ID: 1092489135

View in Genome Browser
Species Human (GRCh38)
Location 12:8929377-8929399
Sequence CTGTGGATAAGGAGGTAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 7, 3: 34, 4: 348}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092489135 Original CRISPR CTGTGGATAAGGAGGTAGGA AGG (reversed) Intronic
900129580 1:1081695-1081717 CTGGGGGCAAGGAGGTGGGACGG - Intergenic
901508386 1:9701005-9701027 CTGCGGAGAAGCAGGGAGGAAGG - Intronic
901855038 1:12039139-12039161 CTGAGGACAGGGAGGGAGGAGGG + Intergenic
902879540 1:19362158-19362180 CTCTGGTCAAGGAGGTAGAAGGG + Intronic
903004499 1:20289750-20289772 GTGTGGAGAAGGAGGTAGGGTGG + Intergenic
903331812 1:22600470-22600492 CTGTGGAGACGAAGGAAGGAGGG - Intronic
903333979 1:22612854-22612876 CCGTGGAGAGGGAGGGAGGAGGG - Intergenic
904212901 1:28897543-28897565 CTGTAGGTAGGTAGGTAGGAAGG + Intronic
904563925 1:31415918-31415940 CTTTGGATGGGGAGGTAAGATGG + Intronic
904680292 1:32224285-32224307 TTCTGGATAAGGAGGTAAGAGGG + Intronic
904727202 1:32558337-32558359 CTGTAGATAAGAAGGAGGGAGGG - Intronic
904853023 1:33473245-33473267 CAGTGGGTAAGTAGGTAGGTAGG - Intronic
905278712 1:36835516-36835538 ATGTGGAGAAGGAAGGAGGAAGG - Intronic
905361074 1:37420836-37420858 CTGTGGATACTGAGGGATGATGG - Intergenic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
909920733 1:81377790-81377812 GTGGTGTTAAGGAGGTAGGATGG - Intronic
911269113 1:95778996-95779018 CTGTGAATAATGAGTTAGAAAGG - Intergenic
911609271 1:99943223-99943245 CTGTGGATGAGGTTGTAGAAGGG + Intergenic
912895500 1:113583632-113583654 CTGGGGATTAGGAGGTTCGAGGG - Intronic
913483499 1:119312302-119312324 CTGTGTAGAAAGGGGTAGGATGG + Intergenic
913524850 1:119681052-119681074 CTGTGGACAAGGAGATAGTGAGG + Intronic
914352820 1:146855077-146855099 CTGTGGTTAAGGAGGTGGTCAGG - Intergenic
914830180 1:151165431-151165453 TTGTGGATAAGTAGCTTGGAGGG - Exonic
915475450 1:156150258-156150280 CTCTGGGTAAGGGGTTAGGAGGG + Intronic
915735305 1:158080864-158080886 CTGTGGGTAAGCAGGTACGCAGG - Intronic
915950887 1:160189353-160189375 CTCTGGATACGTAGGAAGGAAGG - Intergenic
917835101 1:178935359-178935381 CTGTCTCTAAGGAAGTAGGATGG + Intergenic
918072203 1:181141356-181141378 ATGTACATAAGGAGGTATGAAGG + Intergenic
918333449 1:183482887-183482909 CTTGAGATAAGGAGGTAGAATGG + Intronic
918586335 1:186193204-186193226 CTGAGGATGAGAAGGGAGGAAGG + Intergenic
918626256 1:186659135-186659157 CTGAGGAGAAGGTGGTATGATGG - Intergenic
919977685 1:202623398-202623420 CTCTGGAGAAGGAGGTGGGAAGG - Intronic
920097623 1:203496848-203496870 CTGTGGAGGAGGAGGAGGGAAGG - Intronic
920502024 1:206491488-206491510 CTCTGGGAAAGGAGGAAGGACGG - Exonic
922447416 1:225709135-225709157 CTGTGAAGTAGGAGGTAGGGGGG + Intergenic
922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
1064004393 10:11688555-11688577 CTGTTGAAAGGAAGGTAGGAAGG - Intergenic
1065971366 10:30808549-30808571 CTGTGCAGAAGGAAGCAGGATGG + Intergenic
1067008688 10:42690543-42690565 CTTTGGAGCAGTAGGTAGGAGGG - Intergenic
1067514663 10:46927920-46927942 CTGAGGTTCAGGAGGTTGGAGGG + Intronic
1067647596 10:48123893-48123915 CTGAGGTTCAGGAGGTTGGAGGG - Intergenic
1067696930 10:48542537-48542559 CTGGGAATCAGGAGGCAGGAGGG - Intronic
1069726952 10:70586254-70586276 CTGAAGATGAGGAGGTGGGAGGG + Intergenic
1070847964 10:79539287-79539309 CTGTGGTTGGGGAGGAAGGAGGG + Intergenic
1071956711 10:90768294-90768316 CTGAGGATAATGGGTTAGGAAGG - Intronic
