ID: 1092480990

View in Genome Browser
Species Human (GRCh38)
Location 12:8858825-8858847
Sequence CTGTGTCACCAAATCCATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 132}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092480990 Original CRISPR CTGTGTCACCAAATCCATCT GGG Intronic
900760766 1:4468656-4468678 CTGTGTCACCAGCCCCATCTGGG + Intergenic
901107072 1:6764819-6764841 CTCTGTCACCCAGTCGATCTCGG + Intergenic
902206057 1:14868969-14868991 CTGTGTCCCCCACTCCAGCTTGG + Intronic
904406203 1:30289963-30289985 CTGTGTCTGCGAATCCATCCAGG - Intergenic
904428182 1:30445152-30445174 CTGGGTCACCAAGGCCATCCAGG + Intergenic
904966936 1:34381446-34381468 CAGGCTCACTAAATCCATCTAGG - Intergenic
905606222 1:39302713-39302735 CTGTGACACCAAATAAATCAAGG - Intronic
907421112 1:54348103-54348125 CAGAGTCCCCATATCCATCTGGG + Intronic
908374793 1:63524341-63524363 CTGTGACACCACATCCCTGTGGG + Intronic
911017090 1:93345548-93345570 CTCTGTCCCCAAATCCAGCTAGG + Intergenic
911835485 1:102614063-102614085 CTGTGTCTATAAAGCCATCTTGG - Intergenic
918685388 1:187408552-187408574 CTGTCTCACCCTAACCATCTTGG + Intergenic
918794442 1:188874500-188874522 CTGTGTGACCCAATTCTTCTGGG - Intergenic
919402823 1:197140785-197140807 TTGTCTCACCATATCCACCTTGG - Intronic
920179335 1:204122873-204122895 CGCTGTCACCAAAGCCATCCAGG + Exonic
1063515020 10:6687299-6687321 CTGGGTCACCAAGGCCATCCAGG + Intergenic
1073112887 10:101073320-101073342 CTGAGTCCCCAAATTGATCTAGG + Intergenic
1074815015 10:117136718-117136740 CTGTGTCCCCAAATCCAGCTCGG - Intronic
1075304535 10:121355998-121356020 CTGGGTCACCAAATCCCGGTTGG + Intergenic
1075564822 10:123495554-123495576 CATTCTCACCAAACCCATCTCGG + Intergenic
1078065483 11:8076261-8076283 CTGTGGCACCAAGACCATTTTGG + Intronic
1079116905 11:17645872-17645894 CTGTGCCACCAATGCCACCTGGG + Exonic
1086017610 11:82185531-82185553 TTGTGACACAAAATTCATCTAGG - Intergenic
1087267775 11:96079658-96079680 CTGTGGCACCAAAGACACCTAGG + Intronic
1087904526 11:103680288-103680310 CTGTGTCCCCCAAACCATCCAGG - Intergenic
1089313241 11:117573835-117573857 CTGTTCCACCAAATCCTTCAGGG + Intronic
1092480990 12:8858825-8858847 CTGTGTCACCAAATCCATCTGGG + Intronic
1094675850 12:32619718-32619740 CTGTGTGCCCAAATTCAGCTTGG + Exonic
1097723703 12:63050729-63050751 TTGTGTCACCAGGTCCTTCTAGG - Intergenic
1101580295 12:106036787-106036809 CTGTGTCAGCAAAGCAATGTTGG + Intergenic
1101673629 12:106898534-106898556 GTGTGTCAACAAATGCAGCTGGG + Intergenic
1103747265 12:123133866-123133888 CTATGTCCCCAGATCCATGTTGG + Intronic
1104096211 12:125560214-125560236 CTGGGTCACCAAAAGCACCTTGG + Intronic
1104151202 12:126085004-126085026 GGGTTTCACCAAATACATCTTGG - Intergenic
1105940066 13:25140141-25140163 CTGTGTCCCCAAGCCCAACTAGG + Intergenic
