGGTGGTGACAACGGG - Intergenic
1187610476 X:20938453-20938475 GTCATAGTGGTGGTGGCCACAGG - Intergenic
1187618207 X:21021099-21021121 GGCCCAGTGGTGATGGCCACAGG + Intergenic
1187623687 X:21086555-21086577 GTCCCACTGGTGGTGGCCACAGG + Intergenic
1187836314 X:23435600-23435622 GTCCCAGTGGTGGTGACCACAGG + Intergenic
1188046138 X:25428017-25428039 GTCATAGTGGTGGTGGCCACAGG - Intergenic
1188068751 X:25694470-25694492 GTCATAGTGGTGGTGGCCACAGG - Intergenic
1188078405 X:25807189-25807211 GTCTCAGTGCTGGTGGCCACAGG - Intergenic
1188192063 X:27183132-27183154 GTCCCAGTGGTGGTGGCCACAGG + Intergenic
1188716292 X:33463650-33463672 GTCCCAGTGGTGGTGGTCACAGG - Intergenic
1188721420 X:33528019-33528041 ATCCTAGTGATGGTGGCCACAGG - Intergenic
1188742881 X:33808455-33808477 GCCATAGTGCTGGTGGCCACAGG - Intergenic
1188996198 X:36888435-36888457 GTCACAGTGGTGGTGTCCACAGG + Intergenic
1189411777 X:40779223-40779245 GTCCCAATAGTAGTGGCCACAGG - Intergenic
1189623238 X:42866432-42866454 ACCCCAATGCTGGTGGTCAGTGG + Intergenic
1189628288 X:42922138-42922160 GTCCCACTGGTGGTGGCCACAGG + Intergenic
1189640895 X:43068848-43068870 GTCCCAGTGGTGGTGGCCACGGG + Intergenic
1189858347 X:45247158-45247180 GTCATAATGGTGGTGGCCACAGG - Intergenic
1189870126 X:45372306-45372328 GTCCCAGTGATGGTGGCCACAGG + Intergenic
1190015237 X:46820604-46820626 ATCCCAGTGATGGTGGCCACAGG + Intergenic
1190037920 X:47042937-47042959 GTCCCAGTGGTGGTGGCCATAGG + Intronic
1190046369 X:47114209-47114231 GTCCCACTGGTGGTGGCCACCGG + Intergenic
1190374234 X:49774040-49774062 GTCCCAGTGGTGGTGGCCACAGG - Intergenic
1190523114 X:51299781-51299803 GTCCCAATTGTGGTGGCCACAGG + Intergenic
1190537652 X:51446023-51446045 GTCCTAGTGGTGGCGGCCACAGG - Intergenic
1190614706 X:52218031-52218053 GTCCCAGTGGTGGTGGCCACAGG + Intergenic
1190919459 X:54838692-54838714 GTCATAATGGTGGTGGCCACAGG - Intergenic
1191048938 X:56169924-56169946 GTCTCAGTGGTGGTGACCACTGG + Intergenic
1191059236 X:56277563-56277585 GTCCGAGTGGTGGTGGCCACAGG - Intronic
1191123888 X:56933619-56933641 GTCACAGTGCTGGTGGCCACAGG + Intergenic
1191207330 X:57848978-57849000 GTCATAGTGTTGGTGGCCACAGG - Intergenic
1191222040 X:57999304-57999326 GTCCTAGTGGTGGTGGACACAGG + Intergenic
1191694704 X:63977916-63977938 GTCATAGTGGTGGTGGCCACAGG + Intergenic
1191801032 X:65079461-65079483 GTCATAGTGGTGGTGGCCACAGG + Intergenic
1191829680 X:65402557-65402579 GTCCTAGTGGTGATGGCCACAGG + Intronic
1191972654 X:66833651-66833673 GTCACAGTGGTGGTGGTCACAGG + Intergenic
1192060301 X:67817400-67817422 GTCCTAATGCTGGTGGCCATAGG + Intergenic
1192135154 X:68589811-68589833 GTCTCAGTGGTGGTGGCCACAGG + Intergenic
1192397395 X:70795569-70795591 GTCCCAGGGGTAGTGGCCACAGG + Intronic
1192672563 X:73161293-73161315 GTACCAGTGGTGGTGGCCACAGG - Intergenic
1192714669 X:73627218-73627240 GTCATAGTGATGGTGGCCACAGG - Intronic
1192839075 X:74835675-74835697 GTCTCAGGGATGGTGGCCACAGG - Intronic
1192891026 X:75390438-75390460 GCCCTAGTGGTGGTGGCCACAGG + Intronic
1192940993 X:75911771-75911793 GTCCTAGTTATGGTGGCCACAGG - Intergenic
1193163440 X:78256226-78256248 GTCATAGTGGTGGTGGCCACAGG - Intergenic
1193185152 X:78502653-78502675 GTCATAGTGGTGGTGGCCACAGG + Intergenic