1073318152 10:102597323-102597345 CTGGGGAAAAGGAAGGAGGAAGG - Intronic
1073610096 10:104934691-104934713 CTGAGCATAAGGAGGCAGGCTGG - Intronic
1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG + Intergenic
1074288811 10:112122851-112122873 CTGTGTCTAAGGAGGTAGGAAGG + Intergenic
1075416686 10:122269470-122269492 CTGGAGATCAGGAGGTAGGGAGG - Intergenic
1076141289 10:128080398-128080420 CTGTGCATAGAGAGGCAGGAAGG + Intronic
1076827295 10:132975454-132975476 CTGAGGATAAGGAGGGGGTAAGG - Intergenic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1077517505 11:3010715-3010737 CAGTGGAGCAGGAGGCAGGAGGG - Intronic
1082063178 11:47877776-47877798 TTGTGGAGAAAGAGGAAGGAAGG - Intergenic
1082207454 11:49455155-49455177 CTGTAGCTAAGGAGGGAGGCAGG + Intergenic
1085046249 11:73355510-73355532 CTGTGGAGGAGGAGGCAGGTTGG - Intronic
1085064757 11:73484077-73484099 CTGAAGATAAGGAGGGAGGAAGG - Intronic
1085207360 11:74744038-74744060 ATGTGGATGAGGAGTGAGGAAGG + Intergenic
1085784024 11:79436099-79436121 AAGGGGATAAGGAGGTAGAAAGG + Intronic
1086260610 11:84935528-84935550 CTATGGAAAAGCAGGTAGGAGGG - Intronic
1086647820 11:89246602-89246624 CTGTAGCTAAGGAGGGAGGCAGG - Intronic
1087551368 11:99654469-99654491 CTGTGGAACAGGGGGTAGTATGG + Intronic
1087632153 11:100662520-100662542 CCGTGGATAAGGAGGGACTACGG - Intergenic
1088327657 11:108617283-108617305 GAGAGGATAAGGAGGGAGGATGG + Intergenic
1088329465 11:108635363-108635385 AGGTGGACAAGGAAGTAGGAGGG - Intergenic
1088519095 11:110675494-110675516 TTGTGGAGGAGGAGGAAGGATGG + Intronic
1088706849 11:112471567-112471589 CTGTGGTCAAGGAGGCAGTATGG - Intergenic
1089346121 11:117792857-117792879 CTGGGGATATTGGGGTAGGATGG - Intronic
1089404525 11:118186575-118186597 CTGTGGATAAGAAGGTTTGTAGG + Intergenic
1090719488 11:129458812-129458834 GAGTGGAAAAGGAGGCAGGAAGG - Intergenic
1091693629 12:2613269-2613291 CTGTGGAGAAGGGGGAAGGGAGG + Intronic
1091796911 12:3302756-3302778 CTGTGGATATGGAGGGCTGATGG + Intergenic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1093674910 12:21927329-21927351 ATGTGGATAAGGAAGTTGGTTGG + Intronic
1095190457 12:39251791-39251813 CTGTTGATTTGGAGGTATGAGGG - Intergenic
1097194423 12:57235810-57235832 CTGTGGAGCAGGAGGGGGGAGGG + Intronic
1097269576 12:57765802-57765824 CAAAGGATAAGGAGGTAGGCGGG + Intronic
1099078145 12:78138373-78138395 CTTTAAATAAGAAGGTAGGAAGG - Intronic
1100448966 12:94687093-94687115 CTGGGGATAAGGAAGGATGATGG + Intergenic
1101017803 12:100519766-100519788 CTGGGGATAGGGAGTTGGGAGGG + Intronic
1101708526 12:107243314-107243336 TTGAGGACAAGGAGGCAGGAAGG + Intergenic
1101842156 12:108335577-108335599 CTGTAAATAAGGAGGTCGAATGG - Intronic
1103037381 12:117667415-117667437 CTGGGGAGAAGGAGGTGGCATGG + Intronic
1103483875 12:121269484-121269506 CTGTGGATAAGGATGGGGGCAGG + Intronic
1104510010 12:129368711-129368733 CTGTTGGTAAGGAGGAAAGAGGG - Intronic
1104737365 12:131144327-131144349 ATGGGGAAAAGGAGGTATGAGGG - Intergenic
1104803285 12:131569347-131569369 CTGAGGAGAGGGAGGGAGGAGGG - Intergenic
1105767049 13:23570568-23570590 CTGTGGACTAGGAGGTGGGAGGG + Intronic
1106320614 13:28634442-28634464 TAGTGGAAAAGGAGGAAGGAAGG + Intergenic
1108441321 13:50456256-50456278 CAGTGGACAAGGAGGCTGGAGGG - Intronic
1109215751 13:59587894-59587916 CTTTGAAGCAGGAGGTAGGATGG - Intergenic
1113172156 13:107516971-107516993 CTGTGGATGAAGAGGTAGGATGG + Intronic
1114492273 14:23110661-23110683 ATGGGGATAAGGAGAGAGGATGG + Intergenic
