ID: 1092480905

View in Genome Browser
Species Human (GRCh38)
Location 12:8858284-8858306
Sequence ATGAGAATACAGATGAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 287}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092480900_1092480905 28 Left 1092480900 12:8858233-8858255 CCGTGATCAAAATGCTTAGCTGG 0: 1
1: 0
2: 1
3: 10
4: 164
Right 1092480905 12:8858284-8858306 ATGAGAATACAGATGAAGCCTGG 0: 1
1: 0
2: 0
3: 29
4: 287
1092480904_1092480905 -1 Left 1092480904 12:8858262-8858284 CCTCAGTTTTCATGTCTGTAGAA 0: 1
1: 6
2: 87
3: 657
4: 3391
Right 1092480905 12:8858284-8858306 ATGAGAATACAGATGAAGCCTGG 0: 1
1: 0
2: 0
3: 29
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092480905 Original CRISPR ATGAGAATACAGATGAAGCC TGG Intronic
901359680 1:8686452-8686474 ATAAAAATAAAGATGTAGCCGGG + Intronic
901760829 1:11470138-11470160 ATAATAATACAGCTGAGGCCAGG + Intergenic
904142786 1:28367099-28367121 ATGAAAATAAAGATAAAACCGGG - Intergenic
904724543 1:32537196-32537218 ATGAGAATATTGATGAAGTGGGG - Intronic
905246933 1:36621573-36621595 CTGTGAATACAGATGAGGCTTGG + Intergenic
905991288 1:42339000-42339022 TTCAGAATTCAGATGAAGCTAGG - Intergenic
906305710 1:44717527-44717549 ATGGGAACACAAAGGAAGCCAGG - Intronic
908432539 1:64073097-64073119 GTGAGACTGGAGATGAAGCCTGG - Intronic
908785411 1:67730407-67730429 ATGAGAAAACACTTGAACCCAGG + Intronic
909934010 1:81530205-81530227 ATGAAGATAAAGCTGAAGCCTGG - Intronic
910014901 1:82510068-82510090 ATGAGAATAGACATGGAGCTTGG + Intergenic
910067961 1:83176384-83176406 ATCAGCAAACAGATGAAGACTGG - Intergenic
910519355 1:88101468-88101490 AGGAGAATAATGAGGAAGCCTGG + Intergenic
911053765 1:93694081-93694103 ATGAGAATACAGATCTGACCAGG + Intronic
911324728 1:96456772-96456794 CTGAAAACACTGATGAAGCCTGG - Intergenic
911994713 1:104750940-104750962 ATAAGAATATATATGCAGCCAGG + Intergenic
913397586 1:118389178-118389200 ATGAGACTGCAGATGTAGGCAGG + Intergenic
915046427 1:153021186-153021208 ATGAGAGATCAGATGAAACCTGG + Intergenic
917072850 1:171171093-171171115 ATGAGAAAACAGTGGAAGCTTGG - Intergenic
917088744 1:171330402-171330424 ATGAGAATAGACATGAACCATGG - Intronic
917113235 1:171574406-171574428 AAGAAAATACAGCTGAAACCAGG + Intronic
917418330 1:174834869-174834891 ATGAGGTTGGAGATGAAGCCAGG + Intronic
918671875 1:187227841-187227863 AAGCGAACACTGATGAAGCCAGG + Intergenic
920253386 1:204637753-204637775 AGGAGCATACAGATGAGGCCCGG - Intronic
920510402 1:206547315-206547337 CTGTAAATACAGATGAAGCGTGG - Intronic
921782864 1:219188560-219188582 ATGAGGATAAAGAGGAAGACTGG + Intronic
923762665 1:236861144-236861166 TTGAGGATACTGAGGAAGCCAGG + Exonic
924812301 1:247414063-247414085 AAGAAAATAGAGAAGAAGCCAGG - Intergenic
1063099608 10:2938039-2938061 ATGTGAAAACAGAAGAAACCTGG - Intergenic
1064969328 10:21048341-21048363 ATGTAAATACAGATGCAGTCTGG + Intronic