1106144049 13:27036106-27036128 CTGTGTCACAGCTTCCATCTCGG - Intergenic
1110196865 13:72799687-72799709 CTGTACCACCAAAACCATCCTGG - Intronic
1114548575 14:23520520-23520542 CAGTGTCACCAAAAGTATCTTGG - Intergenic
1114803216 14:25802937-25802959 CTGTCTCACCAAAGCCATGCTGG - Intergenic
1122452714 14:101823685-101823707 CTCTGTCACCAGCTCCTTCTTGG - Intronic
1202864816 14_GL000225v1_random:109293-109315 ATGTGTCACCAAGCCCATTTAGG + Intergenic
1124096822 15:26656345-26656367 ATGTGTCACCTAATCCTTATTGG - Intronic
1124559213 15:30756496-30756518 CTGTGTTACCAGATCAAACTTGG + Intronic
1130760902 15:86818618-86818640 AGTTTTCACCAAATCCATCTAGG - Intronic
1131926267 15:97387215-97387237 CTCTGCCACCAAGTCAATCTAGG - Intergenic
1132669661 16:1097360-1097382 CTGTGTCACCACAGCCAACAGGG - Intergenic
1133540855 16:6751998-6752020 CTGAGTCACCTATTCCAACTGGG - Intronic
1135720267 16:24811392-24811414 ACATGTCACCAAATCCGTCTGGG - Intronic
1137932545 16:52602776-52602798 CTGTCTCTTCAAATCCATTTTGG + Intergenic
1141227050 16:82127900-82127922 ATGAGCCACCAAATCCATCCAGG - Intergenic
1141422608 16:83926445-83926467 CCGTGACACCTAATCCATCCGGG + Exonic
1144593138 17:16541760-16541782 CTGTGTCAGCTGATCCATCAAGG + Intergenic
1149854727 17:60071252-60071274 CTGAGTCAAGAAATCAATCTTGG - Intronic
1150747528 17:67827388-67827410 GTGTTTCACCAAATGCATCTCGG - Intronic
1153681436 18:7504734-7504756 CTGTGTGACCCAATTCTTCTTGG - Intergenic
1158857013 18:61553027-61553049 TTTTGTCACCAAAGCTATCTGGG + Intronic
1160357910 18:78244343-78244365 ATGTGTGGCCAAGTCCATCTAGG - Intergenic
1164424999 19:28133282-28133304 CTGTGTCTCCAAATCCACATGGG - Intergenic
1164658887 19:29945096-29945118 CTGTCTCACAAAACCCATGTAGG - Intronic
1165596016 19:37011748-37011770 GTGTGTCACCAAGGCCATATGGG - Intronic
1167614135 19:50522395-50522417 CTTTGACACCAAATCCCACTTGG + Intronic
925640368 2:5981314-5981336 CTGTGTCCACGAATCCCTCTGGG + Intergenic
926222417 2:10944877-10944899 CTGGGTCCCCAGATCCATGTGGG - Intergenic
926817183 2:16810609-16810631 CTGTGTTTTCAAATCCATCTTGG - Intergenic
931069112 2:58624464-58624486 TTGTGTCAACAAATACATATAGG - Intergenic
932526321 2:72473371-72473393 ATGTAACACCAAATCCATATTGG - Intronic
932717432 2:74111773-74111795 CTTTGGCACCAAATACACCTGGG - Intergenic
936663538 2:114568841-114568863 CTGTATCACCAAATCTATTTTGG + Intronic
940279677 2:151976413-151976435 CTATTTCACCAAATTCCTCTTGG - Intronic
940512098 2:154628594-154628616 CTGTTTCTCCACTTCCATCTTGG + Intergenic
942763855 2:179430880-179430902 CTGGGGCACCAAATGCCTCTGGG + Intergenic
946402307 2:219474831-219474853 CTCTGTCACCCACACCATCTCGG + Intronic
946689111 2:222297735-222297757 CTGTGTCACCTGTTACATCTTGG + Intronic
947601746 2:231455419-231455441 CTCTGCCACCAAATCCTCCTCGG + Exonic