1115290746 14:31769356-31769378 CTCTAGGTAAGGAGCTAGGAGGG - Intronic
1115512056 14:34147398-34147420 CTCCGGATAAGGAGGAGGGAAGG + Intronic
1115968479 14:38918325-38918347 CAGAGGAAAAGGAGGAAGGAAGG + Intergenic
1117029121 14:51651533-51651555 CTGTGGAGACGGAGGTGCGAGGG - Intronic
1117831136 14:59752070-59752092 GTGTGGATGTGGAGGTTGGAAGG - Intronic
1118603701 14:67488158-67488180 CTGTGGATGACCAGGCAGGATGG + Intronic
1118837238 14:69485606-69485628 CTCAGGCTAAGGAGGGAGGAAGG + Intronic
1119635476 14:76269848-76269870 TTGTGGAGAGGGAGGAAGGAGGG - Intergenic
1119684837 14:76623352-76623374 ATGTGGAGAAGAAGGGAGGAGGG - Intergenic
1120144010 14:80959480-80959502 CTCTGAATAAGGAGGTAGAAAGG + Intronic
1120265480 14:82244124-82244146 GTGTGGATTTGGAGGAAGGATGG - Intergenic
1120342943 14:83245147-83245169 CTGTGGGTAAGAAGATAGCAAGG + Intergenic
1120681840 14:87489410-87489432 CTGTAGAAAAGGAGGAAGAAAGG + Intergenic
1121471473 14:94158053-94158075 CTCTGGATCAAGATGTAGGAGGG + Intronic
1121577277 14:94998424-94998446 ATTTGGAGAAGGAAGTAGGAGGG + Intergenic
1122376251 14:101261074-101261096 CTGTGGATAAAGGGGGATGATGG + Intergenic
1122847621 14:104509337-104509359 CTTTGGATAAATAGCTAGGAGGG - Intronic
1123010672 14:105348183-105348205 CTGTGGACAGGCAGGTAGGAGGG - Intronic
1123677822 15:22729222-22729244 CTGAGGAAGAGGAGGAAGGAGGG + Intergenic
1124493333 15:30171762-30171784 CTCTGGAGAAGGAGGTGGGAAGG - Intergenic
1124702340 15:31927086-31927108 GGGTAGATAAGGAGATAGGATGG - Intergenic
1124750201 15:32366563-32366585 CTCTGGAGAAGGAGGTGGGAAGG + Intergenic
1125722936 15:41853752-41853774 CTATGGAGAAGGAGGTGGCACGG - Exonic
1127003690 15:54541109-54541131 CTCTGGATAAAGAGGAAGGTTGG - Intronic
1128726238 15:69990618-69990640 CTGTGCATGAGGAGCTGGGATGG + Intergenic
1128846424 15:70901105-70901127 CTGGGGAACAGGAGGAAGGAGGG - Intronic
1130137906 15:81197124-81197146 CTGTGCATAGGGAGGTAGGTGGG + Intronic
1132070422 15:98771881-98771903 CAGTGGAGAAGAAGGAAGGAGGG - Intronic
1132240084 15:100251154-100251176 CTGGGGATCAGGAGATAGGCTGG + Intronic
1133319580 16:4904656-4904678 CTGTGGATAGGGAGGAAACAGGG + Intronic
1133837313 16:9378517-9378539 CTGTGGATAAAGAGTTAACAAGG + Intergenic
1134043433 16:11084829-11084851 CTGTGGAGAAAGAGGTAGCCGGG + Intronic
1135818782 16:25660455-25660477 TTGTGGAGTAGGAGGTTGGAAGG - Intergenic
1136418419 16:30117286-30117308 CTGTGGATAAGGAGGTGACTTGG + Intronic
1137262206 16:46840766-46840788 CTGTGGAGAAGTACGTTGGATGG - Intergenic
1137520388 16:49190198-49190220 CTGTGGATGAAGAGTTAGGCAGG - Intergenic
1138021445 16:53485749-53485771 CGGAGGATAAGGTGGAAGGATGG + Intronic
1138155269 16:54697065-54697087 CTGGAGATAAGGAGGTAAGGAGG + Intergenic
1138272575 16:55706348-55706370 CTATGGAAAAGGAGATTGGAAGG + Intergenic
1138637423 16:58352191-58352213 GAGTGGAGAAGGAGGTTGGATGG - Intronic
1139475084 16:67199098-67199120 CTGGGGGTAGGAAGGTAGGACGG - Exonic
1139592379 16:67940479-67940501 CTGTGGATATGGAGCAAGGTGGG + Intronic
1139645525 16:68326836-68326858 CTGAGGAGAAGGAGGTGTGAAGG + Intronic
1139771364 16:69280250-69280272 CTGTGTATAAAGAGGTAGACAGG - Intronic
1139981206 16:70860441-70860463 CTGTGGTTAAGGAGGTGGTCAGG + Intronic
1140107379 16:71973176-71973198 CTGGGCAAAAGGAGGGAGGAGGG - Intronic
1140751299 16:78026446-78026468 CTGTGCAGAAGCAGGTAAGAGGG + Intronic
1141433354 16:83982436-83982458 CGGTGGATTAGAAGGTAGCATGG + Intronic
