ID: 1092491379

View in Genome Browser
Species Human (GRCh38)
Location 12:8949057-8949079
Sequence CACCCTGGGAGAGCTTTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 163}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092491379 Original CRISPR CACCCTGGGAGAGCTTTGAG GGG (reversed) Intronic
900759755 1:4462905-4462927 CACCCTGGCAGAGGGTTGAGTGG + Intergenic
901681065 1:10913119-10913141 CAACCTGGAAGTGCTTAGAGAGG - Intergenic
902728827 1:18355128-18355150 CACCCTGGGAGAAGTGGGAGCGG + Intronic
904251085 1:29224868-29224890 CACCCTGGGTGAGGTGGGAGGGG - Intronic
904257681 1:29266515-29266537 CACTTTGGGAGACCCTTGAGTGG + Intronic
904390131 1:30179362-30179384 CAGCCAGGGAGAGCTGTGAGAGG - Intergenic
904671220 1:32167150-32167172 CAGCCTGAGAGAGAATTGAGAGG - Exonic
906535419 1:46548545-46548567 GACCCTGGGAGAGATGGGAGAGG + Intronic
906815337 1:48873029-48873051 GAAACTGGGAGAGCTTTAAGAGG - Intronic
909468497 1:76000991-76001013 CAACCTGTGAGAGTTCTGAGTGG - Intergenic
911184090 1:94886297-94886319 CAGCCTGGGAGAGCTTCCAGAGG + Intronic
916138691 1:161675247-161675269 TATCCTGGGAGAGCTGGGAGGGG - Exonic
916930723 1:169575761-169575783 CACCGTGGGAGGGCTTTGTTTGG + Intronic
917749024 1:178037850-178037872 CACCCTGGGACTGCCTTGCGGGG + Intergenic
918342324 1:183578148-183578170 CAGCCTGGCACAGCTTGGAGGGG + Intronic
919298245 1:195729102-195729124 CAAACTGGGAGAAATTTGAGAGG - Intergenic
921370370 1:214416987-214417009 CACCCTGTCATAGCTTTGGGTGG + Intronic
923137775 1:231133603-231133625 CACCCTGGAACAGCTTTGCTTGG + Intergenic
923562881 1:235054953-235054975 CACCCAGAGAGTTCTTTGAGGGG + Intergenic
1062940928 10:1420973-1420995 CACCCTGTGAGAGCAGAGAGAGG - Intronic
1064662264 10:17617632-17617654 CACCCTGCGAGTGCATTTAGTGG + Intergenic
1064934857 10:20668317-20668339 CACCCTGGTAGAGCTGTTGGTGG + Intergenic
1065497776 10:26347687-26347709 CACGCTGGGAGAGCCTGGGGAGG - Intergenic
1067743562 10:48915134-48915156 CACCCTTACAGAGCTATGAGGGG + Intronic
1069515044 10:69070616-69070638 CAGCCTGGCAGAGCTGTGTGAGG + Intergenic
1069798289 10:71067063-71067085 CTCCCTGGGGGAGGTGTGAGAGG + Intergenic
1069861916 10:71476842-71476864 CACTCTGGAAGAGCCATGAGAGG - Intronic
1070781171 10:79138185-79138207 CTCCCTGTGTGTGCTTTGAGAGG - Intronic
1070813347 10:79309366-79309388 CACCCTGGGAGAGCAGGGAGGGG - Intronic
1072782748 10:98261474-98261496 CACCCTGAGAGAGCTGAGATGGG + Intronic
1072792349 10:98327386-98327408 CATCCTGGGAGAGCTTTGGGAGG + Intergenic
1072799577 10:98383899-98383921 CACCCTGGCAGGTTTTTGAGCGG - Intronic
1073532227 10:104243331-104243353 CATGCTGGGAGAGTGTTGAGAGG + Intronic
1073563738 10:104518408-104518430 CATCCTGGGAGAGCTTTCATGGG - Intergenic