1065238937 10:23686175-23686197 AAGATCATACAGATGAGGCCAGG - Intergenic
1065798471 10:29329143-29329165 ATGAGAACAGAGAAGATGCCTGG + Intergenic
1065880341 10:30032047-30032069 TTAAAAATACAGATGGAGCCGGG - Intronic
1068516048 10:58026850-58026872 ATCAGAAAACACATGAGGCCGGG + Intergenic
1069070617 10:63987638-63987660 ACTAGAATACAGATGAAGGTTGG + Intergenic
1069776316 10:70929274-70929296 ATGAGGGTACACATGAGGCCTGG + Intergenic
1071767407 10:88683396-88683418 ATAAAAATACAGATGAGGCCAGG + Intergenic
1072086523 10:92084872-92084894 GTTAAAATACAGATGAGGCCGGG - Intronic
1073440611 10:103550379-103550401 ATGAGAGGACAGATGCAGCTGGG + Intronic
1073618385 10:105021722-105021744 ATGAGAAAACAGATGAAAGCTGG - Intronic
1074398083 10:113116538-113116560 ATGAAAGTACAGATTAAGCCTGG + Intronic
1075172921 10:120132407-120132429 ATGAGATTACAAATGTAACCTGG - Intergenic
1077440664 11:2567268-2567290 CTGCAAATACAGATGAACCCAGG + Intronic
1081818140 11:45964947-45964969 ATAAGAATCCAGATGAAGGTAGG - Intronic
1082711694 11:56560723-56560745 TTGAAAATAGAGAAGAAGCCAGG - Intergenic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1084842944 11:71872427-71872449 ATGAGATTACAGATTGAGCTAGG - Intronic
1085087590 11:73681290-73681312 CTGAGAATACAGATGTAACAAGG + Intronic
1085876834 11:80417710-80417732 ATGAAAAAACAAATGAATCCTGG + Intergenic
1085897924 11:80662148-80662170 ATGAGAAGTCAAATTAAGCCAGG + Intergenic
1087782385 11:102314702-102314724 ATGAGAAGACAGAACAACCCTGG - Intergenic
1090588020 11:128235143-128235165 ATGAGGAAACAGATAAAGCTGGG + Intergenic
1092480905 12:8858284-8858306 ATGAGAATACAGATGAAGCCTGG + Intronic
1092631894 12:10389001-10389023 ATGACAATTCACATAAAGCCAGG + Intronic
1093874960 12:24339471-24339493 ATGAGGTCACAGAGGAAGCCAGG + Intergenic
1095088104 12:38080107-38080129 ATGAGAAGAAAGATGAATGCTGG + Intergenic
1095740732 12:45603816-45603838 TTAAGAATGAAGATGAAGCCAGG - Intergenic
1096672458 12:53208346-53208368 ATGAGAAAACAGCTGCAGGCAGG - Intergenic
1097152016 12:56986135-56986157 AAGAGCAGAGAGATGAAGCCAGG - Intergenic
1098269665 12:68757790-68757812 ATAAGAATAAAAATGAGGCCAGG + Intronic
1101923944 12:108955884-108955906 ATGAGAAAACAGATGCAGGAAGG + Intronic
1102764563 12:115421389-115421411 ATAAGGCTACAGATGAAGGCAGG - Intergenic
1103771268 12:123327297-123327319 ATAAAACAACAGATGAAGCCAGG - Intronic
1104541191 12:129666604-129666626 ATTAGATTATAGATGAGGCCTGG + Intronic
1106686578 13:32066639-32066661 ATGAGAAGACTAATGAAGGCAGG - Intronic
1108102527 13:46972139-46972161 ATGAGGATAAAGAGGAAGACCGG - Intergenic
1109325558 13:60863287-60863309 ATGAGAATGAAGATGATACCTGG + Intergenic
1114638545 14:24203287-24203309 ATGAGAAGACAGATGAAGTGTGG - Intronic
1116125007 14:40772903-40772925 GTGAGGATAGAGATGAAGCATGG - Intergenic
1117187440 14:53254868-53254890 ATGAGAGATCAGATGAAACCTGG - Intergenic