1141458868 16:84164418-84164440 TTGGGGCTGAGGAGGTAGGAGGG - Intronic
1141489540 16:84362884-84362906 CTGTGGGTACGGCGGGAGGACGG - Intergenic
1141651435 16:85395119-85395141 CTGAGGATGAGGAGGAAGGATGG + Intergenic
1141821534 16:86449533-86449555 CTGTGGCCAAGGAGGAGGGACGG + Intergenic
1141873741 16:86807166-86807188 CTGTTGACAAGGAGGCTGGAAGG + Intergenic
1141954121 16:87358807-87358829 CTGGGGCTCAGGAGGTGGGAGGG + Intronic
1142269368 16:89081205-89081227 CTGTGGAGGAGCAGGTGGGAGGG + Intergenic
1142652562 17:1364822-1364844 CTGTGGATAAGGGGGGATGATGG + Intronic
1143861862 17:9897127-9897149 CTGTGGAGTTGGAAGTAGGAGGG - Exonic
1144297364 17:13888884-13888906 TTGTGGAGATGGAGGGAGGAGGG + Intergenic
1146175476 17:30663650-30663672 CTGTGGATAAGGATGGAGGGAGG - Intergenic
1146348927 17:32079696-32079718 CTGTGGATAAGGATGGAGGGAGG - Intergenic
1146462460 17:33057025-33057047 GTGTGTTTAAGGAGGTGGGAAGG + Intronic
1147141788 17:38464571-38464593 CTGGGGAGAGGGAGGAAGGAGGG + Intronic
1148046398 17:44747637-44747659 CTGAGGATAAGGGGAAAGGAAGG - Intronic
1148482617 17:47970079-47970101 CTGGGGACAAGGAGGCTGGAAGG - Intronic
1148571982 17:48677685-48677707 CTGTGAAAAAGGAGGGAGGGAGG - Intergenic
1148749088 17:49934564-49934586 CTGTGGTGGAGCAGGTAGGAAGG + Intergenic
1148861382 17:50606049-50606071 CTGTGGTGAAGGAGGCTGGAGGG + Intronic
1149725863 17:58893675-58893697 CTGTCGATAGGGAGGGAGGCTGG + Intronic
1149806240 17:59620201-59620223 CTGTGGAGAAGGTGGTAGGAAGG + Intronic
1150652917 17:67021613-67021635 CTGTGGAAGAGAAGGTAGGCAGG - Intronic
1151413857 17:73948754-73948776 CAGTGGCCAGGGAGGTAGGAGGG + Intergenic
1151733058 17:75922242-75922264 CTGTGGACATTGAGGCAGGAAGG - Intronic
1151774895 17:76193896-76193918 CTGTGGATGTGGAGGTGGGAGGG - Intronic
1153273754 18:3348592-3348614 CAGGGTATAATGAGGTAGGAAGG - Intergenic
1153439875 18:5104479-5104501 CTCTGGGGAAGGTGGTAGGAAGG - Intergenic
1156435427 18:37122714-37122736 CTGTGAATCAGGAGGTGAGATGG + Intronic
1156593626 18:38520402-38520424 CTGTGTTAAAGGAGATAGGAAGG + Intergenic
1156696919 18:39778586-39778608 CTGGGGAGAAGGAGATAGAAGGG + Intergenic
1157443197 18:47725720-47725742 ATGTGTATAAGGAGGCTGGAGGG - Intergenic
1157928732 18:51795474-51795496 CTGTGGATAAGGGGGAACTATGG - Intergenic
1157998474 18:52587863-52587885 CTGGGGATGAGAAGGTAGGGTGG + Intronic
1158388405 18:57021132-57021154 CTGAGAATAAGGTGGTGGGAAGG + Intronic
1159217017 18:65405629-65405651 GAGGGGAGAAGGAGGTAGGAGGG + Intergenic
1159267262 18:66098427-66098449 TTCTGGAAAAGGAAGTAGGAAGG - Intergenic
1160174517 18:76581639-76581661 GTGTGCATGAGGAGGGAGGAAGG - Intergenic
1160229876 18:77039746-77039768 CTGTGAATCAAGTGGTAGGAAGG + Intronic
1160606675 18:80056739-80056761 CTTTGGATACTGAGGCAGGAAGG - Intronic
1161391822 19:4025117-4025139 CCGTGGATAGTGAGGTGGGATGG + Intronic
1161790713 19:6358177-6358199 CTGGGATTGAGGAGGTAGGAGGG - Intergenic
1162983490 19:14254261-14254283 CTGTGGATAAGGATGGAGGGAGG + Intergenic
1164592189 19:29513121-29513143 GGGGGGATAAGGAGGAAGGAGGG + Intergenic
1165258777 19:34596246-34596268 CTGTGGCTGAGCAGGGAGGATGG + Exonic
1165427300 19:35753240-35753262 CTGAGGATGAGGAGGTGGGATGG + Exonic
1165864053 19:38925338-38925360 CTGTGGGGAAGGAGGAAGAAGGG - Intronic
1165920981 19:39297817-39297839 CTGGGGAGAAGGAGACAGGAGGG - Intronic
1166334095 19:42095201-42095223 CTGTGGACAACCAGGTAGGGTGG + Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1168375614 19:55876866-55876888 CTGTGGATATGGAGGACTGACGG + Intronic