1193191041 X:78571943-78571965 GTCCAAGTGGGGGTGGCCACAGG - Intergenic
1193204757 X:78735769-78735791 GTCACAGTGCTGGTGATCACAGG - Intergenic
1193252648 X:79309780-79309802 GTCACAATGGTGGTGGCCACAGG + Intergenic
1193283590 X:79685672-79685694 GTCTCAATGGTGGTGGTCACAGG - Intergenic
1193305885 X:79950357-79950379 GTCCCAGTGGTGGTGGCCACAGG + Intergenic
1193417178 X:81238727-81238749 GTCATAGTGGTGGTGGCCACAGG + Intronic
1193469181 X:81878471-81878493 GTCCCAGTTGTGGTGGCCAAGGG - Intergenic
1193524408 X:82572155-82572177 GTCAGAGTGGTGGTGGCCACAGG - Intergenic
1193676170 X:84454804-84454826 GTCCCAGTTGTGGTGGCCATAGG + Intronic
1193683622 X:84552100-84552122 GTCAGAGTGGTGGTGGCCACAGG - Intergenic
1193738121 X:85185242-85185264 TTACCAGTGATGGTGGCCACAGG - Intergenic
1193742449 X:85233029-85233051 GTGTCAGTGGTGGTGGCCACAGG + Intergenic
1193846707 X:86480382-86480404 ATCCCAGTGGTGGTGGCCAAAGG - Intronic
1193877759 X:86883459-86883481 GTCATCATGGTGGTGGCCACAGG - Intergenic
1194110310 X:89825167-89825189 GTCCCAGTGATGTTGACCACAGG + Intergenic
1194157780 X:90414973-90414995 GTCCTAGTGATGGTGGCCACAGG - Intergenic
1194340562 X:92700349-92700371 GTCCCAGTGGTGGTGGCCATGGG - Intergenic
1194493380 X:94578486-94578508 GTCTCAGTAGTGGTGGCCACAGG + Intergenic
1194500781 X:94678775-94678797 ATTCCAGTGGTGGTGGCCACGGG - Intergenic
1194526592 X:94984272-94984294 GTCCCAGTGGTGGTGGCCACAGG + Intergenic
1194568532 X:95523179-95523201 GTCATAGTGGTGGTGGCCACAGG + Intergenic
1194586185 X:95736849-95736871 GTCTCCTTGGTGGTGGCCACAGG + Intergenic
1194692812 X:97008835-97008857 GTCCCAGTGGTGGTCGCCACAGG - Intronic
1194780701 X:98022666-98022688 GTGCCAGTGGTGGTGGCCACAGG - Intergenic
1194795987 X:98211311-98211333 GTCCCAGTGGTGGTGGCCACAGG + Intergenic
1194882873 X:99274890-99274912 GTCCCTGTAGTGGTGGCCACAGG + Intergenic
1194892444 X:99397548-99397570 GCCCCAGTAGTGGTGGCCACAGG - Intergenic
1194937527 X:99969756-99969778 GTCCCAAGATTGGTGGCCACAGG - Intergenic
1195136310 X:101910009-101910031 GTCACAGTGGTGGTGGCCACAGG + Intronic
1195199967 X:102539289-102539311 GTTCCAGTGGTGATGGCCACAGG - Intergenic
1195312389 X:103643990-103644012 GTCCCAGTGGTGGTGGCTACAGG + Intergenic
1195403814 X:104491309-104491331 GTCCCAGTCCTGGTGGCCTTTGG - Intergenic
1195601387 X:106752278-106752300 GTCCCAGCAGTGGTGGCCACAGG + Intronic
1195782924 X:108484710-108484732 ATCCCAGGGGTGGTGGCCACAGG - Intronic
1195821072 X:108946026-108946048 GTCCTAGTGGTGGTGGCAACAGG - Intergenic
1195917327 X:109948471-109948493 GTCCCAGTAGTGGTGACCACAGG + Intergenic
1195971402 X:110477696-110477718 GTCCTAGTGGTGGTGGCCACAGG - Intergenic
1196182030 X:112703271-112703293 GTCCCAGTGGTGGTGGCCCAGGG - Intergenic
1196214414 X:113034469-113034491 GTCATATTGATGGTGGCCACCGG - Intergenic
1196232371 X:113239435-113239457 GTCATAGTGGTGGTGGCCACAGG - Intergenic
1196233403 X:113252384-113252406 GTCCTAGTGCTGATGGCCACAGG - Intergenic
1196357183 X:114808907-114808929 GTCCCAGTGGTGGTGGCCACAGG - Intronic
1196461272 X:115934820-115934842 GTCATAGTGGTGGTGGCCACAGG - Intergenic
1196508321 X:116475997-116476019 GTCGTAGTGGTGGTGGCCACAGG - Intergenic
1196576553 X:117325435-117325457 GTCCAAATGGTGGTGGCCACAGG - Intergenic