1117253302 14:53955397-53955419 ATGTGACTAGAGATGAATCCTGG - Intronic
1117385961 14:55212970-55212992 ATGAGAATACTGATAGAGGCAGG - Intergenic
1117803625 14:59468312-59468334 ATGAGACTAGAGAGGAAGCAGGG - Intronic
1118978333 14:70696277-70696299 ATGAAAATACTGATGAATACTGG + Intergenic
1119738814 14:77000592-77000614 AGGAGAAGACAGAGGGAGCCAGG - Intergenic
1119965734 14:78913759-78913781 AAGAGAAAACAGATGAAATCTGG + Intronic
1119968171 14:78940092-78940114 ATGAGTCTAAAGATGTAGCCAGG - Intronic
1120019362 14:79510897-79510919 ATGGGAATACAGATGAGGCAGGG - Intronic
1125101812 15:35922391-35922413 ATGAGCAGACAGATGAAGAGAGG - Intergenic
1126581713 15:50248193-50248215 ATGAGAAAACAGAGGAACACAGG + Intronic
1127121431 15:55775440-55775462 AAGAGACTACAGAGGGAGCCTGG - Intergenic
1129027203 15:72588210-72588232 AAGAGAATTCACATGAAGTCTGG - Exonic
1131742160 15:95404882-95404904 ATGAGAAAACACATGGGGCCTGG - Intergenic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1135141562 16:19926511-19926533 TTAAGAATACAGATGGGGCCGGG - Intergenic
1135174688 16:20217411-20217433 TTAAGGATACAGATCAAGCCTGG - Intergenic
1135956271 16:26958959-26958981 CTGACCACACAGATGAAGCCAGG - Intergenic
1137342246 16:47619976-47619998 ATTAGAATACAGAAGATTCCTGG + Intronic
1137450788 16:48571902-48571924 ACCAGAATACACAGGAAGCCTGG + Intronic
1137947076 16:52743821-52743843 TTGGGAACACAGATGATGCCTGG - Intergenic
1138110419 16:54319429-54319451 AAGAGAATATAGAAAAAGCCTGG - Intergenic
1139397303 16:66650441-66650463 CTGAGACTACAGATGCAGCCTGG + Intronic
1140230977 16:73116860-73116882 ATGAGAACACAGAAAAAGCCTGG + Intergenic
1140235552 16:73155524-73155546 ATAATAATATATATGAAGCCTGG + Intergenic
1140423617 16:74842020-74842042 AAGAGAACACAGATGAAACAAGG + Intergenic
1140677750 16:77350239-77350261 ATGAGAACAGAGATCAAGTCTGG + Intronic
1140771579 16:78210102-78210124 ATGACAAAATAGATGAAGCTCGG - Intronic
1141108152 16:81250380-81250402 AGGAGAGGAGAGATGAAGCCAGG - Intronic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1142646508 17:1317128-1317150 ATGAAAACACATAGGAAGCCGGG + Intergenic
1142796786 17:2314152-2314174 TTGAGAATGCAGAAGGAGCCGGG + Intronic
1143752384 17:9037948-9037970 ATGAGAATAGAGAGGAAGCAGGG - Intronic
1144300959 17:13922784-13922806 ATGAGAAAAGAGATGGAGTCTGG - Intergenic
1144786198 17:17833126-17833148 ATAAAAATACAGATCCAGCCGGG + Intronic
1145200854 17:20943434-20943456 ATGAAAACACAGATTAGGCCGGG - Intergenic
1146422956 17:32706436-32706458 ATGAAAATACACTTAAAGCCAGG + Intronic
1147851168 17:43444074-43444096 ATGAGATTACAGGTGGAACCAGG - Intergenic
1148328818 17:46800625-46800647 ATGAGAATCCAGCTGGAGCAGGG + Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1150657916 17:67052526-67052548 ATGAGCATCTAAATGAAGCCTGG + Intronic
1153349092 18:4059027-4059049 ATGAGAACAGAGATGCAGGCAGG + Intronic
1153507435 18:5815815-5815837 TTTAAAATGCAGATGAAGCCAGG + Intergenic