925082165 2:1078843-1078865 CTGAGGGTCAGGAGGGAGGAAGG + Intronic
926339697 2:11894846-11894868 CTGAGGGTAAGGAGGTGGGAAGG + Intergenic
926902115 2:17763519-17763541 CAGTGGATTAGGAGGAAGCAGGG - Intronic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
933692955 2:85193987-85194009 CTGTGGCTGAGGTGGTAGGAGGG + Intronic
933725136 2:85422528-85422550 CTGGGGATGGGGAGGTAGGAGGG + Intronic
934126235 2:88893701-88893723 CTGTGGAAAAGGAAGTAAGAGGG + Intergenic
934655774 2:96116328-96116350 CGGTGGAGGAGGATGTAGGAGGG - Intergenic
934713396 2:96529725-96529747 CTCTGGACATGGAGGTAGGTTGG - Intergenic
934762801 2:96865633-96865655 CTGGGGACACCGAGGTAGGAGGG + Intronic
938557106 2:132435292-132435314 CTGAGGAGAACGAGGAAGGAGGG - Intronic
939548022 2:143577727-143577749 CTGTGGCTAAGGAAATAGAATGG + Intronic
939618010 2:144381906-144381928 CTGTGGGTAGAGAGGTTGGATGG + Intergenic
940191668 2:151047117-151047139 CTGTGGAGCAGCAGGTGGGATGG - Intronic
940301890 2:152184337-152184359 CTGGGGATGGGGAGGTAGGTAGG - Intergenic
940683032 2:156810036-156810058 CTGTGGATAAGGAGGACATACGG - Intergenic
941796333 2:169602966-169602988 GTTTGGATAATGAGGTATGAGGG + Intronic
942214747 2:173707681-173707703 GTGTGGATAATGAGGGAGAATGG + Intergenic
942656366 2:178218200-178218222 CTTTTGAAAAGGAGGTTGGAAGG + Intronic
942876385 2:180804785-180804807 CTCTGGCTAAGGAGGAAGAAAGG + Intergenic
943600793 2:189918931-189918953 CTGTGGATAAGGGGGGACTATGG - Intronic
944522768 2:200588285-200588307 GTGTGCTTAAGGAGGTAGGTTGG + Intronic
945606132 2:211934556-211934578 TTGTGGATGAGGTGGAAGGAAGG - Intronic
947414066 2:229875184-229875206 CTGTGGATAGTGATGAAGGATGG + Intronic
947878094 2:233480915-233480937 CTGCGGGTGAGGAGGAAGGAGGG + Intronic
948645787 2:239403041-239403063 CTGTGTATAAGGAGAAAGGTGGG + Intergenic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1169264717 20:4160895-4160917 CTGTGGCTCAGGAGGCAGGATGG + Intronic
1169468228 20:5860143-5860165 CTGCGGGTAAGAAGGTAGGAAGG + Intronic
1169630733 20:7627827-7627849 CTATGGCTAAGAAGGTAGAACGG + Intergenic
1170227577 20:14008941-14008963 CTGTGTATAAGGTGTAAGGAAGG - Intronic
1170367484 20:15613789-15613811 CTGTTGAAAAGAATGTAGGAGGG + Intronic
1170436289 20:16333087-16333109 ATGTGGGCAAAGAGGTAGGAAGG - Intronic
1171294349 20:24004601-24004623 CAGTGGATAAGGAGATAACAGGG - Intergenic
1171394095 20:24819867-24819889 CTGTGGGTAAGGAATTTGGAAGG - Intergenic
1172480655 20:35269499-35269521 GTGTGGAAAAGGAGGTGTGAGGG - Intronic
1172780484 20:37433919-37433941 CTGGGGACCAGGAGGTAGGGTGG - Intergenic
1173980086 20:47217125-47217147 AGCTGGGTAAGGAGGTAGGAAGG + Intronic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1174128798 20:48327440-48327462 CTGAGGATGAGGAGATAAGAAGG - Intergenic
1174978131 20:55358193-55358215 ATGTGGGTAATGAAGTAGGATGG - Intergenic
1175238116 20:57526692-57526714 GAATGGATAAGGAGGGAGGAGGG + Intergenic
1176613796 21:9011034-9011056 CTGTGGAAGGGGAGGTGGGAAGG + Intergenic
1178417462 21:32415367-32415389 CTGTGAAGGAGGAGGGAGGATGG + Intronic
1179923088 21:44517763-44517785 CTGGATATCAGGAGGTAGGAGGG - Exonic
1181161164 22:20960748-20960770 GTGTGGGCAAGGAGGTAAGATGG - Intergenic
1181177019 22:21043714-21043736 CTGTGGATAAGCTGGGTGGAGGG + Intergenic
1182281150 22:29218398-29218420 CTGTGGAGAAGGGGCTAGAATGG + Intronic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1182704383 22:32267292-32267314 ATGTGAATAAGGTGGGAGGAGGG + Intergenic
