ID: 1092481241

View in Genome Browser
Species Human (GRCh38)
Location 12:8860985-8861007
Sequence AGGAATACGCATGAGAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 211}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092481241_1092481248 28 Left 1092481241 12:8860985-8861007 CCCTCCTTCTCATGCGTATTCCT 0: 1
1: 0
2: 1
3: 14
4: 211
Right 1092481248 12:8861036-8861058 TCACCCTTTTAAGGTCAAGAAGG 0: 1
1: 0
2: 1
3: 5
4: 108
1092481241_1092481247 19 Left 1092481241 12:8860985-8861007 CCCTCCTTCTCATGCGTATTCCT 0: 1
1: 0
2: 1
3: 14
4: 211
Right 1092481247 12:8861027-8861049 TGTCTCTAGTCACCCTTTTAAGG 0: 1
1: 0
2: 1
3: 9
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092481241 Original CRISPR AGGAATACGCATGAGAAGGA GGG (reversed) Intronic
906281382 1:44556529-44556551 AGGAAAAGGCAAGAGAGGGAAGG - Intronic
907229311 1:52980816-52980838 AAGAATAAGCATAAGAAAGATGG - Intronic
907381284 1:54092516-54092538 AGGGTTACACATGGGAAGGAAGG + Intronic
908210787 1:61897627-61897649 AGGAAAACTCATTAAAAGGAAGG - Intronic
909349811 1:74638027-74638049 AGGAAGGAGGATGAGAAGGATGG + Intronic
909847563 1:80414923-80414945 AGGAGAACAAATGAGAAGGAAGG + Intergenic
910125627 1:83838583-83838605 AGGAATTGGCATGAAATGGAAGG - Intergenic
911632813 1:100201351-100201373 AGAAAAAAGAATGAGAAGGAAGG + Intronic
911703367 1:100982192-100982214 AAGAATACCTTTGAGAAGGAAGG - Intergenic
913371420 1:118103810-118103832 AGTCATACACATGAGAAGCAGGG + Intronic
913478012 1:119257962-119257984 AGAAAAACGCATGACAAGAAAGG + Intergenic
915983579 1:160440313-160440335 AAGAAAAAGCAAGAGAAGGAAGG - Intergenic
916332131 1:163628509-163628531 AGGAAGAGGAAGGAGAAGGAGGG - Intergenic
917416897 1:174819903-174819925 GGGAATAGGCAAGGGAAGGATGG + Intronic
920220346 1:204393941-204393963 AGGCATACAGATGAGAAAGAAGG + Intergenic
920235626 1:204501923-204501945 AGTAATTCTGATGAGAAGGAGGG + Intergenic
922133544 1:222802640-222802662 AGGAATACACAGGAAGAGGAAGG + Intergenic
922204667 1:223436056-223436078 AGGAAAAAGCAGGAGAAGGGAGG + Intergenic
922406505 1:225319604-225319626 AGAAACAAGCAAGAGAAGGAGGG + Intronic
923463524 1:234228213-234228235 AGGAATACACATGACCTGGAGGG - Intronic
1063069837 10:2649858-2649880 AGGGAAACCCATGAAAAGGATGG - Intergenic
1064276289 10:13908289-13908311 AGGAAAAAGGATGAGAAGCATGG - Intronic
1064341510 10:14489884-14489906 AGGAAAAGGAAAGAGAAGGAGGG + Intergenic
1064490796 10:15854276-15854298 TGGAAAAGGCATGAGAAGTATGG - Intronic
1064635240 10:17358589-17358611 AGGAAGAAGGAGGAGAAGGAGGG + Intronic
1066093273 10:32047510-32047532 AGGAAAAGGCATGAAATGGATGG - Intronic
1068878080 10:62018931-62018953 AAGAATACACATTAGAAAGATGG - Intronic
1068929898 10:62578861-62578883 AAGAATATGCAGGAGCAGGATGG + Intronic
1069124385 10:64611340-64611362 AAGAATAAGCATGAGAGGGATGG + Intergenic