1074469663 10:113715454-113715476 AGCCCTGGGAGGGCTTTAAGTGG + Intronic
1075636071 10:124031147-124031169 CACCCAGAGATAGCTCTGAGGGG + Intronic
1081291377 11:41329698-41329720 CACCCTTTGAGAACTTTAAGTGG - Intronic
1081439623 11:43065813-43065835 GACCATGGGAGAGCTCTGACTGG - Intergenic
1083648585 11:64186839-64186861 CAGGGTGGGAGAGCGTTGAGCGG + Intronic
1084332129 11:68436563-68436585 CAACCTGGTAGAGCCTTGGGCGG + Intronic
1084419514 11:69053315-69053337 GACCCTGGGAGTGATTTGGGTGG + Intronic
1085512379 11:77095008-77095030 CACCCTGGAGTGGCTTTGAGAGG - Intronic
1088625766 11:111729309-111729331 CACCCAGGGAGAGCTGTGATGGG + Exonic
1089070633 11:115696894-115696916 CAGGCTGGGAGAGCTTGGACAGG + Intergenic
1089095379 11:115915926-115915948 TAGCCTGGGAGAGATTTGTGAGG + Intergenic
1089620276 11:119718158-119718180 CACCCTGGGTGACCCTCGAGAGG + Intronic
1090416428 11:126543689-126543711 CACCATGGGAGAGGTTTCCGTGG - Intronic
1090661983 11:128889453-128889475 CAACTTGGAGGAGCTTTGAGAGG - Intergenic
1091596680 12:1883208-1883230 CACCCTGGAAGATCTCTGAGGGG + Intronic
1092491379 12:8949057-8949079 CACCCTGGGAGAGCTTTGAGGGG - Intronic
1092951152 12:13504778-13504800 GACCCTGGGAGAGCTGCGTGGGG + Intergenic
1095992339 12:48044555-48044577 CACCCAGGGAGCGGTTTCAGTGG - Exonic
1097587354 12:61530546-61530568 CAAGGTGGGAGAGCTTTGGGTGG + Intergenic
1100855346 12:98752710-98752732 CCCACAGGGAGAGCTTTGAATGG - Intronic
1102006847 12:109594703-109594725 AACCCTGGGAGGGCTGTGATTGG + Intronic
1102915121 12:116746821-116746843 AGCCCTGGGAGGGCTTTTAGTGG + Intronic
1103933383 12:124462469-124462491 CACCCTGGGAGAGCTCTGCACGG - Intronic
1104447098 12:128843475-128843497 CACCCCCGAAGACCTTTGAGGGG + Intergenic
1104960956 12:132488603-132488625 CACCCTGGGGAGGCTTTGACAGG + Intergenic
1107445565 13:40467518-40467540 CACCATGGGAGAGATGTGAAGGG - Intergenic
1109627455 13:64994037-64994059 CTCCCTAAGAGAGCTCTGAGTGG - Intergenic
1109783831 13:67148813-67148835 CATCCTGGGACAGTTTTCAGTGG - Intronic
1110210815 13:72970477-72970499 CACTCTGGGATAGCTTTGTAAGG - Intronic
1110422875 13:75333411-75333433 CACCCTGGGTGGGCTTTGTGAGG + Intronic
1111224364 13:85250192-85250214 CACCCTGGTAGATCTTTATGTGG - Intergenic
1113045265 13:106148058-106148080 CAGGCTGTGGGAGCTTTGAGAGG + Intergenic
1113529528 13:111011983-111012005 CACACTGTGAGGGCTTTGGGTGG - Intergenic
1113874187 13:113584545-113584567 CGCCCTGGGAGAGCGGGGAGGGG - Intergenic
1114961922 14:27902367-27902389 CTCCCTAGGAGAGCCTTGACTGG - Intergenic
1116778272 14:49206610-49206632 CAGCCTGGGAGAGATTTGCTAGG - Intergenic
1120300921 14:82705743-82705765 CACACTTGCAGAGCATTGAGAGG - Intergenic