948056558 2:235012985-235013007 CTGTGTCACCATCTGCATTTAGG - Intronic
1170588674 20:17754705-17754727 CTGTGTCCCCTCACCCATCTCGG + Intergenic
1170611470 20:17917185-17917207 CTCTGTCACCCAGTCAATCTTGG - Intergenic
1174306601 20:49617837-49617859 CTGTGTCACCAAATGGCTCTTGG + Intergenic
1176330818 21:5547101-5547123 CTGTGTCAGCAAATGGCTCTGGG + Intergenic
1176396939 21:6273850-6273872 CTGTGTCAGCAAATGGCTCTGGG - Intergenic
1176440218 21:6715254-6715276 CTGTGTCAGCAAATGGCTCTGGG + Intergenic
1176464480 21:7042323-7042345 CTGTGTCAGCAAATGGCTCTGGG + Intergenic
1176488041 21:7424102-7424124 CTGTGTCAGCAAATGGCTCTGGG + Intergenic
1177115128 21:17075848-17075870 TTGAGTCAGCAAATCTATCTAGG + Intergenic
1178228590 21:30754245-30754267 GTGTGTCACCCAAGCAATCTCGG + Intergenic
1179888432 21:44324385-44324407 CTGTGTCTCCAAAGCCAGCCTGG - Intronic
1182820800 22:33214514-33214536 CTGTGTCTCCAAATACATGATGG - Intronic
1184379941 22:44138939-44138961 CTTTGTCCCCAAATCCCTCTAGG - Intronic
1184986976 22:48142393-48142415 CTCAGTCCCCAAATGCATCTGGG + Intergenic
952726860 3:36595691-36595713 ATGTGTCAGCAAATCCACCAAGG + Intergenic
952863713 3:37836680-37836702 GGATGTCACCAATTCCATCTTGG + Intergenic
953193716 3:40712978-40713000 CTCTCTCACCGAATCTATCTAGG - Intergenic
953203140 3:40795675-40795697 CTTTGTCCCCAAAACCATATAGG - Intergenic
954454555 3:50590715-50590737 CTGTCACAGCAAATCAATCTGGG + Intergenic
954969953 3:54643243-54643265 CTGTGTCCTCAACTCTATCTAGG + Intronic
955146185 3:56322527-56322549 CTATCTCTCCAACTCCATCTTGG - Intronic
957639545 3:82834102-82834124 CTGGGTCACCAAAGCCATCTGGG - Intergenic
961364654 3:126391603-126391625 CTGTTTCCCCAATTCCATCTAGG + Intergenic
964770178 3:160216620-160216642 CTGTGTCACCAAATTCATTTTGG - Intergenic
967249309 3:187520531-187520553 CTGGGTCAGCAATTCCATGTGGG - Intergenic
967292221 3:187932399-187932421 CTGTGTCACCAAAACTCTCCGGG - Intergenic
968077800 3:195825851-195825873 CTGTGCCACAGAATCCACCTGGG - Intergenic
971481612 4:27119689-27119711 CAGTTTCTCCAAATCCCTCTGGG - Intergenic
972808312 4:42554306-42554328 CTGAGTCACCAAGTCCTTGTTGG - Intronic
972944693 4:44239980-44240002 CTTTATCACTAAATCCATCCAGG - Intronic
973536814 4:51891190-51891212 CTGTTTCACTTAATACATCTTGG + Intronic
974436301 4:61861677-61861699 TTATGTTACCAAATTCATCTAGG + Intronic
975335378 4:73170033-73170055 CAGTGACTCCAAGTCCATCTTGG - Intronic
980380212 4:132003954-132003976 TTGTGTCCCCAAATTCATATAGG - Intergenic
991909263 5:71545477-71545499 ATGTGTCACCACAGCCAGCTAGG + Intronic
995409695 5:111841900-111841922 GCTTGTCACCAAATGCATCTTGG - Intronic
996452336 5:123639728-123639750 CTGTGTCACTCAGTCCTTCTGGG + Intergenic
998223464 5:140306965-140306987 CTGTCTCAAAAAAACCATCTGGG + Intergenic