1154080876 18:11255254-11255276 ATGTGAATACAGGTGAATACAGG + Intergenic
1154363079 18:13681318-13681340 ATGAGAAAACAGATTAGGCAAGG - Intronic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1159087278 18:63808057-63808079 CTGACAATTGAGATGAAGCCTGG - Intergenic
1161447099 19:4324534-4324556 AAGAGAAGACAGATGAGGCCAGG + Exonic
1162765801 19:12918656-12918678 AGGAGAAAAGAGATGAGGCCGGG + Intronic
1163781964 19:19255242-19255264 AAGAGAATAAAAATCAAGCCCGG + Intergenic
1164230029 19:23279068-23279090 ATTAGAAAACAGATGTAGCCAGG - Intergenic
1166727897 19:45039727-45039749 AGGAGAATAAGGATGAAGGCAGG - Intronic
1166986599 19:46663798-46663820 AAGAGAATGCAAATGAGGCCGGG + Intergenic
925918802 2:8625564-8625586 ATGAGATTACAGCCAAAGCCAGG + Intergenic
926489771 2:13510788-13510810 CTGAGAGTACAGTTGAAGCAAGG + Intergenic
929069503 2:38015215-38015237 ATGAGATTACAGAGAAAGACAGG + Intronic
929348296 2:40915062-40915084 ATGAGAATACAAAGTTAGCCAGG - Intergenic
930129408 2:47833961-47833983 TTGAAAATAAAGATGCAGCCAGG - Intronic
930301191 2:49618101-49618123 CTGACAAAACAGATGAAGACAGG + Intergenic
931349897 2:61477606-61477628 ATGAGAACACAGATGTAACCTGG - Intergenic
931712523 2:65001239-65001261 TTAAGAATACTGATGAAGACAGG + Intronic
932234930 2:70113266-70113288 ATGAGATTAAAAATGTAGCCTGG - Intergenic
933698900 2:85240292-85240314 TTGTGAACACAGAGGAAGCCGGG + Intronic
934609112 2:95721574-95721596 TTGAGAAGACACATGAGGCCTGG - Intergenic
934648390 2:96072587-96072609 TTGAGAAAACAGAGGACGCCGGG + Intergenic
937134117 2:119537575-119537597 AAGGGAATACAGCTTAAGCCTGG + Intergenic
939025026 2:137002332-137002354 ATGAGAAAACAGATCCAGACTGG + Intronic
939071780 2:137552895-137552917 ATGAGAAAAGAGAGAAAGCCTGG + Intronic
939306319 2:140416092-140416114 TTGTGAATACAGATGAAGCTTGG - Intronic
940975528 2:159939210-159939232 TTAAAAATACAGATGAGGCCAGG + Exonic
941515519 2:166471111-166471133 ATGAGAATAAAGATGAAGAGAGG + Intronic
943582980 2:189706098-189706120 ATGAGAAGAAAGAAGAGGCCAGG + Intronic
943639499 2:190343456-190343478 ATGAGAGTACAGATGAATGGAGG + Exonic
944651928 2:201838849-201838871 ATGAGAATACTGATGAAAAAAGG - Intronic
944691584 2:202163395-202163417 ATAAGAATACATATGTGGCCAGG - Intronic
946355689 2:219182909-219182931 ATGAGAATAGAGATGAGGCAGGG - Exonic
947224052 2:227823016-227823038 ATCTGATTTCAGATGAAGCCAGG + Intergenic
947787955 2:232841609-232841631 ATGAAAATACAAATGAAGGCAGG - Intronic
949030260 2:241792659-241792681 ATGAGAGATCAGATGAAACCTGG + Intronic
1169875398 20:10291786-10291808 ATGAAAATACAGATGAAAAGAGG + Intronic
1170277612 20:14609320-14609342 ATGAGGAAAGAGATGAATCCAGG + Intronic
1170966494 20:21077052-21077074 ATGGGAAGACAAATTAAGCCAGG - Intergenic
1172257361 20:33530783-33530805 ATGAAAATAAAGATGGCGCCAGG + Intronic
1173240379 20:41290642-41290664 ATGAGAAAACAGATGCAGAGAGG + Intronic