1069718519 10:70535590-70535612 AGGAAGAGGAAGGAGAAGGAAGG - Intronic
1071536802 10:86440129-86440151 AGGAATTAGCATGGGAAAGATGG + Intronic
1072975024 10:100049997-100050019 AGAAATAAGAATGAGAAGTATGG + Intronic
1072986292 10:100143866-100143888 TGGAAGACGGATGAGAAGCATGG - Intergenic
1073373591 10:103012901-103012923 AGGAAAAGGAAAGAGAAGGAAGG - Intronic
1074721627 10:116270610-116270632 TGGAAAACCCATGAGGAGGACGG - Intronic
1076677761 10:132156285-132156307 AGCAATCAGCATGAGCAGGATGG - Intronic
1078850966 11:15163320-15163342 AGGGAAAAGAATGAGAAGGAAGG - Intronic
1079051886 11:17168029-17168051 AGGAATAAGGAAGAGAAAGAAGG + Intronic
1079754586 11:24240319-24240341 GGGAGCAAGCATGAGAAGGAGGG + Intergenic
1081094834 11:38920312-38920334 AGGAATAGGCTTCAGAAGGTGGG - Intergenic
1081368830 11:42272878-42272900 AGGAAAACGCATGGGCATGAAGG + Intergenic
1081732804 11:45383513-45383535 AGGAATACAGAAGTGAAGGAAGG - Intergenic
1082783318 11:57302930-57302952 TGGAAAAAGCATGGGAAGGAGGG - Intronic
1082952686 11:58834264-58834286 AAGAATACAGAGGAGAAGGAAGG + Exonic
1085045157 11:73348426-73348448 AGGGATACGCCTTAAAAGGAGGG + Intronic
1086433817 11:86762066-86762088 AGGGAGACGTATGAGAAGAAAGG + Intergenic
1087704029 11:101468453-101468475 TGGAATACAAATGACAAGGAGGG - Intronic
1088984404 11:114892819-114892841 AGAGATACTCAAGAGAAGGATGG - Intergenic
1089359250 11:117875446-117875468 AGGAATGGGCAGGAGAAAGAGGG + Intronic
1089836194 11:121372762-121372784 TGGAACATGCAGGAGAAGGAGGG + Intergenic
1091084852 11:132711827-132711849 AGGAATAGGGAAGAGAAGGGAGG - Intronic
1092109323 12:5947790-5947812 GAGAATACCCATGAGAAAGAAGG - Intergenic
1092481241 12:8860985-8861007 AGGAATACGCATGAGAAGGAGGG - Intronic
1092579471 12:9822456-9822478 AGGAAAAAGAATGAAAAGGAAGG + Intergenic
1094677900 12:32639054-32639076 AGGAATGAGCATGAGGAGAAGGG + Intronic
1095907306 12:47391508-47391530 AGGAAGAAGGATGAGAAGCAGGG + Intergenic
1099006299 12:77238316-77238338 AGAAATACAGATGAGAAGAAAGG - Intergenic
1099974812 12:89535336-89535358 AGTAATCCCCATGAGAATGAGGG + Intergenic
1100263398 12:92953691-92953713 AGGAATAGGGATGAGAAGAGAGG - Intergenic
1100759968 12:97796640-97796662 AGAAATAAGAATGAGAAGGGTGG - Intergenic
1100875119 12:98953593-98953615 AGGAATGTGCATGAGGTGGAGGG - Intronic
1103225893 12:119287522-119287544 AGGTACACATATGAGAAGGATGG - Intergenic
1103482558 12:121260371-121260393 TGGAATAGGCAGGAGACGGATGG + Intronic
1105500701 13:20969183-20969205 AAGAAAACTCAAGAGAAGGAAGG - Intergenic
1106940722 13:34776113-34776135 TGGAATATGCAAGAGAAGGCTGG + Intergenic
1107347730 13:39480617-39480639 AGGAGTCCCCATGAGAGGGAGGG - Intronic
1107684262 13:42880916-42880938 AGGGATAATTATGAGAAGGAAGG + Intergenic
1108260737 13:48653218-48653240 AGGTAAAAGCAAGAGAAGGAGGG + Intergenic