1001776346 5:174331857-174331879 CTGTGTGTCTAATTCCATCTTGG - Intergenic
1002173398 5:177387814-177387836 CTCTGTCACCAACACCATCGTGG + Exonic
1003747850 6:9023356-9023378 CTGGGTCACCAAATTTGTCTTGG + Intergenic
1010244405 6:73650010-73650032 CTTTGTCATCACATCCATCTCGG - Intronic
1017047017 6:150356352-150356374 CTGTGTGACCACATTCTTCTTGG - Intergenic
1021486810 7:21176543-21176565 CTCTGTCACCACATCCTTGTGGG - Intergenic
1021662783 7:22936963-22936985 CTGTCTCATCAAATTCAACTTGG + Intergenic
1029004095 7:97189228-97189250 CTGGGTCACCAAAGCCATCCAGG - Intergenic
1029506278 7:100965777-100965799 CTGTGTCACCAAATGCACGTCGG + Exonic
1031562174 7:123251631-123251653 CTGTTTCACCAATTCCAGCATGG + Intergenic
1032005823 7:128301343-128301365 CTGTGTCACCACAGCCTCCTGGG + Exonic
1032976503 7:137230246-137230268 ATCTGTCACCAAATTCTTCTTGG + Intronic
1033304655 7:140215525-140215547 GTGTGTCTCCAAAGCCATCTTGG + Intergenic
1035206558 7:157297396-157297418 CTGTGTCATCTGATCCATCAGGG + Intergenic
1038341874 8:26692967-26692989 CTGTGTCCCCAAATCCCCATCGG - Intergenic
1038541744 8:28395634-28395656 CTGTGCCACCACACCCAGCTAGG - Intronic
1039193426 8:35002946-35002968 CACAGTCACCAAACCCATCTAGG - Intergenic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1041009228 8:53525088-53525110 CTGTGTCACTCAAGCCAGCTAGG + Intergenic
1041643197 8:60225035-60225057 CTGAGTTACCAAATCCAAATAGG - Intronic
1042872776 8:73413162-73413184 CTGTGGCCCCAAATGCCTCTTGG - Intergenic
1044363110 8:91311063-91311085 CTGTTGCAACAAATCCATATGGG - Intronic
1047677560 8:127219899-127219921 CTGATTCACCAAATTAATCTTGG - Intergenic
1047718295 8:127615920-127615942 CTGTGTGACCTAATCTCTCTGGG + Intergenic
1047787841 8:128171205-128171227 CTGTGTCACCAACACCTTCCTGG + Intergenic
1050119328 9:2292203-2292225 TTGTGTCTCCAAAGCCATGTTGG - Intergenic
1051037084 9:12761068-12761090 CTGTCTCACCAAATTCCTGTAGG - Intergenic
1051740323 9:20245342-20245364 TTGTCTCACCAATACCATCTAGG - Intergenic
1056688674 9:88787469-88787491 CTGTTACACCAACTCCATCTTGG + Intergenic
1057610781 9:96541702-96541724 CTCTGTCACCATAGGCATCTTGG + Intronic
1060161846 9:121371097-121371119 CTCTGTCACCCAGGCCATCTCGG - Intergenic
1203739532 Un_GL000216v2:166929-166951 ATGTGTCACCAAGCCCATTTAGG - Intergenic
1185846849 X:3445780-3445802 CTTTGACACCCAATCCATCAGGG + Intergenic
1195907906 X:109863629-109863651 CTGGGAGACCAAAGCCATCTTGG + Intergenic
1196638327 X:118030455-118030477 CTGTTTCACTAATTGCATCTAGG + Intronic
1197569176 X:128128096-128128118 CCATGTCAACAACTCCATCTTGG - Intergenic
1197859682 X:130957094-130957116 CTGTCTCACAAAATCCATTTTGG + Intergenic
1200275612 X:154729558-154729580 CTGGGTCACCAAATGCATGTGGG + Intronic
1201516961 Y:14828570-14828592 TTATGTCAGCAAAGCCATCTTGG - Intronic