1120355175 14:83424087-83424109 AATCCTGGGAAAGCTTTGTGAGG - Intergenic
1120860115 14:89247387-89247409 GAACCTGGGAGAGCTATGAAAGG + Intronic
1121995708 14:98601348-98601370 CACCCTTTGAGACCGTTGAGAGG - Intergenic
1122281771 14:100627726-100627748 GAGACTGGAAGAGCTTTGAGAGG - Intergenic
1122534503 14:102452721-102452743 CAACCTGTGAGAGTTCTGAGGGG + Intronic
1124249905 15:28099695-28099717 CCCGCTGGGAGAGCTCTGAAGGG - Intergenic
1124568049 15:30834225-30834247 CAGCTTGGGAGAGCTTGGATTGG + Intergenic
1126070116 15:44858816-44858838 AATCCTGGGGAAGCTTTGAGGGG - Intergenic
1126087917 15:45026277-45026299 AATCCTGGGGAAGCTTTGAGGGG + Intronic
1127161392 15:56190458-56190480 CAACCTGGGACAGCTTTGATTGG + Intronic
1127920078 15:63487516-63487538 GTCCCTGGGAGAGCTCTGCGCGG + Intergenic
1127982140 15:64042921-64042943 CACTCTGGGAGAACTTGAAGAGG - Intronic
1129830488 15:78666664-78666686 CACGCGGGCAGAGCTTAGAGTGG + Intronic
1130978199 15:88793208-88793230 CAGACTGGGAGTGCTTTGGGAGG + Intergenic
1132582157 16:689861-689883 CACCCTGGCTGAGCGGTGAGGGG + Exonic
1135135282 16:19882702-19882724 AACCCTTGGAGGGTTTTGAGTGG - Intronic
1135491648 16:22914805-22914827 CACCAGGTGAAAGCTTTGAGTGG + Intronic
1139374462 16:66488087-66488109 CACCCTGGGAAAGATGAGAGTGG + Intronic
1143626290 17:8111989-8112011 CTCCCTGGGAGGGCTGGGAGAGG + Intronic
1144093753 17:11881465-11881487 CACTCTGGGAGAGGTTGCAGAGG + Intronic
1144994315 17:19256645-19256667 CCCCGTGGGAAAGCTCTGAGGGG + Intronic
1146197264 17:30824441-30824463 AAGGCTGGGAGGGCTTTGAGGGG - Intronic
1147617448 17:41837908-41837930 CACCCTGGGACAGCGGAGAGAGG - Exonic
1148005376 17:44423673-44423695 CCCCCTGGGAGAGTTTAGAAGGG - Intronic
1153509075 18:5832920-5832942 CACCCTGGGAAAGCACTGGGTGG + Intergenic
1153535850 18:6100841-6100863 CACCCTAGCAGAGCTGGGAGGGG + Intronic
1157863989 18:51165429-51165451 AACCCTGGGTGAGTTTAGAGTGG - Intergenic
1158269747 18:55699638-55699660 CACCATCTCAGAGCTTTGAGGGG + Intergenic
1159651478 18:70983868-70983890 CACCCTGTTTCAGCTTTGAGGGG + Intergenic
1160557440 18:79735395-79735417 CAACGTCGGAGAGCTGTGAGCGG + Intronic
1161252485 19:3288040-3288062 CACACTGGGGGAGCTGTGGGAGG + Intronic
1166365219 19:42274662-42274684 CACCTTGGGAGGGCTTCAAGGGG + Intronic
1166621171 19:44301905-44301927 CACCATGGAACAGCTTTGTGAGG - Intronic
1167106370 19:47432140-47432162 CACCCTGGGAGACTTTGGTGGGG - Intronic
1167563348 19:50239928-50239950 CAGCCTGGGGGAGTTTTGGGAGG + Intronic
925492242 2:4407626-4407648 CAACCTGAGTGAGCTTGGAGTGG + Intergenic
926404585 2:12538132-12538154 CAGCCTGGGTGAGGATTGAGGGG + Intergenic
927678407 2:25123734-25123756 CACCCTGGGACAGCTTGGCAGGG - Intronic