1108465838 13:50714700-50714722 GGGAAAACACATGAGAAGGGAGG - Intronic
1114986257 14:28232252-28232274 AGGAATAGTCATTAGAAGCATGG - Intergenic
1115380909 14:32737960-32737982 AGCAATACGTATGAGAAATATGG + Intronic
1117237794 14:53797034-53797056 AGAAATCAGCATGAGACGGAGGG - Intergenic
1117316155 14:54572557-54572579 TGGCATATGCAGGAGAAGGAAGG + Intronic
1120513380 14:85442208-85442230 AGGAATAAGCAAGAGCAGGAAGG + Intergenic
1123430948 15:20215944-20215966 AGGAATGGGCAGGAGAGGGAAGG + Intergenic
1125278929 15:38024221-38024243 AGGAAAAGGGATGAGAAGAAAGG + Intergenic
1129955488 15:79632863-79632885 AAGAACAGGCATGAGAAAGATGG + Intergenic
1130924674 15:88375960-88375982 AGGAATGAGGAAGAGAAGGAAGG - Intergenic
1131502217 15:92979464-92979486 AGGAAAACACATAAGAAGGGGGG - Intronic
1131527961 15:93167629-93167651 GGGAATCAGCAAGAGAAGGAAGG - Intergenic
1131565339 15:93480313-93480335 AGGAACAGGGATGAGAAGAAGGG - Intergenic
1131695385 15:94871654-94871676 AGGAATAACAATGAGAAGAAAGG - Intergenic
1134281175 16:12818468-12818490 AGGAAGAGGCAAGACAAGGAAGG + Intergenic
1136031709 16:27507862-27507884 AGTAACATGCATAAGAAGGAGGG + Intronic
1137379967 16:47988198-47988220 AGGAATACGCATAGGAAAGAAGG + Intergenic
1141022434 16:80510017-80510039 AGGAAGCCACGTGAGAAGGAAGG - Intergenic
1142682854 17:1560665-1560687 AGGAAAAAGAATCAGAAGGATGG + Intronic
1143164284 17:4890110-4890132 AGGGATCCGCAGGAGAATGAGGG - Intronic
1143325275 17:6094566-6094588 AGGAAAAGGAAGGAGAAGGAAGG + Intronic
1144336704 17:14277955-14277977 AGGAAGACACATGAGGAGGCAGG + Intergenic
1144942374 17:18950661-18950683 AGGACTAGGCAGAAGAAGGAAGG - Intronic
1145902138 17:28496145-28496167 AGGAACACGCCTGGGGAGGAAGG - Intronic
1146561616 17:33874907-33874929 AGGAATACTGCTGGGAAGGAGGG - Intronic
1148355168 17:46970763-46970785 AGGTACAAGCCTGAGAAGGATGG + Intronic
1154343014 18:13520015-13520037 ATGAATACACATGAAAAAGAGGG + Intronic
1157621155 18:49018169-49018191 AGGAAGACACAGGAGAAGGAAGG + Intergenic
1158146040 18:54313669-54313691 AGGAATACACATAAGCAGGGAGG - Intronic
1158767982 18:60478741-60478763 AGAAAGACACAAGAGAAGGAAGG + Intergenic
1159745921 18:72234496-72234518 TGGAATCCGGATGAGAAGGAAGG - Intergenic
1159904060 18:74074871-74074893 AGGAAGAGGCGGGAGAAGGAAGG - Intronic
1160135305 18:76266375-76266397 AGGAAGAGGAAGGAGAAGGAAGG + Intergenic
1160135317 18:76266420-76266442 AGGAAGAGGAAGGAGAAGGAAGG + Intergenic
1161273324 19:3402353-3402375 AGGAGGAGGCATGAAAAGGAAGG - Intronic
1163262139 19:16197837-16197859 AGGAATGCGCAGGCGCAGGACGG - Intronic
1164016274 19:21258477-21258499 AGGAACACACATTGGAAGGATGG + Intronic
1164849682 19:31471290-31471312 AGGAATATTCCTCAGAAGGACGG + Intergenic
1168384968 19:55955515-55955537 AAGAATACTCATGCCAAGGAAGG - Exonic
925943260 2:8839341-8839363 AAGAATAGAGATGAGAAGGAGGG + Intergenic