1184745124 22:46451650-46451672 TTGTGGAGAAGGAGGTTGTAGGG - Intronic
1185149048 22:49153921-49153943 GTGTGGGTAAGGTGGGAGGAGGG + Intergenic
1185258599 22:49849555-49849577 CTGCGGAGAGGGAGGAAGGAAGG + Intergenic
950474442 3:13206706-13206728 CTGTGGGAAAGGAGGCAGGTGGG + Intergenic
950825059 3:15809964-15809986 TTGTGGATGAGGAGGTGGGAGGG - Intronic
952944194 3:38466199-38466221 CAGAGGCTAAGGAGGTAGGTAGG + Intronic
953721539 3:45360130-45360152 CTTTGAAGAATGAGGTAGGAAGG + Intergenic
954758932 3:52860353-52860375 CTGTCAATGAGGAGGTATGAAGG + Intronic
954899771 3:54008818-54008840 CTGTGGGTAGGGAAGTAGCAGGG - Intergenic
955400030 3:58585106-58585128 CTGCGGGTAAGGAGCCAGGAAGG - Intronic
956339359 3:68204418-68204440 CTGTGGACAAAGGGGTTGGAAGG - Intronic
956754067 3:72368167-72368189 CTGTGGAGTGCGAGGTAGGAAGG + Intergenic
957143583 3:76393611-76393633 CTGTAGATAATGAGGAAGGAAGG + Intronic
957153416 3:76516286-76516308 GTGTGGGTATGGAGGTAGGATGG - Intronic
961243473 3:125432231-125432253 CTGTGGGCAAGGAGGTGTGAGGG - Intergenic
962234091 3:133693150-133693172 CTAGGGATAAGGAGGAAGGTGGG - Intergenic
962654964 3:137533715-137533737 CTATGGATAGGGAGGTAGTGAGG + Intergenic
962861741 3:139409555-139409577 CTGTGTATAAGGTGTAAGGAAGG - Intergenic
963065789 3:141263236-141263258 CTGTGGAAGTGGAGGTAGTAAGG + Intronic
963961119 3:151310259-151310281 CTGGGGAGAAGGAGGCAGAAAGG + Intronic
965338307 3:167455425-167455447 CTGGGGATAAGGGGAAAGGAAGG - Intronic
965912319 3:173794092-173794114 CTGGGTATGAGGAGGTAGGGTGG - Intronic
966431088 3:179832367-179832389 GGGTGGATAAGTAGGTAGGTTGG - Intronic
968466181 4:752568-752590 TTGTGGATAAGGAGTGAGGTGGG + Intronic
968538263 4:1148783-1148805 CTGTGGAGACTGAGGCAGGAGGG - Intergenic
970123806 4:12787147-12787169 CAGAGGGTAAGGAGGGAGGATGG - Intergenic
971059265 4:22949092-22949114 CTGAGTATAAGGAGGTAAAAAGG - Intergenic
971739018 4:30497056-30497078 CTCTGGATAAGGAAATAGAATGG + Intergenic
973661523 4:53112063-53112085 CTGTGGATACAGAGCTAGGCCGG + Intronic
974123858 4:57671696-57671718 CTGTGGAGAAGGAGGCATGTAGG + Intergenic
974543287 4:63267135-63267157 TTTTGTATAAGGAGGAAGGAAGG - Intergenic
975652772 4:76610987-76611009 CTGTGGATAGGGATGGGGGAGGG + Intronic
976231138 4:82844393-82844415 CTGTGGATAAGGTGGTACCTGGG + Exonic
977700079 4:100011926-100011948 CTGTGATTGAGGTGGTAGGAGGG - Intergenic
978910135 4:114052672-114052694 AAGTGGATAAGGAGGTAATAGGG - Intergenic
981013493 4:139950502-139950524 CTGTGAAAAAGGTGATAGGAGGG - Intronic
981044637 4:140253466-140253488 GTGGGGATAAGGAGGAAGGAGGG + Intergenic
981681779 4:147407835-147407857 CTGTGGTTTAGGAGGTGGGGAGG - Intergenic
982776234 4:159444367-159444389 GTGTGGATAAGATGGTGGGAGGG + Intergenic
983472801 4:168177129-168177151 GTGGGGAGAAGGAGGTAGGGAGG - Intronic
983519549 4:168693010-168693032 ATTTGGATGAGGAGGGAGGAAGG + Intronic
985901291 5:2796729-2796751 CTGTGGGTCAGGATTTAGGATGG + Intergenic
988678391 5:33458065-33458087 ATGTTGGCAAGGAGGTAGGAGGG + Intronic
989520393 5:42393969-42393991 CTTTGCACAAGGAGGTGGGAGGG + Intergenic
992554011 5:77885621-77885643 CTGTGGCTCAGGACCTAGGAGGG - Intergenic
993390139 5:87310520-87310542 CTTTGCATAAAGAAGTAGGAAGG + Intronic
993588186 5:89759095-89759117 ATTTGGATGAGGAGGTGGGAAGG - Intergenic
994501402 5:100583187-100583209 CTGAAGAGAAGGAGGAAGGAGGG + Intronic
995114249 5:108461232-108461254 CTGGAGAAAAGCAGGTAGGAGGG - Intergenic