1173447339 20:43130961-43130983 ATCTAAATACAAATGAAGCCAGG + Intronic
1174328448 20:49798381-49798403 ATCAGAATACTGTTGAAGGCTGG - Intergenic
1174849203 20:53975651-53975673 ATTAAAACACAGATGCAGCCAGG + Intronic
1175659569 20:60801005-60801027 ATGATGAAACAGATGAAACCAGG + Intergenic
1177999116 21:28139106-28139128 ATGAGAAGAAACAAGAAGCCAGG - Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1179165566 21:38932865-38932887 TTAAGAATAGAGATAAAGCCGGG - Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1182709325 22:32310728-32310750 ATGAGAAGACAGACTCAGCCGGG - Intergenic
1182973203 22:34596897-34596919 ATGAGAATACACATGGAGACAGG - Intergenic
1182980669 22:34667745-34667767 ATGAGAACACACATGGAGACAGG - Intergenic
1183603039 22:38851061-38851083 AAGGGACTACACATGAAGCCAGG + Intergenic
1183709979 22:39497436-39497458 AAAAGAAGAAAGATGAAGCCGGG - Intergenic
1184303279 22:43576740-43576762 AGGAGAATAAAGAGGAATCCTGG + Intronic
1184533110 22:45069581-45069603 ATTAGAATAGTGATGAGGCCGGG + Intergenic
1184839147 22:47042455-47042477 ATGAGAATGAAGATGATGCGGGG + Intronic
1185089685 22:48758877-48758899 ATGAGAATGCAGATGTAGACAGG - Intronic
949974252 3:9440484-9440506 ATGAGAATACAACTGAGGGCTGG + Exonic
950339229 3:12227842-12227864 CTGATACCACAGATGAAGCCCGG + Intergenic
951725422 3:25752538-25752560 ATTAAAATAAAGAAGAAGCCAGG + Intronic
951934951 3:28012294-28012316 ATGAAATTACAGATGGAGCCAGG + Intergenic
952850853 3:37728189-37728211 ATCAGAGCACAGAAGAAGCCTGG + Intronic
954046088 3:47931788-47931810 TTAAAAATACAGATGGAGCCAGG - Intronic
955754867 3:62216780-62216802 ATTGGAAGGCAGATGAAGCCAGG - Intronic
955988130 3:64596591-64596613 GTGAGAATACAGATAAATACTGG - Intronic
956329719 3:68092802-68092824 ATGTGCATACAGAAGAAGGCAGG + Intronic
956727625 3:72169400-72169422 ATGACAATACAGTTGAACCCAGG - Intergenic
957612816 3:82490374-82490396 GAGAGTATACATATGAAGCCTGG + Intergenic
959150963 3:102607078-102607100 ATGAGAAAACAGTTGAAGTATGG - Intergenic
959987820 3:112596845-112596867 AAGAGAATACAGATGACATCGGG + Intergenic
961137576 3:124526276-124526298 ATAAAAATACATATGGAGCCAGG + Intronic
961438797 3:126938350-126938372 CTGAGAAGACAGATGAAGAGCGG - Intronic
963004948 3:140718281-140718303 ATGAGAAAGAAAATGAAGCCCGG - Intergenic
963720002 3:148851240-148851262 ATGAGAATCCATTTGAACCCAGG + Intronic
966093632 3:176171704-176171726 ATGAGAATGTAAATGTAGCCAGG + Intergenic
966549914 3:181193543-181193565 ATAAAAATACAGTTGAAGCTTGG + Intergenic
966650316 3:182293468-182293490 AAGAGATTACAGAAGAGGCCAGG + Intergenic
967358758 3:188605543-188605565 TTCAGAATACAGATGAATTCTGG + Intronic
968284997 3:197503311-197503333 AAGAGAAAACACAGGAAGCCAGG + Intergenic
968294727 3:197567172-197567194 ATGAGACACCAGATGAAACCTGG + Intronic
968784706 4:2611567-2611589 AAGAAAATGCAGATTAAGCCGGG - Intronic