1196600825 X:117600223-117600245 GTCATAGTGGTGGTGGCCACAGG - Intergenic
1196619716 X:117807709-117807731 GTCCCAGTGGTGGTAGCTACAGG + Intergenic
1196660631 X:118264890-118264912 GTCATAGTGTTGGTGGCCACAGG + Intergenic
1196922245 X:120595796-120595818 GTCATAGTGGTGGTGGCCACAGG + Intronic
1196962013 X:121013999-121014021 GTCCCAGTGGTGGTGGCCACAGG - Intergenic
1196980487 X:121208706-121208728 GTCATAGTGGTGGTGGCCACAGG - Intergenic
1196984437 X:121253211-121253233 GTCACAGTGGTGGTGGCCACAGG - Intergenic
1197025101 X:121738554-121738576 GTCCTAGTGGTGGTGGCCACAGG + Intergenic
1197075845 X:122351271-122351293 GTCACAGTGGTGGTCGCCACAGG + Intergenic
1197382669 X:125765057-125765079 GTCCCAGTGGGGGTGGACACAGG - Intergenic
1197458074 X:126702257-126702279 GTCCCACTGGTGGTGGTCACAGG + Intergenic
1197514569 X:127410479-127410501 GTCCCATTGTTGGTGGCTACAGG - Intergenic
1197520285 X:127489503-127489525 GTTCCAGTGGTGGTGGCTACAGG - Intergenic
1197524350 X:127544379-127544401 GTCATAATGGTGGTGGTCACAGG - Intergenic
1197537606 X:127709055-127709077 GTCTCAGTGGTGGTGGCAACAGG + Intergenic
1197558962 X:127993189-127993211 ATTACAGTGCTGGTGGCCACTGG + Intergenic
1197600471 X:128521001-128521023 GTCATGGTGCTGGTGGCCACAGG + Intergenic
1197670533 X:129272742-129272764 GTCCCAGTGGTGGTGGCCACAGG - Intergenic
1198430698 X:136564129-136564151 GTCCCAATGGTGGTGGCCACAGG - Intergenic
1198515105 X:137399649-137399671 GTCCCAGTGCTGGTGGCCACAGG - Intergenic
1198537676 X:137602066-137602088 GTCCCAGTGGTGGTGGCCACAGG + Intergenic
1198702459 X:139413179-139413201 GTCCTAGTGGTGGTGGCCACAGG - Intergenic
1198770472 X:140125510-140125532 GGCCCAGTGGTGGTGGCCACAGG - Intergenic
1198785358 X:140282754-140282776 GTCCTAGTGATGGTGGCCACAGG - Intergenic
1198817962 X:140613761-140613783 GTCATAGTGGTGGTGGCCACAGG - Intergenic
1198964535 X:142214092-142214114 GTCCTAGTGATGGTGGCCAGAGG - Intergenic
1199037151 X:143064491-143064513 GTCCCAGTAGTGGTGGCCACTGG + Intergenic
1199138806 X:144286571-144286593 GTCCCAGTGATGGTGGTTACAGG - Intergenic
1199156237 X:144551763-144551785 GTCATACTGGTGGTGGCCACAGG + Intergenic
1199258653 X:145745359-145745381 GTCATAGTGCTGGTGGCCACGGG + Intergenic
1199304033 X:146245750-146245772 GTCACAGTGATGGTGGCCACAGG + Intergenic
1199316158 X:146380088-146380110 GTCCCAGTGGTGGTGGCCACAGG + Intergenic
1199358411 X:146887336-146887358 GTCATAGTGGTGGTGGCCACAGG + Intergenic
1200090945 X:153635692-153635714 GGCTCAAGGCTGGTGGCCAGGGG + Intergenic
1200211698 X:154349471-154349493 GGCCCCATGCTGGGGGGCACAGG + Exonic
1200370640 X:155720533-155720555 GTCACAGTGGTGGTGACCACAGG + Intergenic
1200462972 Y:3479908-3479930 GTCCCAGTGATGTTGACCACAGG + Intergenic
1200504113 Y:3991942-3991964 GTCCTAGTGATGGTGGCCACAGG - Intergenic
1200536044 Y:4398644-4398666 GTCCCTTTGGTGGTGCCCACAGG + Intergenic
1200648917 Y:5817087-5817109 GTCCCAGTGGTGGTGGCCATGGG - Intergenic
1201066012 Y:10095013-10095035 GTCATAGTGGTGGTGGCCACGGG - Intergenic
1201067077 Y:10107090-10107112 GTCTCAGTGGTGGTGGCCACAGG + Intergenic
1201760793 Y:17536238-17536260 GTCTTTGTGCTGGTGGCCACAGG - Intergenic
1201840759 Y:18369752-18369774 GTCTTTGTGCTGGTGGCCACAGG + Intergenic
1202024014 Y:20501381-20501403 ATCACAGTGATGGTGGCCACAGG - Intergenic