995378677 5:111507993-111508015 CTGTAGACAATGAGGTATGATGG - Intronic
996022872 5:118611119-118611141 CTTGGGATTAGGAGGCAGGAGGG - Intergenic
996777794 5:127151681-127151703 CAGAGGATAAGGAGGAAGAAAGG - Intergenic
998458029 5:142288847-142288869 TTGTGGAGAAGGAGGGAGGCTGG - Intergenic
999315700 5:150582554-150582576 CTGAGGAGAAGGAGGTAGAGAGG - Intergenic
1002273191 5:178086389-178086411 CTGGAGATGAGGAGGTAGGCGGG + Intergenic
1003039811 6:2677356-2677378 CTGTGGATCAACAGGTAGAAGGG - Intronic
1004381604 6:15137551-15137573 CTGTTCTTAAGGAGGTAGGGAGG - Intergenic
1004814292 6:19295865-19295887 CTGTGGCTAATGAGATATGAAGG + Intergenic
1004845177 6:19633896-19633918 GTGTGGAAAGGGAGGTGGGATGG + Intergenic
1005332614 6:24764410-24764432 CTGTGGAGAAGGAGGTAAGAGGG - Intergenic
1006187325 6:32188860-32188882 CTGAGAACAAGGAGGGAGGAGGG + Intronic
1006683594 6:35814529-35814551 CTGTGGCTGAGGGGGAAGGAGGG - Exonic
1006741354 6:36311304-36311326 CTGAGGATAAGGGTGTGGGAGGG + Intergenic
1007176803 6:39902737-39902759 CTGTGGATTAGTAGACAGGATGG - Exonic
1007533627 6:42564654-42564676 CTGGGGGAAAGGAGGTATGATGG - Intronic
1007549929 6:42721506-42721528 CATTGGCTAAGGTGGTAGGAAGG - Intronic
1007825413 6:44596191-44596213 CTAAGGATATGGAGGGAGGAAGG - Intergenic
1007958023 6:45934628-45934650 CTGCGCAAAAGGAGGTTGGATGG + Intronic
1008611520 6:53188621-53188643 CTGTGGATAAGGGAGCGGGAGGG + Intergenic
1008770163 6:54968600-54968622 CTGTTGATTAGAAGGCAGGAGGG + Intergenic
1010333827 6:74657360-74657382 ATGTGGAGATGGTGGTAGGAAGG + Intergenic
1011157731 6:84352026-84352048 CTGTGGAAAGGAAGGGAGGAAGG + Intergenic
1011449321 6:87476042-87476064 CTGGGAATAAGGAAGTATGAGGG + Intronic
1011519923 6:88194258-88194280 CTCTGGATAAGGAGGTCGGTGGG + Intergenic
1012442129 6:99270541-99270563 CAGTGGAGAAGGAGGTAGCCAGG + Intergenic
1012546798 6:100428997-100429019 CTGTGGATAAGGGGGGACTATGG + Intronic
1012868381 6:104644814-104644836 CTGAGGACACGGAGGTAGCAAGG - Intergenic
1014820393 6:125982791-125982813 CTGAGGAAAAGGAGGATGGATGG - Intergenic
1015095225 6:129407959-129407981 CTGTTGACTTGGAGGTAGGAGGG + Intronic
1016192134 6:141282539-141282561 CTGTGTAAAAGGAGATGGGATGG - Intergenic
1016400545 6:143675533-143675555 CTGGGGGTGAGGAGGCAGGAGGG - Intronic
1016521458 6:144951341-144951363 CTGTGGATACTGAGGGATGATGG - Intergenic
1018027340 6:159816465-159816487 CTGTGGATGGTGAGCTAGGATGG + Intronic
1019868142 7:3732170-3732192 CTGTGTTGAAGTAGGTAGGAAGG + Intronic
1020255843 7:6502873-6502895 CTGTGGACAAGAAGGTGGGTAGG + Intronic
1022540328 7:31128957-31128979 CTGTGGAGAAAAAGGGAGGAGGG - Intergenic
1023018576 7:35989140-35989162 GGGTGTATGAGGAGGTAGGAAGG - Intergenic
1023708199 7:42964465-42964487 CTGTAGATAATGAGGTAACAGGG + Intergenic
1024019183 7:45349481-45349503 CTGTGGAGGAGGAGGTTTGAAGG + Intergenic
1024435743 7:49352965-49352987 CTCTGGATCAGTAGATAGGATGG + Intergenic
1027024565 7:74841570-74841592 GTGTGGATGAGGGGGAAGGATGG - Intronic
1027063200 7:75102552-75102574 GTGTGGATGAGGGGGAAGGATGG + Intronic
1029160541 7:98548631-98548653 ATGTAGATAAGTAGGTAGGCAGG - Intergenic
1029188456 7:98755579-98755601 CTGTAGTTCAGGAGGAAGGAGGG + Intergenic
1029282456 7:99444879-99444901 CCGGGGAGAAGGAGGTGGGAGGG - Intronic
1029601093 7:101563885-101563907 CTGTGGAGAGGGAGGAGGGAAGG - Intergenic
1030235994 7:107262715-107262737 CTGAGAATAAGGAGGAGGGAAGG - Intronic
1032704205 7:134408090-134408112 AAGTGGATAAGGAGGTAGGTAGG + Intergenic