926221869 2:10941704-10941726 AGGGAAACCCAGGAGAAGGATGG + Intergenic
926266838 2:11330873-11330895 AGGAAGAGGAATGAGGAGGAGGG + Intronic
926656367 2:15411321-15411343 AGAAATACTCATGAGAAGGAGGG - Intronic
926913447 2:17872234-17872256 AGGAGTAGGCAAGAGAGGGAAGG - Intergenic
929038311 2:37718541-37718563 ATGAATACACATGAGAAGAAGGG - Intronic
930840943 2:55844653-55844675 AGGAAGAGGAAGGAGAAGGAGGG - Intergenic
934551721 2:95267007-95267029 AGGAATAGGCATGAGAAAGGAGG - Intergenic
935862479 2:107348146-107348168 AGGACTATTTATGAGAAGGAAGG + Intergenic
937719916 2:125082123-125082145 AGGAATAAGCAAGAGAAAAAGGG - Intergenic
937840228 2:126518054-126518076 CAGAACAAGCATGAGAAGGAAGG + Intergenic
939115655 2:138057366-138057388 AGGAAAAAGAAAGAGAAGGAAGG - Intergenic
940179678 2:150918420-150918442 AGGAAAAGGAAGGAGAAGGAAGG + Intergenic
940917095 2:159267716-159267738 ATGAATACGTATGGGAAAGAGGG - Intronic
941025306 2:160450015-160450037 AGGAATCTGCAAAAGAAGGAGGG - Intronic
943763586 2:191636183-191636205 AGGAATACCTTTCAGAAGGATGG - Intergenic
945930186 2:215847090-215847112 AGCAATAGCCATGAGAAGAAGGG - Intergenic
947402020 2:229740803-229740825 AGGAATCTGGATGAGAAGAATGG + Intergenic
948997928 2:241593428-241593450 ATGAATCCGCAGGAGAAAGATGG + Intronic
1169096765 20:2906576-2906598 AGGTATACTAATGAGAAGAATGG + Intronic
1169388645 20:5171729-5171751 AGGAATCCCCATGGGAAGGAGGG + Intronic
1175060104 20:56234123-56234145 AGCAATACTTATGGGAAGGAAGG - Intergenic
1176145019 20:63561725-63561747 AGGACTGCTCCTGAGAAGGATGG - Exonic
1179968498 21:44820062-44820084 AAGAAGACTCATGAGAAGGCAGG + Intergenic
1180762627 22:18221485-18221507 ACGACCACGCAGGAGAAGGAGGG + Intergenic
1180773040 22:18403123-18403145 ACGACCACGCAGGAGAAGGAGGG - Intergenic
1180804398 22:18652678-18652700 ACGACCACGCAGGAGAAGGAGGG - Intergenic
1180806355 22:18716738-18716760 ACGACCACGCAGGAGAAGGAGGG + Intergenic
1181217301 22:21342519-21342541 ACGACCACGCAGGAGAAGGAGGG + Intergenic
1182974464 22:34610116-34610138 AGGAATCCTCCTAAGAAGGAAGG - Intergenic
1203234874 22_KI270731v1_random:144111-144133 ACGACCACGCAGGAGAAGGAGGG - Intergenic
952438695 3:33300144-33300166 AGAAGTATGCATGAGAAGGGTGG - Intronic
952701731 3:36335831-36335853 AGGAAAAGGCATCACAAGGATGG - Intergenic
956698930 3:71941965-71941987 AGGAAAAGGTATGAAAAGGAAGG - Intergenic
960496562 3:118382740-118382762 AGGAAGAAAGATGAGAAGGAGGG + Intergenic
960910033 3:122640407-122640429 AGGAATAAGAAGGAGAAGAATGG - Intergenic
962883896 3:139605209-139605231 ATGAATAAGGATGAGGAGGAAGG - Intronic
963091704 3:141488001-141488023 AATTACACGCATGAGAAGGAAGG - Intronic
963932200 3:151015020-151015042 AGAAATACGCAGAAGAAGGCTGG - Intergenic
964445214 3:156751094-156751116 AGGAATGCGCATGAGAGTCATGG - Intergenic