928420506 2:31134695-31134717 CACCCTTGGAGAGCTCCCAGGGG - Intronic
928456898 2:31430488-31430510 AACCTAGGAAGAGCTTTGAGAGG - Intergenic
929960185 2:46490503-46490525 CTCTCTGGGTGAGATTTGAGAGG - Intergenic
932842826 2:75099617-75099639 AACCCAGGGAGAGGTTTGCGCGG + Intronic
937909001 2:127066349-127066371 CACCCTGGGGGAGCAGCGAGAGG - Intronic
938338380 2:130518857-130518879 CAACCTGGGACCGCTTTGTGTGG + Intergenic
938351459 2:130601893-130601915 CAACCTGGGACCGCTTTGTGTGG - Intergenic
939296582 2:140273581-140273603 CACCCTTGGTGAGCTCTCAGCGG + Intronic
940505375 2:154546835-154546857 CTGCCTGGTAGAGCTGTGAGAGG + Intergenic
940625117 2:156165432-156165454 CACCCAGGGAGAGGTTTAAAAGG - Intergenic
942032683 2:171978529-171978551 CAGCCTAGGAGAGATTTGGGAGG - Intronic
1171947344 20:31390168-31390190 GAGCTTGGGAGAGGTTTGAGGGG - Intronic
1171976310 20:31596855-31596877 CAGCCTGGGAGCACTTTGGGAGG - Intergenic
1173841766 20:46162042-46162064 CTGCCTGCAAGAGCTTTGAGTGG - Intergenic
1175209960 20:57348014-57348036 AACCCTGAGAGAGCTTTGGGAGG + Intergenic
1176013985 20:62919043-62919065 CAAGCTGGTGGAGCTTTGAGTGG - Intronic
1176041901 20:63070078-63070100 CAGCCTGGGAGACCTTCGAGCGG + Intergenic
1177519464 21:22200205-22200227 CACACTGGGAGGACTTGGAGAGG - Intergenic
1178960726 21:37062318-37062340 CAACCTGGGAGAGGTATCAGTGG - Intronic
1179451880 21:41473566-41473588 CAGCCTGGGAGACCCTTGGGAGG - Intronic
1182448547 22:30404250-30404272 CAGCATGGGACAGCTTTTAGAGG - Intronic
1183058022 22:35318893-35318915 CAGCCCGGGAGGGCTTTGCGTGG + Intronic
1183516633 22:38270644-38270666 GCCCCTGGGAGAGCTCTGTGTGG - Intronic
1185178171 22:49342783-49342805 CCCTCAGGGATAGCTTTGAGGGG + Intergenic
950386339 3:12663648-12663670 CACCCTGGGGTAGCGTTGGGCGG - Intronic
953919955 3:46944837-46944859 GACCCAGTGAGAGCTTTGAGCGG - Intronic
954796178 3:53162163-53162185 CACCCTGGGAGGGGTCTCAGAGG - Intronic
958904231 3:99924345-99924367 AATCCTGGGACAGCTTTTAGTGG - Exonic
960938948 3:122921228-122921250 CAGCCTGGGAGAGCCTCGGGTGG + Intronic
968383332 4:113088-113110 CACCCTGACAGAGCTTAGGGGGG + Intergenic
972169906 4:36333495-36333517 CACACCGGGAGAGCTTAGGGTGG + Intronic
977937047 4:102818493-102818515 GACCATGTGAGAGCTTTGAGAGG - Intronic
983981709 4:174005655-174005677 GAGCCTGGGAGAGCTGAGAGCGG - Intergenic
986769478 5:10958589-10958611 CCACCTTGGAGAGCTTTGGGTGG + Intergenic
989730960 5:44648055-44648077 CACCCTGGCAAAGGTTTGATTGG - Intergenic
990012438 5:51016004-51016026 CACCCCAGGAGAGCTTTGGATGG + Intergenic
992342515 5:75839894-75839916 GACCCTGTGAGATATTTGAGAGG + Intergenic
993730172 5:91412869-91412891 GAGGCTGGGAGATCTTTGAGAGG + Intergenic
