ID: 1092486003

View in Genome Browser
Species Human (GRCh38)
Location 12:8902533-8902555
Sequence CAAAATGCTGATAGCGATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092486003_1092486006 1 Left 1092486003 12:8902533-8902555 CCTATATCGCTATCAGCATTTTG No data
Right 1092486006 12:8902557-8902579 GCAAAGCCGTTCAAGTCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092486003 Original CRISPR CAAAATGCTGATAGCGATAT AGG (reversed) Intergenic
No off target data available for this crispr