964755689 3:160089152-160089174 AGGAATATGCAGGAGAACTAAGG - Intergenic
964960482 3:162417762-162417784 AGGAATTCTCTAGAGAAGGAGGG - Intergenic
964963605 3:162460714-162460736 AGGAAGAAGCATGAGAAAAAAGG + Intergenic
965594873 3:170400692-170400714 AGGAAGAAGAAAGAGAAGGAAGG - Intergenic
967552988 3:190821259-190821281 AGGCATGCACATTAGAAGGAAGG + Intergenic
967554864 3:190844858-190844880 AGGAATACAGAAGAAAAGGAGGG + Intergenic
967718105 3:192787221-192787243 AAGACTACGCATGGGAAAGAGGG - Intergenic
967968739 3:194984181-194984203 AGGAATCCTCAGGAGAAGGCTGG - Intergenic
968439859 4:617756-617778 AGAAGTACGCGTGAGAAGGGAGG - Intergenic
971849131 4:31960529-31960551 AGGTTCAAGCATGAGAAGGAAGG - Intergenic
971877889 4:32327936-32327958 AGGAAAAAGCATCACAAGGATGG + Intergenic
973110979 4:46397504-46397526 AGGAATGCTAATGAGAAAGAGGG - Intronic
974659385 4:64865861-64865883 AGGAATACGAAGGAAAAGGAAGG - Intergenic
975481807 4:74889315-74889337 AGGATTATGCATGAGAAAGCTGG + Intergenic
978419865 4:108519857-108519879 TGAAACACTCATGAGAAGGAGGG + Intergenic
983928940 4:173432422-173432444 AGGAAGAAGGAGGAGAAGGAAGG - Intergenic
986372787 5:7097615-7097637 AGGAATAAGCTTCAGAGGGAAGG - Intergenic
987032960 5:13992369-13992391 AGACATAAGAATGAGAAGGAAGG + Intergenic
992493715 5:77271086-77271108 GGGAAGAGGCATGAGAAGGGTGG - Intronic
993162289 5:84307840-84307862 AAGAATATGAATTAGAAGGAGGG + Intronic
994437669 5:99759617-99759639 AGGAATACAAATTACAAGGAAGG - Intergenic
997206771 5:132054778-132054800 AGGAAGAAGGATGAGGAGGAGGG + Intergenic
998361190 5:141589191-141589213 AAGAATAAGCATGAGAAAGAAGG + Intronic
998365620 5:141628908-141628930 GGGAATAGCCATGAGGAGGAGGG + Intronic
999413501 5:151374037-151374059 TGGACTAGGCCTGAGAAGGAAGG - Intergenic
1000497151 5:161998844-161998866 AGGAATACACAAGAGAATGAAGG - Intergenic
1001580392 5:172794248-172794270 AGGAGCACCCATGAGAAAGATGG + Intergenic
1002004967 5:176225013-176225035 AGGCAAAGGAATGAGAAGGAAGG + Intergenic
1007171022 6:39863608-39863630 AGGAACAGGAATGAGCAGGATGG + Intronic
1007242139 6:40433899-40433921 AGGAATCCCCTTCAGAAGGAAGG + Intronic
1011114315 6:83873925-83873947 AGGAAAAAGCATGCAAAGGATGG + Intronic
1013424945 6:110003160-110003182 AAGAATAAGCAGAAGAAGGAAGG + Intergenic
1013730918 6:113165849-113165871 AGGAATATGTATGAAAAAGAGGG + Intergenic
1016470303 6:144368474-144368496 AGGAATATACATGATAAGCATGG + Intronic
1016824321 6:148374282-148374304 AGGAATATGAATGGGAAGGAGGG + Intronic
1018226809 6:161636596-161636618 CGGAATGCCCATGGGAAGGATGG + Intronic
1020770987 7:12394369-12394391 AGGAAAACGAATGGGATGGAGGG + Intronic
1021042422 7:15878769-15878791 AAGAATACGCTTTAGAAAGATGG + Intergenic
1021494873 7:21263400-21263422 AGGAATAAACATTGGAAGGAGGG + Intergenic