1032883876 7:136116875-136116897 CTGTGGCTGAAGAGGAAGGAGGG - Intergenic
1033017105 7:137682556-137682578 CTGTGGATTGGGAGGAAGAAGGG - Intronic
1034478954 7:151305094-151305116 TGGCGGATGAGGAGGTAGGAGGG - Intergenic
1034480567 7:151317220-151317242 GTGGGGGTAAGGAGGTCGGATGG + Intergenic
1036644352 8:10602441-10602463 CTGTGGACACGGGGGCAGGAGGG + Intergenic
1037315885 8:17599084-17599106 ATGTGGATAAAGAGGGAGAAGGG - Intronic
1037596179 8:20356220-20356242 CTGGGGAGGAGGATGTAGGAGGG - Intergenic
1037868869 8:22472455-22472477 CAGTGGATAAAGATGTAGGGGGG - Intronic
1037877311 8:22554429-22554451 CTGTGGGGAAGGAGGAAGGAAGG - Intronic
1037961155 8:23099315-23099337 CTGGGGATGAGGAGGTAGGGAGG - Intronic
1038431591 8:27504691-27504713 CTGTTGTCAAGGAGGAAGGAGGG + Intronic
1040482281 8:47836965-47836987 CTGTGGATTGGGAGGAATGAGGG + Intronic
1041237958 8:55823779-55823801 CTGGGGAGGAGGAGGAAGGAAGG + Intronic
1041315563 8:56558521-56558543 CTCTAGATTAGGAGGTAGGTGGG - Intergenic
1046955576 8:120059785-120059807 CTGTTCATAAGGCGGCAGGAGGG - Intronic
1047495215 8:125404253-125404275 TTGTTGATAAGAAGGAAGGAAGG - Intergenic
1047512070 8:125523019-125523041 CTGTGGGTAAGGATCTAGTATGG - Intergenic
1047619176 8:126588863-126588885 GTGTGGACAAGGAGGAACGAGGG - Intergenic
1050991964 9:12167032-12167054 CTCTGGATCAGAAGGCAGGATGG + Intergenic
1051189865 9:14500052-14500074 ATGTGGCTAAAGAGGTAGGCAGG - Intergenic
1053073953 9:35116831-35116853 GTGTTGATATGGAGTTAGGAGGG + Intergenic
1053118033 9:35522592-35522614 CTGTGTATAAGGAGCTATGCTGG - Intronic
1053596499 9:39566998-39567020 CTGTGGAGCAGCAGGAAGGAAGG - Intergenic
1053854464 9:42323638-42323660 CTGTGGAGCAGCAGGAAGGAAGG - Intergenic
1054569760 9:66798020-66798042 CTGTGGAGCAGCAGGAAGGAAGG + Intergenic
1056009635 9:82313694-82313716 ATGTGCATAAGGAGGGAGCAGGG + Intergenic
1056238994 9:84624682-84624704 CTGTGTATTTGGAGGAAGGAGGG - Intergenic
1056245909 9:84695125-84695147 CTATCTATAAGGAGGGAGGATGG + Intronic
1058011365 9:99981154-99981176 TTGTGAATAAGAAAGTAGGATGG - Exonic
1058879094 9:109271240-109271262 CTGTGGCTGAGCAGGAAGGATGG - Intronic
1059268613 9:113059147-113059169 CTTTGGAGAAGGAGGTGGAAGGG - Intergenic
1059269665 9:113063930-113063952 CTTTGGAGAAGGAGGTGGAAGGG - Intergenic
1059270799 9:113069378-113069400 CTTTGGAGAAGGAGGTGGAAGGG - Intergenic
1059271933 9:113074825-113074847 CTTTGGAGAAGGAGGTGGAAGGG - Intergenic
1059273067 9:113080272-113080294 CTTTGGAGAAGGAGGTGGAAGGG - Intergenic
1059274203 9:113085714-113085736 CTTTGGAGAAGGAGGTGGAAGGG - Intergenic
1060006357 9:120003539-120003561 CTCTGGATTAGGAAGTGGGAAGG - Intergenic
1060676576 9:125520740-125520762 CTTTGGAGGAAGAGGTAGGATGG - Intronic
1061332525 9:129904716-129904738 CTGTGGGAAAGAAGGCAGGAAGG - Intronic
1061489010 9:130934832-130934854 GTGTGGCTGAGGAGGTAGAATGG - Intronic
1185746614 X:2578441-2578463 ATGTGGATTTGGAGCTAGGAGGG - Intergenic
1186050759 X:5592418-5592440 CCGTGGATAAGGGGGAACGACGG + Intergenic
1186693701 X:12006649-12006671 CTGTGGAGAAGGAGGGAGTCTGG - Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1190014721 X:46817133-46817155 CTGTGGACAGGAAGGCAGGAAGG + Intergenic
1191724328 X:64263183-64263205 TTGTGGAGAAGGAGGTGGGAAGG - Intergenic
1191800836 X:65077479-65077501 TTGTGGATCAGGAGTTAAGATGG + Intergenic
1194536258 X:95108532-95108554 CTGATGATGAGGAGGAAGGAGGG - Intergenic
1196138256 X:112232966-112232988 CTGTTCATAAGGCAGTAGGAAGG + Intergenic