996086448 5:119310294-119310316 CGTCCTGGGAGAGCCCTGAGTGG + Intronic
997979357 5:138459344-138459366 ACCCCAGGGAGGGCTTTGAGGGG - Intergenic
1002292260 5:178208020-178208042 GACCCTGGGAGATCTTTGGAAGG - Intronic
1005199366 6:23325779-23325801 CAACCTGAGTGAGCTTGGAGAGG + Intergenic
1007839648 6:44705277-44705299 CAGCCTGGAAAAGCCTTGAGTGG - Intergenic
1009613987 6:65981843-65981865 CAGGCTTGGAGAGCTGTGAGAGG - Intergenic
1018243182 6:161798649-161798671 CTCCCTGGGAGACTTATGAGAGG + Intronic
1018928611 6:168224321-168224343 CCCCCAGGGAGTGCTTGGAGTGG + Intergenic
1019285046 7:219174-219196 CACCTGGGGCGAGGTTTGAGGGG + Intronic
1019992763 7:4703476-4703498 CACCCTGGGGGAGCCTTGTGGGG - Intronic
1022456562 7:30563403-30563425 CAACCTGAGAGAAGTTTGAGAGG + Intergenic
1024398728 7:48898964-48898986 CTCCCTGGGAGAGCTGTGGTGGG + Intergenic
1026220638 7:68393310-68393332 CTCCCTGGGAGTGCATTGAGAGG - Intergenic
1029734809 7:102459618-102459640 CAGACTGGGAGAGCTTCCAGGGG + Exonic
1032900887 7:136305995-136306017 GGCCCTGTGAGAGGTTTGAGTGG + Intergenic
1034414452 7:150957239-150957261 CACCTTGGAGGAGCTTGGAGAGG - Intronic
1035486799 7:159232488-159232510 CACCCAGGGAGAGGCTTGACGGG + Intergenic
1035657251 8:1319460-1319482 CACCCTCGGAGAGATTGGAGTGG + Intergenic
1037588624 8:20295055-20295077 CACCCAGGGAGAGGTTAGAAAGG - Intronic
1037610473 8:20471844-20471866 AAGGCTGGGAGAGTTTTGAGGGG + Intergenic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1042105599 8:65323131-65323153 CACCCTGAGACAGATTTGAGTGG - Intergenic
1045476590 8:102557824-102557846 CACCGTGGGAGAGTCTTGAAAGG + Intronic
1047200331 8:122759920-122759942 CATCCTGGGAGGGGATTGAGAGG + Intergenic
1047330162 8:123879820-123879842 CTCCCTGGCAGAGCTGGGAGTGG - Intronic
1049005670 8:139854148-139854170 GACCCTGGGAGGGATTTGCGAGG + Intronic
1049024570 8:139979784-139979806 CCCCCTGGCAGTGCTGTGAGGGG - Intronic
1053035824 9:34826146-34826168 GACCCTGGGAGAGCATGGGGAGG - Intergenic
1056883880 9:90421207-90421229 CTCCATGGCAGAGCTTTGTGGGG - Intergenic
1058328874 9:103733978-103734000 CACTCTAGGAGAGCTCTGATAGG + Intergenic
1060441249 9:123641584-123641606 CTCTTTGGGAGAGCTTTGACTGG - Intronic
1060497551 9:124129564-124129586 CAGCCAGGAAGAGCATTGAGTGG + Intergenic
1061945761 9:133907569-133907591 CCCCCTGGGAGATGTTTTAGGGG + Intronic
1062096729 9:134707528-134707550 CACCCTGGGATTCCTGTGAGTGG + Intronic
1196796661 X:119507381-119507403 CACCCGGGGATGGCCTTGAGTGG + Intergenic
1198857849 X:141036690-141036712 GACCCTGACAGAGCTTTGAGAGG + Intergenic
1198904847 X:141550682-141550704 GACCCTGACAGAGCTTTGAGAGG - Intergenic
1200076780 X:153555158-153555180 CACCCTGTCACAGCTTAGAGTGG + Intronic