1022423795 7:30248401-30248423 AGGAAGAGGGAAGAGAAGGAGGG + Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1023215604 7:37859307-37859329 AAGAATAAGCATTAGAAGGATGG - Intronic
1023279899 7:38558568-38558590 AGGAATAATGATGGGAAGGAGGG + Intronic
1024663396 7:51521003-51521025 AGGAATACAAATGAAAAGCAAGG - Intergenic
1028616455 7:92773352-92773374 AAGAAATGGCATGAGAAGGAAGG + Intronic
1029041356 7:97579936-97579958 AGAAATAGGCATGAGGAGAAAGG + Intergenic
1033026717 7:137781552-137781574 AGGAATACTGAGGAGAAAGAGGG + Intronic
1034184892 7:149168021-149168043 AGATATATGCATGATAAGGAAGG - Intronic
1036126605 8:6068653-6068675 AGGAATGAGGAGGAGAAGGAAGG - Intergenic
1037005115 8:13768476-13768498 TGAAATAAGCATGAGAATGAAGG + Intergenic
1037406496 8:18547984-18548006 AGGAAAAAGAATGAAAAGGAAGG - Intronic
1037452798 8:19033875-19033897 AGAAAGATACATGAGAAGGAAGG + Intronic
1040599006 8:48866033-48866055 AAGAATATGTAAGAGAAGGAAGG + Intergenic
1040904435 8:52451388-52451410 AGGAAAATGGATGAGTAGGAAGG + Intronic
1041250262 8:55927229-55927251 AGGAATAAACATGTGAAGAATGG - Intronic
1043691518 8:83159337-83159359 AGCAATACGCATGCCATGGAGGG + Intergenic
1043938293 8:86168005-86168027 AGGAAGAGGAATGAGAAGGAAGG + Intergenic
1045853366 8:106731274-106731296 AGGAATACAGATAGGAAGGAAGG - Intronic
1046137155 8:110042655-110042677 AGGAATATGGCTAAGAAGGAAGG - Intergenic
1046196335 8:110867410-110867432 AGGAAAATACATAAGAAGGATGG - Intergenic
1046558452 8:115806845-115806867 AGGAAGAAGAATAAGAAGGAAGG + Intronic
1048694395 8:137008904-137008926 CAGAATAAGCATGAGGAGGAAGG - Intergenic
1049103850 8:140598888-140598910 AGGAAAACGCATGGGGAGGCTGG - Intronic
1050398263 9:5223034-5223056 AGAAATAGGCATCAGAAGGTGGG + Intergenic
1051330270 9:16018098-16018120 AGGAAGACCCCTGAGAAGGCAGG + Intronic
1052055946 9:23907588-23907610 AGGAATCCTCATGAGAAAGTAGG + Intergenic
1055122385 9:72676739-72676761 AGAAATACGAATAAGAAAGAAGG - Intronic
1055573536 9:77641036-77641058 ACGAATTTGCATGGGAAGGAAGG + Intronic
1056593951 9:87989971-87989993 AGGCATACACATTAAAAGGAAGG - Intergenic
1057757983 9:97852714-97852736 AGGAATACTCATTCGAAAGATGG + Intergenic
1058472731 9:105297833-105297855 AGGAAAGGGCATGAGCAGGAGGG - Intronic
1059284785 9:113162993-113163015 AGGAATAGCCATCAGAAGAAAGG - Exonic
1187264586 X:17719142-17719164 AGGAATAATAAGGAGAAGGAAGG + Intronic
1187612104 X:20954230-20954252 AGGAGTACAGATGAGAAAGAGGG - Intergenic
1192561388 X:72130288-72130310 AGGAACAAGAATGAGGAGGAAGG - Exonic
1192956835 X:76080516-76080538 AGGAATACACATCGAAAGGAAGG + Intergenic
1195522199 X:105844226-105844248 AGGAACATACATGAGTAGGAAGG + Intronic
1198015409 X:132605339-132605361 GGGAAAAGGCATGAGAAGGGAGG + Intergenic
1198339400 X:135699484-135699506 AGGAATCTGAATGAGGAGGAAGG + Intergenic
1201278158 Y:12317500-12317522 AGGAACACACATTGGAAGGACGG + Intergenic