969046804 4:4342292-4342314 ATCAGAATATGGATGAAGACAGG + Intergenic
969145873 4:5123641-5123663 ATAAGAACACAGATGCACCCAGG - Intronic
970043159 4:11819787-11819809 GTGAGAATAAAGATGAAGCTTGG + Intergenic
971389749 4:26175030-26175052 ATGAGAAAACACATGAAGAGGGG - Intronic
971497536 4:27283035-27283057 GTGAGAATACACATCAAACCTGG + Intergenic
971913230 4:32823799-32823821 ATGAGAGTTCAGATGAAACCTGG - Intergenic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974144543 4:57930641-57930663 ATGAGAAGACAGAAGGAGGCCGG + Intergenic
974938788 4:68439141-68439163 ATGGGAAAACAGATGAAGAAAGG + Intergenic
975207071 4:71656945-71656967 ATGAGAATACAAATGTAAACTGG + Intergenic
980461990 4:133126182-133126204 ATGAGGATACAGATGGAAACAGG + Intergenic
982085679 4:151834014-151834036 GTGAGAAAACAGATTAAGACAGG + Intergenic
983134236 4:164060235-164060257 ATAAGAATCCAGCTGAAGACTGG + Intronic
983460421 4:168019434-168019456 ATAAGAAAAGAGATGAAGCCTGG - Intergenic
983855290 4:172636078-172636100 ATGAGATTACATATGATTCCAGG - Intronic
983869453 4:172808116-172808138 ACAAGAATACAGATGGGGCCGGG - Intronic
983984804 4:174045579-174045601 TTGAGAATACAGATGTTGTCAGG + Intergenic
984391225 4:179136595-179136617 AAGAGAATTCAGATGTACCCTGG + Intergenic
984729867 4:183058049-183058071 ATGATAATATTGATGATGCCTGG + Intergenic
985622043 5:960861-960883 CTGAGAAGACAGCTGAAGCTTGG - Intergenic
990305670 5:54492340-54492362 ATGAGAACTGGGATGAAGCCAGG + Intergenic
990420556 5:55628315-55628337 ATGAAAAAACAGAAGAATCCTGG + Intronic
990793053 5:59504521-59504543 ATGAGAACAGAAATGAATCCCGG - Intronic
991396039 5:66206330-66206352 ATGAGATTAAAGATGTAGGCAGG + Intergenic
991444276 5:66682864-66682886 ATTAAAATCCAGATGAAGCGGGG - Intronic
991704228 5:69342831-69342853 AAAAGAATAAAGATGACGCCAGG - Intergenic
992549594 5:77848075-77848097 AAGTGAATAGAGATGAAGGCAGG - Intronic
994297910 5:98113267-98113289 ATGAGAATATAGCTAATGCCTGG + Intergenic
994407846 5:99367822-99367844 CTGAGAACAGAAATGAAGCCAGG + Intergenic
994625850 5:102217767-102217789 ATGAGAAGACAGATTAGGCTTGG + Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
996164456 5:120208215-120208237 ATGAGAGCTCAGATGAAGTCAGG + Intergenic
996470933 5:123859791-123859813 ATGAGAAGACATGAGAAGCCAGG - Intergenic
996479010 5:123952197-123952219 ATGAGAATTAAGATGTAGGCAGG - Intergenic
997360345 5:133290882-133290904 ATGACAATACAGCTGAATGCTGG + Intronic
998516873 5:142763835-142763857 ATGGGAAAACAGAGGGAGCCAGG - Intergenic
998565751 5:143214589-143214611 ATGTGTTTACAGATGCAGCCAGG - Intronic
999155828 5:149456955-149456977 ATGAGAACAGAGATGAGGCAAGG + Intergenic
999681509 5:154064444-154064466 ATAAGAAAATAAATGAAGCCGGG - Intronic
999762696 5:154714882-154714904 ATGAAATTAAAAATGAAGCCGGG + Intronic
1000972876 5:167734145-167734167 ATGAAAATGCAGATGGAGCAAGG + Intronic
1001173842 5:169446517-169446539 ATGAGAGAAAAGATGAAGGCTGG - Intergenic
