ID: 1092486587

View in Genome Browser
Species Human (GRCh38)
Location 12:8907562-8907584
Sequence TCAGGCCCTTTCCCATACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092486587_1092486590 -8 Left 1092486587 12:8907562-8907584 CCACAGTATGGGAAAGGGCCTGA No data
Right 1092486590 12:8907577-8907599 GGGCCTGAGCAGAGGGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092486587 Original CRISPR TCAGGCCCTTTCCCATACTG TGG (reversed) Intergenic
No off target data available for this crispr