1002207573 5:177574170-177574192 AAGAGAAAATAGAAGAAGCCAGG - Intergenic
1002291975 5:178206168-178206190 ATGAAAATACAGATTAAGCTGGG + Intronic
1002675983 5:180913158-180913180 ATGGGAAGACTGATGAAGCTGGG + Intronic
1003946711 6:11082815-11082837 CTGAAAATACACCTGAAGCCTGG - Intergenic
1004327268 6:14686698-14686720 CTGTAAAAACAGATGAAGCCTGG + Intergenic
1005932900 6:30497108-30497130 ATAAGAAAGCAAATGAAGCCTGG + Intergenic
1006347324 6:33493377-33493399 ATAAGAAAACACCTGAAGCCAGG + Intergenic
1006728957 6:36221137-36221159 TTGAAAATACTGATGATGCCCGG + Intronic
1007080053 6:39093911-39093933 TTAAAAATACAGATGAAGTCTGG + Intergenic
1007948287 6:45845789-45845811 ACGAGACTACATATGAAGCAGGG + Intergenic
1008702936 6:54123228-54123250 CTAAGAATATAAATGAAGCCGGG - Intronic
1009909925 6:69913466-69913488 CTGAGAGAACAGATGAAGCCAGG + Intronic
1010042266 6:71398559-71398581 AAGAGAATACCAATGAAGGCAGG - Intergenic
1013291053 6:108719172-108719194 ATAAGAAAACTTATGAAGCCGGG - Intergenic
1016129100 6:140443335-140443357 ATAAAAATACAGAAGTAGCCAGG + Intergenic
1016841397 6:148529110-148529132 CTGTGAAAACAGATGAAGCTTGG + Intronic
1017828295 6:158100101-158100123 ATAAGAGTACAAATGAGGCCAGG + Intergenic
1017861511 6:158402495-158402517 CTGAGAAAACAAATGAAGACTGG + Intronic
1018871230 6:167784378-167784400 ATGAGAAAAAAAATGAAGCCAGG + Intergenic
1019106487 6:169671735-169671757 AGGAGAAGGCAGATGAGGCCAGG - Intronic
1019123163 6:169821539-169821561 ATGAGAGATCAGATGAAACCTGG + Intergenic
1020399138 7:7755114-7755136 GTGAGAAAACAGATCAAGGCAGG - Intronic
1022926089 7:35057502-35057524 CTGAGAATACAAATGAGGTCAGG + Intergenic
1022974302 7:35543727-35543749 AGGAGGATACAGATGGATCCAGG + Intergenic
1023585206 7:41722694-41722716 ATGAGTTTAAAAATGAAGCCTGG - Intergenic
1026175042 7:67989301-67989323 TTCAGAATACAGATAAGGCCAGG - Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1027489717 7:78808222-78808244 ATAAAAATACAGCTGAAGGCTGG - Intronic
1027489763 7:78808549-78808571 ATGAAAATACAGCTGAGGCTGGG - Intronic
1028324966 7:89512045-89512067 TTCAGAAGACAGATTAAGCCAGG - Intergenic
1029284937 7:99458915-99458937 AGGAAAATCAAGATGAAGCCAGG - Intronic
1031036517 7:116793601-116793623 ATAAGAACACATATGCAGCCAGG + Intronic
1031288806 7:119907091-119907113 ATGAAAGTACAGAGTAAGCCGGG - Intergenic
1033843857 7:145407876-145407898 AAGAGAAGAGAGATGAAGCTGGG - Intergenic
1034140843 7:148814469-148814491 ATGAGACTGCACATGAAGCTTGG - Intronic
1034211814 7:149370338-149370360 AAAAAAATACAGATGAGGCCAGG - Intergenic
1036776592 8:11617207-11617229 AGGAGAATGGAGATGAAGACGGG + Intergenic
1037340547 8:17839994-17840016 ATGAAAATACAGATGTGGGCCGG + Intergenic
1038074619 8:24057703-24057725 ATGAGAAGACAGCTGGGGCCTGG - Intergenic
1038424065 8:27453271-27453293 CTCATGATACAGATGAAGCCCGG + Intronic
1038850638 8:31271953-31271975 ATGAGGAGGCAGATGAAGCCGGG + Intergenic
1043043587 8:75293387-75293409 ATGAAAATACAGAAGTGGCCGGG + Intergenic
1043754717 8:83988564-83988586 ATGAGAACCCAGAGGAGGCCAGG - Intergenic
1045359282 8:101417550-101417572 ATCAGAATAAAGATGAGGGCTGG + Intergenic
1046356841 8:113097513-113097535 ATGAGAAAACAAAGGAAGACTGG - Intronic
1046639421 8:116710364-116710386 CTGAAAATACAGATCAAGCTGGG - Intronic
1046934196 8:119870678-119870700 ACAATAATACAAATGAAGCCAGG - Intergenic
1047257377 8:123225412-123225434 ATGAGACTAGAGATAAAGACTGG + Intronic
1047647247 8:126881900-126881922 ATGAGAAAACACATGTAGTCCGG + Intergenic
1047652220 8:126935133-126935155 AGGTGAATAAAGATGAAGACTGG + Intergenic
1049630023 8:143648807-143648829 ATGAGAAAACAGAAGAAATCAGG - Intronic
1050248798 9:3721215-3721237 ATGAGAAGACAGATGGAGTGGGG - Intergenic
1050911808 9:11080793-11080815 ATAAGTATACAGATGTTGCCAGG - Intergenic
1053243263 9:36514328-36514350 ATGACAAAAGAGAGGAAGCCAGG + Intergenic
1053575377 9:39354297-39354319 ATGAGAAGAGGGCTGAAGCCAGG + Intergenic
1054096938 9:60912980-60913002 ATGAGAAGAGGGCTGAAGCCAGG + Intergenic
1054118343 9:61188606-61188628 ATGAGAAGAGGGCTGAAGCCAGG + Intergenic
1054589412 9:66993958-66993980 ATGAGAAGAGGGCTGAAGCCAGG - Intergenic
1056580019 9:87883663-87883685 ATGAGAATGGAGAGGAGGCCAGG - Intronic
1057106495 9:92422715-92422737 ATGAGCATATAGATGAAAACAGG - Intronic
1057125170 9:92611049-92611071 ATGAGAATACAGCTGTAGGGAGG + Intronic
1058418763 9:104815683-104815705 ATGAGAATCCAGTTGATACCTGG + Intronic
1058444960 9:105046699-105046721 ATGAGACTAGAGAGGTAGCCAGG + Intergenic
1059554688 9:115267729-115267751 AAGAGAATAAGGATGAATCCTGG - Intronic
1059713532 9:116891590-116891612 GTCAGAATACAGATGCAGGCAGG + Intronic
1059940832 9:119358163-119358185 ATGAGAATAAGGATGAAGAGGGG + Intronic
1060649614 9:125314063-125314085 AGCAGAAGAGAGATGAAGCCAGG + Intronic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1186556386 X:10564113-10564135 GTGAGAACACAGATAAAGCATGG - Intronic
1187026031 X:15436334-15436356 AAGAGAATAAAGATGATGACGGG + Intronic
1188083187 X:25870810-25870832 ATGAGAAGACAGACAAATCCAGG + Intergenic
1192134494 X:68584141-68584163 ATGAGAATACACATAAAGTACGG + Intergenic
1192603365 X:72487964-72487986 ATGATAATACAGAGGTAGCCAGG + Intronic
1194044859 X:88989897-88989919 ATGAGAAATCAGATGAAAACTGG + Intergenic
1195406295 X:104517585-104517607 ATAAGACTACAGATTCAGCCGGG - Intergenic
1196821404 X:119703985-119704007 AGGAAAAAACAGATGAAGCTGGG - Intergenic
1197457107 X:126690613-126690635 ATGAGGATAGAGAGGTAGCCAGG - Intergenic
1199819056 X:151426666-151426688 ATGAGAATAAGGAGGGAGCCAGG + Intergenic
1200696339 Y:6364322-6364344 ATGAGAATAAAGATAAATCAAGG + Intergenic
1201037775 Y:9800378-9800400 ATGAGAATAAAGATAAATCAAGG - Intergenic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic