ID: 1092491612

View in Genome Browser
Species Human (GRCh38)
Location 12:8950227-8950249
Sequence CAAGGTACTCAACTGGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 799
Summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 750}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092491612_1092491618 29 Left 1092491612 12:8950227-8950249 CCTTTTTCCAGTTGAGTACCTTG 0: 1
1: 0
2: 5
3: 43
4: 750
Right 1092491618 12:8950279-8950301 TGTCGTTCCTTACTGCTTCGTGG 0: 1
1: 0
2: 0
3: 2
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092491612 Original CRISPR CAAGGTACTCAACTGGAAAA AGG (reversed) Intronic
901168691 1:7238375-7238397 CAGTGTACTCAACTCTAAAATGG + Intronic
901383868 1:8893658-8893680 GAAGGTACCCAAAGGGAAAAAGG + Intergenic
901587786 1:10312632-10312654 CAAGGTCCTGAAATGGAAAGGGG - Intronic
901649698 1:10736554-10736576 CCATGTACTCATCTGCAAAATGG - Intronic
901959534 1:12813910-12813932 CAATCTACTCATCTGAAAAAGGG - Intergenic
902238327 1:15072126-15072148 CAGTGTACTCATCTGTAAAATGG + Intronic
902254469 1:15178655-15178677 CAATGTCCTCATCTGTAAAATGG - Intronic
902758222 1:18563573-18563595 CAAGGCACACAGCTGGCAAATGG + Intergenic
902999389 1:20254214-20254236 CAAGGTCCTCATCTTTAAAATGG - Intergenic
903471928 1:23593339-23593361 CAAGTTTCTCATCTGTAAAATGG + Intronic
903473863 1:23606120-23606142 CAATTTCCTCAACTGTAAAAGGG + Intronic
903705728 1:25284400-25284422 CAATGTTCTCAACTGAATAATGG - Intronic
903721512 1:25409020-25409042 CAATGTTCTCAACTGAATAATGG + Intronic
903876176 1:26474580-26474602 GAAGGTACCCAAAGGGAAAAAGG + Exonic
905135692 1:35797658-35797680 CAACTTCCTCAACTGTAAAATGG - Intergenic
905972376 1:42151855-42151877 CAGGTTACTCATCTGTAAAATGG + Intergenic
906172371 1:43737950-43737972 CAGTTTGCTCAACTGGAAAATGG - Intronic
906436406 1:45800560-45800582 CTGGGTGCTCAACTGGAGAAGGG + Intronic
906604505 1:47157193-47157215 CAAGCTACTCATCTGACAAAGGG + Intergenic
906840367 1:49131915-49131937 CAAGATATGGAACTGGAAAATGG + Intronic
907117065 1:51978287-51978309 CAATCTCCTCATCTGGAAAATGG + Intronic
907316947 1:53578248-53578270 CAATGTCCTCTACTGTAAAATGG + Intronic
907701717 1:56794811-56794833 CAAGGCACGTAAGTGGAAAATGG - Intronic
907865909 1:58398890-58398912 CAAGTTACTCATCTGTGAAATGG + Intronic
907876565 1:58494508-58494530 CAATCTACTCAACTGACAAAGGG + Intronic
908433986 1:64086881-64086903 CAATTTCCTCAACTGTAAAATGG - Intronic
909545183 1:76838807-76838829 CAATCTACTCATCTGAAAAAGGG + Intergenic
909704426 1:78564431-78564453 CAACCTACTCATCTGAAAAAGGG + Intergenic
910319974 1:85932176-85932198 CAAGCTACTCATCTGACAAAGGG + Intronic
911291517 1:96061802-96061824 CAAGGAACTGAACAGGGAAATGG + Intergenic
913026767 1:114851021-114851043 CAAGAAGCTCATCTGGAAAATGG + Intergenic
913704592 1:121406546-121406568 CAACCTACTCATCTGGCAAAGGG + Intergenic
914412399 1:147443522-147443544 CAAGCTACTCATCTGACAAAGGG + Intergenic
914678078 1:149918902-149918924 CAGGTTTCTCATCTGGAAAAGGG + Intergenic
914986799 1:152465077-152465099 CAACTTACTCAACTGACAAAGGG - Intergenic
915036210 1:152927613-152927635 CAACCTACTCATCTGAAAAAGGG + Intergenic
915440698 1:155943745-155943767 CACTGTTCTCAACTGTAAAATGG + Intergenic
915658020 1:157377594-157377616 CAATGGCCTCATCTGGAAAATGG - Intergenic
915670995 1:157489055-157489077 CAATGGCCTCATCTGGAAAATGG + Intergenic
915942099 1:160124878-160124900 CCATGTACTCAACTGTAAAATGG - Intronic
916299144 1:163254548-163254570 CAACCTACTCAACTGACAAACGG - Intronic
916990308 1:170236341-170236363 CAACCTACTCATCTGAAAAAGGG + Intergenic
917641571 1:176987966-176987988 AAAGTTTCTCATCTGGAAAATGG + Intronic
917994924 1:180426831-180426853 CAAGTTACTTACCTGTAAAATGG - Intronic
918410321 1:184251809-184251831 AAAGCTACACAGCTGGAAAATGG + Intergenic
918785008 1:188753139-188753161 CAAGCTACTCATCTGACAAAGGG - Intergenic
918985754 1:191623260-191623282 CAACGTACTCATCTGACAAAGGG - Intergenic
919207432 1:194435920-194435942 CAATCTACTCATCTGAAAAAGGG - Intergenic
919830078 1:201534560-201534582 CAATTTTCTCAACTGTAAAATGG - Intergenic
920357790 1:205387986-205388008 CAGGGTTCTCATCTGTAAAATGG - Intronic
920993756 1:210966474-210966496 CAAGCTACTCATCTGACAAAGGG + Intronic
921433976 1:215095467-215095489 CAATTTACTCATCTGTAAAACGG - Intronic
921591375 1:217008219-217008241 CAAGTTACTCATCTGTAAAATGG - Intronic
922487943 1:225990389-225990411 AAAGGGACTTAACTGCAAAAGGG + Intronic
922519778 1:226239617-226239639 CATGTTCCTCAACTGCAAAATGG + Intronic
922654273 1:227367473-227367495 CCAGCTACCCAACTGAAAAAGGG + Intergenic
922707788 1:227798746-227798768 CAAGGTCCTCATCTTGACAATGG - Intergenic
923890395 1:238209034-238209056 CAACCTACTCAACTGACAAAGGG + Intergenic
924863791 1:247955844-247955866 CAATCTACTCATCTGAAAAAGGG - Intronic
924911546 1:248518858-248518880 CAATGCAATCAACTGGAGAAAGG - Intergenic
924912555 1:248529182-248529204 CAATGCAATCAACTGGAGAAAGG + Intergenic
1063364576 10:5481885-5481907 GAGGGCACTCCACTGGAAAAGGG - Intergenic
1063626925 10:7698935-7698957 CAACGTCCTCATCTGAAAAATGG - Intergenic
1063823838 10:9870098-9870120 CTAGTAACTCAACTGAAAAAAGG - Intergenic
1063908547 10:10805821-10805843 CAAGGTGATCAAATGGAAAATGG - Intergenic
1065353517 10:24816743-24816765 TAATTTACTCATCTGGAAAATGG + Intergenic
1066135375 10:32440464-32440486 CAATGTCTTCCACTGGAAAAAGG + Intergenic
1067145784 10:43692734-43692756 CAAAGTACCCAAGAGGAAAAAGG - Intergenic
1068139010 10:52980936-52980958 CAAGGTAATTAAATGGGAAAAGG - Intergenic
1068390244 10:56386637-56386659 CAATCTACTCATCTGAAAAAGGG - Intergenic
1068904343 10:62306744-62306766 GAAGGTATTCAGCTGGAAAATGG + Intergenic
1069073721 10:64016279-64016301 CAAGCTACTCATCTGACAAAGGG - Intergenic
1069770913 10:70899362-70899384 CAGTGTCCTCAACTGTAAAATGG + Intergenic
1070489795 10:76965731-76965753 CAACATACTCACCTGTAAAATGG + Intronic
1070534814 10:77368370-77368392 CAAGCTACCCAACTGGAAAATGG - Intronic
1070727251 10:78800913-78800935 CAAGATTCTCATCTGGAAACAGG + Intergenic
1071097178 10:81990151-81990173 CAATGTTCTCATCTGTAAAACGG + Intronic
1071278888 10:84081575-84081597 GAAGGTACCCAAAGGGAAAAAGG + Intergenic
1071517176 10:86305862-86305884 CAAGTTCCTCAACTATAAAATGG - Intronic
1071594923 10:86914143-86914165 CAAGTAATTCAATTGGAAAAAGG + Intronic
1071784536 10:88883837-88883859 CAAGGTACTCTTTTGGAAATGGG + Intronic
1071914806 10:90281457-90281479 CAATGTACTCATCTGACAAAGGG - Intergenic
1072284754 10:93903489-93903511 CAAGGTAAAGAACTGGAAGAGGG - Intronic
1072540069 10:96391597-96391619 CAGCTTCCTCAACTGGAAAACGG + Intronic
1072599886 10:96915732-96915754 GAAGGTACCCAAAGGGAAAAAGG - Intronic
1072869702 10:99104224-99104246 CAATCTACTCATCTGGCAAAGGG + Intronic
1074335773 10:112573337-112573359 CAGGGTACTAGACAGGAAAACGG - Intronic
1074621042 10:115123321-115123343 CAATTTTCTCAACTGTAAAATGG - Intronic
1074623466 10:115151619-115151641 CAATGTACTCATCTGGCAAAGGG - Intronic
1074625195 10:115176207-115176229 CAATCTACTCATCTGGCAAAGGG - Intronic
1074657336 10:115607561-115607583 CAATTTCCTCAACTGTAAAAAGG - Intronic
1074956198 10:118392566-118392588 CAACGTTCTCATCTGTAAAATGG - Intergenic
1075217529 10:120550637-120550659 CAAGGTAATCTAGTGGCAAATGG + Intronic
1075447245 10:122521656-122521678 CAATGTCCTCATCTGTAAAATGG - Intergenic
1075682606 10:124343300-124343322 CTAGTTTCTCACCTGGAAAATGG - Intergenic
1075838341 10:125475280-125475302 CAAAGTCCTCATCTGTAAAACGG + Intergenic
1076234385 10:128852477-128852499 AAGGGTAGTCAGCTGGAAAATGG + Intergenic
1076853578 10:133104679-133104701 CAAGGAACACAGCTGGAACACGG - Intronic
1077509187 11:2946959-2946981 CAAGGGACTCGCCTAGAAAATGG + Intronic
1078693939 11:13610496-13610518 GAAGGTACTCAAAGGGAAAAAGG - Intergenic
1078810568 11:14757704-14757726 CAACCTACTCATCTGAAAAAGGG - Intronic
1078900929 11:15641982-15642004 CAATGTACTCATCTGTAAAGTGG + Intergenic
1078952454 11:16149593-16149615 CTAGGGACAAAACTGGAAAAGGG + Intronic
1079327468 11:19506488-19506510 CAATGTCCTCAACTGTGAAATGG + Intronic
1079972250 11:27049552-27049574 CAAGCTACTCAATTAAAAAATGG - Intronic
1080079516 11:28199673-28199695 CAATATACTCATCTGTAAAATGG + Intronic
1080421137 11:32111463-32111485 CAACTTTCTCATCTGGAAAATGG + Intergenic
1080685087 11:34508755-34508777 CAACTTCCTCAACTGTAAAATGG - Intronic
1080730891 11:34951597-34951619 CAACGTACTCATCTGACAAAGGG - Intronic
1080844141 11:36011765-36011787 CAATTTCCTCATCTGGAAAATGG + Intronic
1080885096 11:36360403-36360425 TAAGGTACCAAACAGGAAAATGG + Intronic
1080914658 11:36644088-36644110 CAATCTACTCAACTGACAAAGGG + Intronic
1081176135 11:39928841-39928863 CATGGTCCTCAACTGGGGAATGG - Intergenic
1081364303 11:42215741-42215763 CAACGTACTCATCTGACAAAGGG + Intergenic
1082298522 11:50474951-50474973 CAACGTACTCATCTGACAAAGGG + Intergenic
1082321170 11:50814250-50814272 CAAGCTACTCATCTGACAAAGGG - Intergenic
1082643826 11:55697437-55697459 CAATGTACTCATCTGACAAAGGG - Intergenic
1082665716 11:55972978-55973000 CAGTGTACTCCAGTGGAAAATGG - Intergenic
1082744064 11:56943282-56943304 CAAGCTACTCATCTGACAAAGGG - Intergenic
1082878253 11:58010746-58010768 CAAGCTACTCATCTGACAAAGGG - Intergenic
1082905587 11:58305047-58305069 CAAGCTACTCATCTGACAAAGGG - Intergenic
1083654471 11:64222872-64222894 CAAGTTCCTCATCTGGTAAATGG - Intronic
1084660575 11:70544263-70544285 CAGTGTCCTCATCTGGAAAATGG + Intronic
1085074689 11:73580399-73580421 GAAGGTACCCAAAGGGAAAAAGG + Intronic
1085728658 11:78977427-78977449 CAATGTATTCATCTGTAAAAGGG - Intronic
1085750231 11:79155099-79155121 CAAGCTACTCACTTGGATAATGG - Intronic
1085797676 11:79557757-79557779 CAAGCTACTCATCTGACAAAGGG + Intergenic
1085864489 11:80273346-80273368 CAAGCTACTCATCTGACAAAGGG + Intergenic
1086613092 11:88780494-88780516 CAATCTTCTCAACTGAAAAATGG + Intronic
1087211724 11:95451792-95451814 CAAGTTTCTCATCTGCAAAATGG + Intergenic
1087504438 11:99001675-99001697 CAATGTACTCATCTGACAAAGGG + Intergenic
1087722179 11:101679314-101679336 CAAGCTACTCATCTGACAAAGGG - Intronic
1087930542 11:103972804-103972826 CAACGTTCTCAACTGCAACATGG + Intronic
1088602198 11:111490578-111490600 CAACGCACTCAATTAGAAAATGG + Intronic
1088687093 11:112293716-112293738 CATGGCACTCAGCTGGAAGAGGG - Intergenic
1089102728 11:115977115-115977137 CAAGTTCCTCATCTGTAAAATGG - Intergenic
1090812131 11:130254308-130254330 CAATCTACTCAACTGACAAAGGG + Intronic
1090892851 11:130942194-130942216 CAAGCTACTCATCTGACAAAGGG - Intergenic
1091195304 11:133725870-133725892 GAAGGGACTTAACTGGCAAACGG + Intergenic
1091536601 12:1416071-1416093 CAAGGAACTAGACTGGAAAATGG - Intronic
1091920075 12:4297028-4297050 CACGGTGCTCAAGTGGAGAAAGG + Intronic
1092048549 12:5451146-5451168 CAAGTTTCTCATCTGTAAAATGG + Intronic
1092048776 12:5453037-5453059 CAAGTTTCTCATCTGTAAAATGG + Intronic
1092293077 12:7176237-7176259 CAAACAACTCAACTTGAAAATGG - Intergenic
1092343672 12:7697816-7697838 CAAGCCACTCAAGTGTAAAATGG + Intergenic
1092491612 12:8950227-8950249 CAAGGTACTCAACTGGAAAAAGG - Intronic
1092651731 12:10642074-10642096 GAAGTTTATCAACTGGAAAACGG + Intronic
1092715230 12:11382393-11382415 CAATCTACTCATCTGGCAAAGGG + Intronic
1092718929 12:11421222-11421244 CAATCTACTCATCTGGCAAAGGG + Intronic
1093298401 12:17420525-17420547 CAAGGTTCTCAACCTGATAAAGG - Intergenic
1093694188 12:22141626-22141648 CAAGCTACTCATCTGACAAAGGG + Intronic
1093712756 12:22345978-22346000 CAAGCTACTCATCTGACAAAGGG + Intronic
1093807228 12:23449247-23449269 CAAGCTACTCATCTGACAAAGGG + Intergenic
1094050588 12:26216475-26216497 CAAGCTACTCATCTGACAAAGGG - Intronic
1094259950 12:28483263-28483285 CAAGGCAATCAATTGGAAAATGG - Intronic
1095060887 12:37686846-37686868 CAACGTACTCATCTGACAAAGGG + Intergenic
1095074293 12:37897620-37897642 CAACCTACTCATCTGGCAAATGG + Intergenic
1095077176 12:37945011-37945033 CAACCTACTCATCTGGCAAATGG + Intergenic
1095152145 12:38807842-38807864 CAACCTACTCATCTGAAAAAGGG + Intronic
1095258926 12:40075892-40075914 TAAAGGACTCAAATGGAAAATGG - Intronic
1095304991 12:40628206-40628228 TGAGGCACTCTACTGGAAAAAGG - Intergenic
1095325843 12:40891195-40891217 CAAACAACTCAACTAGAAAACGG - Intronic
1095364803 12:41390098-41390120 CACGGCCCTCAACTGTAAAAAGG - Intronic
1095425262 12:42068199-42068221 CAAGCTACTCATCTGACAAAGGG + Intergenic
1095429393 12:42116370-42116392 CAAGCTACTCATCTGACAAAGGG + Intronic
1095591780 12:43911586-43911608 CAAGCTACTCATCTGACAAAGGG + Intronic
1095911598 12:47432005-47432027 CAACCTACTCATCTGGCAAAGGG + Intergenic
1096736389 12:53658748-53658770 TAAGGAACCCAACAGGAAAAGGG - Intronic
1097611037 12:61820703-61820725 AAAAGAACTCTACTGGAAAAAGG + Intronic
1097732095 12:63140200-63140222 CAATCTACTCATCTGGCAAAGGG + Intergenic
1097862393 12:64531313-64531335 AAAGGTACTTCAGTGGAAAAAGG - Intergenic
1098004581 12:65982451-65982473 CAATGTACTCATCTGACAAAGGG + Intergenic
1099075148 12:78097226-78097248 AAAGGGATTCAACTTGAAAAGGG - Intronic
1099409902 12:82312447-82312469 AAGGGTATTCAACTGGCAAAAGG - Intronic
1099951516 12:89309398-89309420 CCAGGTACTCACCTGAAAAAGGG + Intergenic
1099951568 12:89309793-89309815 CCAGGTACTCACCTGAAAAAGGG - Intergenic
1101584913 12:106077276-106077298 CAAGTTCCTCATCTGCAAAATGG + Intronic
1101637678 12:106559250-106559272 CAATCTACTCAACTGACAAAGGG - Intronic
1101832524 12:108270480-108270502 CAATGTACTCAACTGTAAAATGG - Intergenic
1102233001 12:111276571-111276593 CAGTGTTCTCATCTGGAAAAGGG + Intronic
1102389813 12:112540402-112540424 CAAGTTCCACAACTGTAAAATGG + Intergenic
1102785605 12:115601834-115601856 CAAGTTTCTCATCTGTAAAATGG + Intergenic
1102920499 12:116788299-116788321 CAATTTTCTCATCTGGAAAATGG - Intronic
1103979019 12:124724004-124724026 CAATGTCCTCATCTGGAAAATGG - Intergenic
1104015409 12:124958506-124958528 CAGGCTCCTCATCTGGAAAATGG + Intronic
1104300906 12:127564194-127564216 CAAGGTTATCAAGTGTAAAAAGG - Intergenic
1104663378 12:130628574-130628596 CAGTGTTCTGAACTGGAAAATGG - Intronic
1105713512 13:23037154-23037176 TAAGGTTCTCAAATGAAAAAAGG - Intergenic
1105860833 13:24410882-24410904 CAAGTTACTTCTCTGGAAAATGG - Intergenic
1106241214 13:27915224-27915246 CAATTTCCTCCACTGGAAAATGG + Intergenic
1107018641 13:35729757-35729779 AAAAGTACTCATCTGGAAGATGG + Intergenic
1107676972 13:42807592-42807614 CCATTTCCTCAACTGGAAAATGG + Intergenic
1109856843 13:68141467-68141489 AATAGTACTCACCTGGAAAAGGG - Intergenic
1110101560 13:71612619-71612641 CAAGTTACTCATCTGTAAAGTGG + Intronic
1110186051 13:72676031-72676053 CAAGCTACTCATCTGACAAAGGG + Intergenic
1110227323 13:73133205-73133227 CAAGGTACTCTGCTGGGAAGGGG - Intergenic
1110368209 13:74711286-74711308 CAAGCAACTCAGCTGCAAAAGGG - Intergenic
1110800182 13:79685010-79685032 AAAACTACTCAGCTGGAAAAAGG - Intergenic
1111103420 13:83614730-83614752 CAAGCTACTCATCTGACAAAGGG + Intergenic
1111273054 13:85912692-85912714 CAAGCTACTCATCTGACAAAGGG - Intergenic
1111291564 13:86178000-86178022 CAAGGTAATTCAATGGAAAAAGG + Intergenic
1111871962 13:93844545-93844567 CAACCTACTCATCTGAAAAAGGG - Intronic
1112125890 13:96467751-96467773 CAATGTACTCATCAGCAAAATGG - Intronic
1112182577 13:97098986-97099008 CAATGTACTCATCTGACAAAGGG - Intergenic
1112701596 13:102016194-102016216 CAATTTTCTCAACTGTAAAATGG - Intronic
1112899487 13:104341251-104341273 CAACCTACTCAACTGACAAAGGG - Intergenic
1112961649 13:105134449-105134471 CAATCTACTCATCTGGCAAAGGG + Intergenic
1114756594 14:25267165-25267187 GAAGGTACCCAAAGGGAAAAAGG - Intergenic
1114979731 14:28148011-28148033 CAAGCTACTCATCTGACAAAGGG - Intergenic
1115950482 14:38715545-38715567 CAATCTACTCATCTGAAAAAGGG + Intergenic
1116315453 14:43385072-43385094 CAAGCTACGCAACTGTAAAAGGG + Intergenic
1117439605 14:55747250-55747272 CAAGTTCCTCACCTGGAAAATGG - Intergenic
1117855433 14:60026426-60026448 CAAACAACTCAACAGGAAAAAGG - Intronic
1118312391 14:64703695-64703717 AAAGGTACACACCTGGAAACTGG - Intergenic
1118823811 14:69362628-69362650 CACTGTTCTCAACTGAAAAATGG + Intergenic
1118922819 14:70165665-70165687 AAAGCTATCCAACTGGAAAAAGG + Intronic
1119220669 14:72904411-72904433 CAGTGTACTCATCTGTAAAATGG + Intergenic
1119298413 14:73551854-73551876 CAGGACACTCCACTGGAAAAGGG + Intronic
1119302709 14:73584040-73584062 CAGGACACTCCACTGGAAAAGGG + Intergenic
1119657901 14:76430658-76430680 CAGGGTCCTCATCTGTAAAATGG - Intronic
1119967336 14:78931565-78931587 CAGGGTCCTCATCTGTAAAATGG - Intronic
1120063380 14:80011374-80011396 CAACCTACTCATCTGAAAAAGGG - Intergenic
1120065227 14:80032788-80032810 CAACCTACTCATCTGAAAAAGGG + Intergenic
1121820616 14:96962952-96962974 CAATGTCCTCAACTGCGAAAAGG - Intergenic
1122274105 14:100582463-100582485 CAGTGTCCTCAACTGCAAAAGGG - Intronic
1122454653 14:101841111-101841133 CAGTTTTCTCAACTGGAAAATGG - Intronic
1124445815 15:29730862-29730884 GAAGGTACCCAAAGGGAAAAAGG + Intronic
1124445933 15:29732120-29732142 CAGGCTACTCAACTGTAACATGG + Intronic
1124502471 15:30241263-30241285 CAAGCTACTCATCTGACAAAGGG - Intergenic
1124741093 15:32297386-32297408 CAAGCTACTCATCTGACAAAGGG + Intergenic
1124876921 15:33603354-33603376 CAAGGTACTCACCTGACCAAAGG - Exonic
1125057924 15:35384860-35384882 CAAGTTACCCATCTGGCAAAGGG + Intronic
1125680111 15:41525137-41525159 AAAGCTGCTCAACTGGAAATGGG + Exonic
1126917244 15:53479446-53479468 CAGTTTACTCAACTGTAAAATGG + Intergenic
1127364228 15:58272267-58272289 GCAGGTACACATCTGGAAAAGGG - Intronic
1128519526 15:68366291-68366313 CAATGTTCTCATCTGTAAAATGG - Intronic
1129272277 15:74425326-74425348 CATGGTCCTCATCTGCAAAATGG - Intronic
1130176676 15:81579132-81579154 CAAGATACACAACAGGAAAATGG - Intergenic
1130246933 15:82260696-82260718 CAAGGTATGTAACTTGAAAATGG + Intronic
1130453706 15:84082260-84082282 CAAAGTACGTAACTTGAAAATGG - Intergenic
1130556247 15:84924377-84924399 CAATTTTCTCATCTGGAAAATGG - Intronic
1130580479 15:85133421-85133443 CAAGGGACACAGCTGGAAACTGG + Intronic
1132139249 15:99377443-99377465 CAATCTACTCATCTGGCAAAGGG - Intronic
1133391499 16:5413970-5413992 CAATGTCCTCATCTGTAAAATGG - Intergenic
1133391777 16:5416201-5416223 CAATGTCCTCATCTGTAAAATGG - Intergenic
1133396428 16:5450941-5450963 CAGTGTTCTCATCTGGAAAATGG + Intergenic
1133577780 16:7110379-7110401 CAATGTAGTCAACTGTAAAGTGG - Intronic
1134363261 16:13552569-13552591 CAATTTACTCAACTGCGAAATGG - Intergenic
1134366025 16:13579902-13579924 CAGGGTTTTCAGCTGGAAAATGG + Intergenic
1134821380 16:17250178-17250200 CATGGTACTCAAGTGGCACAAGG + Intronic
1135157500 16:20065519-20065541 CAAAGTTCTCACCTGAAAAATGG + Intronic
1135705346 16:24670267-24670289 CAATGTCCTCATCTGTAAAATGG - Intergenic
1135858340 16:26032640-26032662 GAAGGTACCCAAAGGGAAAAAGG - Intronic
1135904704 16:26500942-26500964 AATGATACTCTACTGGAAAAGGG + Intergenic
1136020128 16:27434777-27434799 CAATGTCCTCATCTGTAAAATGG - Intronic
1136091274 16:27921793-27921815 CAGGGTCCTCAACTTGAGAAGGG - Intronic
1136392703 16:29975321-29975343 CAACGTTCTCAACTGTAAAATGG - Intronic
1136596173 16:31251628-31251650 CACTGTCCTCATCTGGAAAATGG - Intergenic
1136607070 16:31343116-31343138 CAAGCTACTCATCTGACAAAGGG + Intergenic
1137062373 16:35803004-35803026 GAAGGTACCCAAAGGGAAAAAGG - Intergenic
1137228726 16:46540587-46540609 CAACCTACTCAACTGACAAAGGG + Intergenic
1137738287 16:50741510-50741532 CAATGTCCTCATCTGTAAAATGG - Intergenic
1137791979 16:51182801-51182823 CAATTTTCTCATCTGGAAAATGG - Intergenic
1138131906 16:54487047-54487069 CAATGTCCTCACCTGTAAAATGG - Intergenic
1138200192 16:55082730-55082752 AAAGATACTCAACTGGGAGATGG + Intergenic
1138242238 16:55436381-55436403 CAGGGTCCTCATTTGGAAAATGG - Intronic
1138435670 16:56998510-56998532 CAATGTTCTCATCTGTAAAATGG - Intronic
1139326623 16:66157469-66157491 CAAGTTACTCAACTGCAAAAGGG - Intergenic
1139430151 16:66906837-66906859 CAAGATCCTCCACTGCAAAATGG + Intergenic
1140046790 16:71444974-71444996 CAAATTACTGAGCTGGAAAAGGG + Intergenic
1140147890 16:72329620-72329642 CAATCTACTCATCTGAAAAAGGG + Intergenic
1140707607 16:77645173-77645195 CAATTTACTCATCTGTAAAATGG - Intergenic
1141188653 16:81807626-81807648 CAATGTTCTCATCTGTAAAATGG - Intronic
1141324213 16:83040160-83040182 CAGGTTCCTCAGCTGGAAAAGGG + Intronic
1141730412 16:85819117-85819139 CAATGTACTCATCTGACAAAGGG + Intergenic
1141738960 16:85877257-85877279 CAATGTACTCATCTGACAAAGGG + Intergenic
1142580230 17:937407-937429 CAAGGAACACACCTGGAGAAGGG + Intronic
1142581647 17:946772-946794 CAGTGTCCTCACCTGGAAAATGG + Intronic
1142893857 17:2962351-2962373 CAATGTTCTCATCTGTAAAATGG - Intronic
1143737311 17:8921494-8921516 CAAGAAAATCAACTGAAAAATGG + Intronic
1144258489 17:13494282-13494304 GAAGGAAATCAACTGAAAAAAGG + Intergenic
1144787451 17:17839992-17840014 CAATTTACTCATCTGTAAAATGG - Intergenic
1145863391 17:28225790-28225812 CAATTTCCTCATCTGGAAAATGG + Intergenic
1146599690 17:34204013-34204035 CAAGGTCCTCATCTGTAATATGG - Intergenic
1146632032 17:34477105-34477127 CAAAGTACTCATCTGTAAAATGG - Intergenic
1146723284 17:35138207-35138229 CAATTTTCTCATCTGGAAAATGG - Intronic
1147135347 17:38430989-38431011 CAGTGTCCTCAACTGTAAAATGG - Intronic
1149566320 17:57643162-57643184 AAAGGTACCCTACTGGAAGAGGG + Intronic
1149628163 17:58094940-58094962 CACGTTACTCAGCTAGAAAAAGG - Exonic
1149735179 17:58987191-58987213 CCAGTTACTCATTTGGAAAATGG - Intronic
1149896872 17:60435267-60435289 GAAGGTACCCAAAGGGAAAAAGG - Intergenic
1149948436 17:60957765-60957787 CAAGTTACTCTTCTGTAAAATGG + Intronic
1151407504 17:73898789-73898811 CAGTGTTCTCAACTGTAAAATGG + Intergenic
1152302270 17:79502103-79502125 CAATGTGCTCATCTGAAAAATGG + Intronic
1153077157 18:1176504-1176526 CAAGGTACTTTAATGGAGAATGG - Intergenic
1153437409 18:5082493-5082515 AAAGTTACGCAGCTGGAAAATGG + Intergenic
1153781012 18:8495324-8495346 TAATTTACTGAACTGGAAAAAGG - Intergenic
1156602445 18:38625317-38625339 CAGTGTTCTCAACTGTAAAATGG + Intergenic
1157124690 18:44945219-44945241 CAATCTACTCAACTGACAAAGGG + Intronic
1157578524 18:48759631-48759653 CCAGTTACTCATCTGTAAAATGG + Intronic
1157989850 18:52481759-52481781 CAAGGTCCTCATCAGCAAAATGG + Intronic
1158379318 18:56911651-56911673 TAAAGGACTCAACTGGAACAAGG - Intronic
1158535241 18:58302728-58302750 AAGGGTCCTCATCTGGAAAATGG - Intronic
1158599448 18:58844836-58844858 CAAAGTTCTTAACTGTAAAAAGG + Intergenic
1158779471 18:60629381-60629403 CAATCTACTCAACTGACAAAGGG - Intergenic
1158970481 18:62661974-62661996 CAGCGTTCTCAACTGTAAAATGG - Intergenic
1159295553 18:66482493-66482515 CAATATGTTCAACTGGAAAATGG - Intergenic
1159486425 18:69064479-69064501 CGATGTTCTCAACTGTAAAATGG + Intergenic
1159748395 18:72269300-72269322 CAATGTACTCATCTGACAAAGGG + Intergenic
1160078402 18:75700236-75700258 CAAGATACTGAACTGGGAATAGG - Intergenic
1162204191 19:9043523-9043545 TAGTGTACTCATCTGGAAAATGG + Intergenic
1164061816 19:21682027-21682049 CAACCTACTCATCTGAAAAAGGG + Intergenic
1164326622 19:24198678-24198700 CAATCTACTCAACTGACAAAGGG - Intergenic
1164333322 19:24282237-24282259 CAAGCTACTCATCTGACAAAGGG - Intergenic
1164341116 19:24399040-24399062 CAACCTACTCATCTGAAAAAGGG + Intergenic
1164658961 19:29946046-29946068 GAAGGAAATCAACTGGAAGATGG - Intronic
1164812938 19:31172268-31172290 CAATGTGCTCATCTGTAAAATGG + Intergenic
1164951447 19:32340406-32340428 CAGGGCACTCCAGTGGAAAATGG - Intergenic
1165735775 19:38174530-38174552 CAATGTCCTCATCTGTAAAATGG + Intronic
1165781561 19:38437491-38437513 CAGTGTTCTCATCTGGAAAATGG + Intronic
1166645116 19:44525770-44525792 CAATCTCCTCAACTGTAAAATGG + Intronic
1166948306 19:46410739-46410761 CAAGGTGCTCAGCTTGATAAAGG - Exonic
1167015288 19:46837342-46837364 CAATGTTCTCACTTGGAAAATGG + Intergenic
925334777 2:3087603-3087625 CAAGCTACTCATCTGACAAAGGG + Intergenic
925510129 2:4616223-4616245 CAATGTACTCATCTGACAAAGGG - Intergenic
925752502 2:7102141-7102163 CCATGTACTTATCTGGAAAATGG + Intergenic
925856076 2:8131034-8131056 CAACCTACTCATCTGAAAAAGGG + Intergenic
926104804 2:10143429-10143451 CAGGGCACTCAGCTGGAACAAGG - Intronic
926495462 2:13581380-13581402 CAACCTACTCAACTGAGAAAGGG - Intergenic
927441134 2:23118744-23118766 GAAATTACACAACTGGAAAATGG - Intergenic
927514808 2:23665985-23666007 CAAGGTACTCATCTCTAAGAGGG - Intronic
927588309 2:24330551-24330573 GAAGGTACCCAAAGGGAAAAAGG + Intronic
928404837 2:31006740-31006762 AAAGGTGCTAAACTGGAATATGG + Intronic
928761776 2:34592370-34592392 AAATGTATCCAACTGGAAAAAGG + Intergenic
928860337 2:35849723-35849745 CAATCTACTCATCTGAAAAAGGG + Intergenic
929470525 2:42188090-42188112 CAAGGTAATTCAATGGAAAAAGG - Intronic
930024136 2:47020183-47020205 CAAGGTCCTCATCTGCAAAATGG - Intronic
930402213 2:50904575-50904597 AAAGTTAATCAACTGGTAAATGG - Intronic
930908385 2:56601206-56601228 CAATCTACTCATCTGAAAAAGGG - Intergenic
932508992 2:72266155-72266177 CAACCTACTCATCTGGCAAAGGG - Intronic
932520703 2:72408956-72408978 CAACCTACTCATCTGGCAAAGGG + Intronic
933127262 2:78624208-78624230 CAACCTACTCATCTGAAAAAGGG + Intergenic
934472812 2:94571106-94571128 CAAGCTACTCATCTGACAAAGGG - Intergenic
934603992 2:95680654-95680676 TCAGTTTCTCAACTGGAAAATGG - Intergenic
935207414 2:100908396-100908418 CAGGTTTCTCAACTGTAAAATGG - Intronic
936341665 2:111639193-111639215 CAAGGCCCTCAACTGGTAAGTGG - Intergenic
936492123 2:112981264-112981286 GAAGGTACCCAAAGGGAAAAAGG - Intronic
936537376 2:113322883-113322905 CAGGTTTCTCAACTGGAAAATGG - Intergenic
937000779 2:118465347-118465369 CAGTTTACTCATCTGGAAAATGG + Intergenic
937001516 2:118472080-118472102 CAAGGTACAGAACTGGAAACTGG - Intergenic
937673903 2:124567943-124567965 CAATGTTCTCATCTGTAAAATGG - Intronic
938160982 2:128984196-128984218 CAACGTCCTCATCTGTAAAATGG + Intergenic
938952441 2:136267350-136267372 GAAGGTACTCAGAAGGAAAAAGG - Intergenic
939066092 2:137484922-137484944 CAAGCTACTCATCTGACAAAGGG - Intronic
939261893 2:139821187-139821209 CAATCTACTCACCTGGCAAAGGG - Intergenic
939454911 2:142421489-142421511 CAAGGCTGTCAACTGAAAAAGGG + Intergenic
939592821 2:144086499-144086521 CAAGGTCCTTACCTGTAAAATGG - Intronic
939943890 2:148385203-148385225 CAACGTACTCATCTGACAAAGGG + Intronic
940392612 2:153150374-153150396 CAATCTACTCAACTGACAAAGGG - Intergenic
940976728 2:159954157-159954179 CAAGTTCCTCATCTGTAAAATGG + Intronic
941047129 2:160689454-160689476 CAGGGTACTCATCTCTAAAACGG - Intergenic
941558161 2:167009966-167009988 CAAGCTACTCATCTGACAAAGGG - Intronic
941978518 2:171431347-171431369 CCAGGTATTCAACTGTAAAGGGG + Intronic
944089272 2:195887547-195887569 CAAGGTACAGATTTGGAAAATGG - Intronic
947288187 2:228541825-228541847 CAAGATTCTCATCTGAAAAATGG - Intergenic
1168814105 20:724984-725006 CAGGCTCCTCATCTGGAAAATGG - Intergenic
1169300463 20:4437684-4437706 CAAGGTAGTCAATCAGAAAACGG - Intergenic
1169876518 20:10303256-10303278 CAGGTTTCTCAATTGGAAAATGG - Intronic
1170177087 20:13483898-13483920 CAATGTACTCATCTGACAAAGGG + Intronic
1170265483 20:14462435-14462457 CAATCTACTCAACTGACAAAGGG - Intronic
1170707312 20:18756171-18756193 CAGTGTACTCAACTGAGAAACGG - Intronic
1170708678 20:18769029-18769051 CAACTTCCTCAACTGTAAAATGG - Intergenic
1170971159 20:21117726-21117748 CAAATTCCTCATCTGGAAAACGG + Intergenic
1170985138 20:21251128-21251150 TGAGGTTCTTAACTGGAAAAAGG - Intergenic
1171048694 20:21835409-21835431 CGATGTTCTCATCTGGAAAAAGG - Intergenic
1171095039 20:22324818-22324840 CAAGTTAACCAACTGGAAATTGG + Intergenic
1171748678 20:29025890-29025912 CAACCTACTCAACTGACAAAGGG + Intergenic
1171995033 20:31724259-31724281 CAATGTCCTCAATTGTAAAATGG + Intergenic
1172206692 20:33167510-33167532 CAGCTTTCTCAACTGGAAAATGG + Intronic
1172329450 20:34064866-34064888 CAGAGTCCTCAACTGCAAAACGG - Intronic
1172590876 20:36116966-36116988 CAAGTTCCTCATCTGCAAAATGG - Intronic
1172871424 20:38137886-38137908 CAGTCTACTCATCTGGAAAACGG + Intronic
1173399953 20:42716652-42716674 CAATGTACTCATCTGACAAAGGG - Intronic
1173496857 20:43525714-43525736 CAATGTAATCCACTGGAAAGAGG - Intronic
1173761345 20:45563279-45563301 CAATTTCCTCATCTGGAAAATGG + Intronic
1173855362 20:46246955-46246977 CGAGGGACTCAGCTGGAAAGGGG + Intronic
1174096122 20:48091004-48091026 CAAGTTTCTCATCTGAAAAATGG + Intergenic
1174268035 20:49345993-49346015 CAATTTCCTCATCTGGAAAATGG + Intergenic
1174725329 20:52855622-52855644 CAATGTCCTCAACTGTGAAATGG - Intergenic
1174733247 20:52938742-52938764 CCATGGCCTCAACTGGAAAACGG - Intergenic
1174920712 20:54698905-54698927 GAAGTTACTCACCTGGTAAATGG + Intergenic
1174989866 20:55497997-55498019 CAAGCTACTCATCTGACAAAGGG - Intergenic
1175025777 20:55901129-55901151 CAACGTACTCATCTGACAAAGGG - Intergenic
1175142364 20:56870475-56870497 CAATGTCCTCATCTGTAAAATGG - Intergenic
1175243813 20:57569060-57569082 CAGGTTCCTCAACTGTAAAATGG + Intergenic
1175267710 20:57712552-57712574 CATTGTCCTCAACTGCAAAATGG - Intergenic
1175574072 20:60047307-60047329 CAAGATACTCACCTATAAAATGG - Intergenic
1175632680 20:60555576-60555598 CAATGCACTCATCTGCAAAATGG + Intergenic
1177951536 21:27544099-27544121 CAACCTACTCATCTGAAAAAGGG + Intergenic
1179358018 21:40680136-40680158 CAATTTCCTCAACTGTAAAATGG - Intronic
1180426919 22:15203280-15203302 CAAACTACTCATCTGAAAAAGGG - Intergenic
1181270073 22:21653431-21653453 CAACCTTCTCAACTGGAAAGTGG - Intronic
1181921114 22:26321206-26321228 CAGTTTACTCATCTGGAAAATGG - Intronic
1182332703 22:29562110-29562132 CAATGTTCTCATCTTGAAAATGG + Intronic
1182437523 22:30340337-30340359 CAAGATACTCATCTGGAGCAGGG + Exonic
1182611955 22:31555670-31555692 CAAGTTCCTCATCTGTAAAATGG - Intronic
1182753852 22:32662591-32662613 CAAGTTCCTCATCTGTAAAATGG + Intronic
1183958156 22:41394864-41394886 CAAGTTCCTCATCTGTAAAACGG + Intronic
1184005958 22:41709320-41709342 GAAGGTACCCAAAGGGAAAAAGG - Intronic
1184298224 22:43539727-43539749 CACTGTGTTCAACTGGAAAATGG + Intronic
1184327688 22:43802654-43802676 GAAGGTACACAAAGGGAAAAAGG + Intronic
1184471956 22:44701401-44701423 CAATGTCCTCAACTGGAAAATGG + Intronic
949485155 3:4531076-4531098 CAGGGTGCCCAACTGTAAAATGG - Intronic
949632031 3:5938917-5938939 CAACGTACTCATCTGAGAAAGGG + Intergenic
950182805 3:10927056-10927078 CAAGTGACTCAACTGGCAGAAGG - Intronic
950186720 3:10950004-10950026 CAGGGTCCTCATCTGCAAAATGG - Intergenic
950409352 3:12825200-12825222 CAATGTCCTCATCTGTAAAATGG - Intronic
950560423 3:13718271-13718293 CTATGTGCTCACCTGGAAAATGG + Intergenic
950779058 3:15375474-15375496 GAAGGTACCCAAAGGGAAAAAGG - Intergenic
950880536 3:16319422-16319444 CAAGTTACTCATCTCTAAAATGG + Intronic
951167751 3:19503017-19503039 CAACGTACTCATCTGACAAAGGG + Intronic
951198673 3:19853719-19853741 CAATCTACTCATCTGGCAAAGGG + Intergenic
952612796 3:35231036-35231058 CAACGTACTCATCTGACAAAGGG + Intergenic
952925696 3:38317812-38317834 CAATGTTCTCACCTGTAAAATGG - Intronic
953735878 3:45493562-45493584 CTAGTTACTCATCTGAAAAATGG + Intronic
953812320 3:46123882-46123904 GTAGGTATTCCACTGGAAAAGGG + Intergenic
954548274 3:51457284-51457306 CGATGTGATCAACTGGAAAAAGG + Intronic
954643292 3:52115067-52115089 CAAGTTACCCAACTTGGAAAAGG - Intronic
955082389 3:55670130-55670152 CAATGTCCTCATCTGGAAAATGG - Intronic
955733385 3:62011037-62011059 CAGGGTATTCAACTGGGAAGGGG - Intronic
956033465 3:65065030-65065052 CAATCTACTCATCTGAAAAAGGG + Intergenic
956243194 3:67152877-67152899 CAACCTACTCATCTGAAAAAGGG + Intergenic
956363689 3:68476061-68476083 CAATCTACTCAACTGACAAAGGG - Intronic
956549842 3:70445912-70445934 CAATGTACTCATCTGACAAAGGG - Intergenic
956550419 3:70452506-70452528 CAATGTACTCATCTGACAAAGGG - Intergenic
956914695 3:73859068-73859090 CAATGTATTCAACTTTAAAATGG - Intergenic
956985145 3:74690027-74690049 CAATGTACTCATCTGACAAAGGG + Intergenic
957168926 3:76711892-76711914 CAAGGCACTCAACTGGAGAAAGG - Intronic
957399279 3:79687463-79687485 CAATGTACTCATCTGACAAAGGG + Intronic
957465804 3:80589146-80589168 CAAGCTACTCATCTGACAAAGGG - Intergenic
957589004 3:82171361-82171383 CAATCTACTCATCTGAAAAAGGG - Intergenic
957860903 3:85947036-85947058 CAATCTACTCATCTGGCAAATGG + Intronic
958071135 3:88613520-88613542 CAAGATACTCATCTGTGAAATGG - Intergenic
958080101 3:88736563-88736585 CAACCTACTCATCTGGCAAAGGG + Intergenic
958485542 3:94702964-94702986 CAATGGACTCAACTGCCAAATGG + Intergenic
958633449 3:96710919-96710941 CAACCTACTCATCTGAAAAAGGG - Intergenic
959194835 3:103166866-103166888 CAGGGCACTCCACCGGAAAATGG + Intergenic
959488089 3:106951825-106951847 CAACCTACTCATCTGGCAAAGGG + Intergenic
959508483 3:107181400-107181422 GAAGATACTCAAATGGACAATGG + Intergenic
959741607 3:109726857-109726879 CAATCTACTCATCTGGCAAAGGG - Intergenic
959844494 3:111017762-111017784 CAATCTACTCATCTGGCAAAGGG + Intergenic
960017996 3:112914890-112914912 CAACCTACTCAACTGACAAAGGG + Intergenic
960411789 3:117335983-117336005 CAACGTACTCATCTGGCAAAGGG - Intergenic
960743513 3:120860909-120860931 CAGTGTCCTCATCTGGAAAATGG - Intergenic
961622706 3:128237512-128237534 CAAGGTCCACATCTGGAAACAGG - Intronic
962081348 3:132142300-132142322 CAACCTACTCATCTGGCAAAGGG + Intronic
962575926 3:136754829-136754851 CAATTTCCTCAACTGCAAAATGG + Intergenic
962831344 3:139144481-139144503 CAACCTACTCATCTGAAAAAGGG - Intronic
963131789 3:141865108-141865130 GAAGGTACCCAAAGGGAAAAAGG - Intergenic
963167354 3:142218907-142218929 CAAAGAACTCAATTTGAAAATGG + Intronic
963566905 3:146941573-146941595 CAATCTACTCATCTGGCAAAGGG - Intergenic
963759479 3:149272674-149272696 CAAGGAACTCAACTGCATAATGG - Intergenic
964108760 3:153067429-153067451 GAAGGTACTCAAAGGGAAAAAGG + Intergenic
964187575 3:153965128-153965150 CAATCTACTCAACTGACAAAGGG + Intergenic
964222267 3:154360490-154360512 CAATGTTCTCATCTGTAAAATGG - Intronic
964280152 3:155055155-155055177 CAAAGAACTCAACTGTAAAATGG + Intronic
964315799 3:155443039-155443061 CAAGTCCTTCAACTGGAAAATGG + Intronic
964721122 3:159768031-159768053 CAATTTTCTCAACTGTAAAATGG - Intronic
965252148 3:166355683-166355705 CAACCTACTCATCTGAAAAAGGG + Intergenic
965308423 3:167097826-167097848 CAATGTTCTCATCTGTAAAATGG + Intergenic
965381611 3:167996335-167996357 CAATGTTCTCAACCTGAAAAAGG - Intergenic
966052896 3:175642853-175642875 CAAAGTACACAAATGTAAAATGG + Intronic
966068154 3:175841446-175841468 CAATCTACTCATCTGAAAAAGGG + Intergenic
966307382 3:178551812-178551834 CAAGGTACACAACTTGTAGATGG + Intronic
966941626 3:184751659-184751681 CAGTGTCCTCAACTGTAAAATGG - Intergenic
966946683 3:184781755-184781777 CAAGAGACACAACTGGAAAATGG + Intergenic
966996786 3:185290003-185290025 CAATTTCCTCAACTGTAAAAAGG + Intronic
967238955 3:187417230-187417252 CAAGCTACTCATCTGACAAAGGG + Intergenic
967239637 3:187425309-187425331 CAAGCTACTCATCTGACAAAGGG - Intergenic
967468892 3:189839977-189839999 CAATTTACTTAACTGGCAAATGG + Intronic
967815375 3:193794030-193794052 CTGGGTCTTCAACTGGAAAATGG - Intergenic
968597390 4:1492470-1492492 CAAATTCCCCAACTGGAAAATGG - Intergenic
969393418 4:6906051-6906073 CAAGGAGCTCAACTGGGCAATGG - Intergenic
969416308 4:7061988-7062010 CAATGATCTCAACTGTAAAATGG + Intronic
970027618 4:11640186-11640208 CAATATACTCATCTGAAAAATGG - Intergenic
970085318 4:12339683-12339705 CAACCTACTCAACTGACAAAGGG + Intergenic
970111041 4:12638615-12638637 CAAAGTACTCATCTGTAAAGTGG + Intergenic
970240746 4:14006212-14006234 CAAGCTACTCATCTGACAAAGGG - Intergenic
970329464 4:14964634-14964656 CAATGTTCTCATCTGCAAAATGG + Intergenic
970475864 4:16422233-16422255 CAAGCTACTCATCTGACAAAGGG + Intergenic
970586105 4:17515891-17515913 CAGTGTACTCCTCTGGAAAATGG - Intronic
970762760 4:19511648-19511670 CAATGTCCTCATCTGAAAAATGG - Intergenic
971179976 4:24320867-24320889 CAAGGTCAACAGCTGGAAAATGG + Intergenic
971809290 4:31403084-31403106 CAATTTACTCATCTGTAAAATGG + Intergenic
972074890 4:35075153-35075175 CAATGTAGACAACTGTAAAAGGG - Intergenic
972174069 4:36381718-36381740 CAATCTACTCATCTGAAAAAGGG + Intergenic
972588419 4:40460500-40460522 CAGTTCACTCAACTGGAAAATGG + Intronic
972947129 4:44269630-44269652 CAACCTACTCATCTGAAAAAGGG + Intronic
972996440 4:44884676-44884698 CAACCTACTCATCTGAAAAAGGG + Intergenic
973876287 4:55222915-55222937 CAGGGTCCTCATCTGTAAAATGG + Intergenic
974181508 4:58389475-58389497 CAACCTACTCAACTGACAAAGGG - Intergenic
974820650 4:67063288-67063310 CAATGTACTCATCTGACAAAGGG - Intergenic
974944502 4:68510707-68510729 CAACCTACTCAACTGACAAAGGG - Intergenic
974983553 4:68991458-68991480 CAACGTACTCATCTGACAAAGGG - Intergenic
975016634 4:69429830-69429852 CAAGCTACTCATCTGACAAAAGG - Intergenic
975164688 4:71164793-71164815 CAATCTACTCAACTGACAAAGGG + Intergenic
975579326 4:75892470-75892492 CAATGTCCTCATCTGGAAAAGGG + Intronic
976358582 4:84150325-84150347 CAATTTTCTCAACTGTAAAATGG - Intergenic
978025666 4:103870682-103870704 AAAGGTAATCAATTAGAAAAAGG + Intergenic
978255308 4:106685783-106685805 CAACCTACTCATCTGAAAAAGGG - Intergenic
978257604 4:106711284-106711306 CAACCTACTCATCTGAAAAAGGG - Intergenic
978323753 4:107527147-107527169 CAACCTACTCATCTGAAAAAGGG + Intergenic
978687284 4:111460807-111460829 CAACCTACTCATCTGGCAAAGGG + Intergenic
978919734 4:114168938-114168960 CAACCTACTCATCTGGCAAAGGG - Intergenic
979473549 4:121128480-121128502 CAACATACTCATCTGGCAAAGGG + Intergenic
979752568 4:124297727-124297749 CAAGCTACTCATCTGACAAAGGG + Intergenic
979823745 4:125206689-125206711 CAAGTTCCTCATCTGTAAAATGG - Intergenic
980621288 4:135307831-135307853 CAATGTACTCATCTGACAAAGGG - Intergenic
981325845 4:143446695-143446717 CAACCTACTCATCTGGCAAAGGG - Intronic
981444924 4:144824560-144824582 CAACCTACTCATCTGGCAAAGGG - Intergenic
981601445 4:146493113-146493135 CAAGCTACAGAACTTGAAAAAGG + Intronic
982321311 4:154080241-154080263 CAAGAAACTCATCTGTAAAATGG - Intergenic
982492662 4:156048696-156048718 CAACGTACTCATCTGACAAAGGG - Intergenic
982650750 4:158085141-158085163 CAACGTACTCATCTGACAAAGGG - Intergenic
982754648 4:159203877-159203899 CTAGTTCCTCAACTGCAAAATGG - Intronic
982833007 4:160086827-160086849 AAAGGCACTCAATTTGAAAAGGG - Intergenic
983965884 4:173809187-173809209 TAAGGCACTAAACTGGAAATAGG - Intergenic
984011219 4:174374111-174374133 CAAATTACTTAACTGGAAGATGG - Intergenic
984227905 4:177057217-177057239 CAATGTTTTCAACTGTAAAATGG - Intergenic
984838447 4:184044668-184044690 CAACTGACACAACTGGAAAATGG - Intergenic
985532960 5:444318-444340 AAAGCTACTCATGTGGAAAAGGG - Intronic
987004586 5:13697085-13697107 CATGTAACTCAACTGGAAAAAGG + Intronic
987553530 5:19415032-19415054 CAATTTTCTCATCTGGAAAATGG - Intergenic
987716722 5:21580822-21580844 CAAGCTACTCATCTGACAAAGGG + Intergenic
987735754 5:21841097-21841119 CAAGCTACTCATCTGACAAAGGG + Intronic
988251212 5:28760224-28760246 CAACCTACTCAACTGACAAAGGG + Intergenic
988403218 5:30790045-30790067 CAAAGTACTCAATTGGAGACAGG + Intergenic
988676288 5:33436415-33436437 CAATCTACTCATCTGGCAAAGGG - Intergenic
988810512 5:34780462-34780484 CAATGTACTCATCTGACAAAGGG + Intronic
989033244 5:37141840-37141862 CAATCTCCTCAACTGTAAAATGG + Intronic
989105689 5:37861250-37861272 CAATGTCCTCATCTGGAAAAAGG - Intergenic
989528285 5:42477784-42477806 CAATGTACTCATCTGACAAAGGG - Intronic
989616897 5:43346064-43346086 CAATGTACTCATCTGACAAAGGG + Intergenic
989971800 5:50534070-50534092 CAACCTACTCATCTGGCAAAGGG + Intergenic
990160418 5:52932883-52932905 CAAATTCTTCAACTGGAAAATGG - Intronic
990175233 5:53100410-53100432 CAAGGTGCCCATATGGAAAAAGG - Exonic
990434230 5:55771855-55771877 AAAGATACTCAACAGAAAAATGG - Intronic
990460538 5:56027390-56027412 CAATTCCCTCAACTGGAAAATGG + Intergenic
990474800 5:56151990-56152012 CAAGCTACTGAACTAGAAACTGG + Intronic
990934123 5:61128889-61128911 CAATCTACTCAACTGACAAAGGG + Intronic
991179519 5:63733602-63733624 CAACCTACTCATCTGGCAAAGGG - Intergenic
992101324 5:73410307-73410329 GAAGGTACCCAAAGGGAAAAAGG + Intergenic
992116324 5:73541478-73541500 CATGGTACTGAGCAGGAAAATGG - Intergenic
992345902 5:75878318-75878340 CAACTTCCTCAACTGCAAAATGG - Intergenic
992381497 5:76242125-76242147 GAAGGTACCCAAAGGGAAAAAGG - Intronic
992397257 5:76379351-76379373 CAAGTTCCTCATCTGTAAAATGG + Intergenic
992973632 5:82088776-82088798 TAGGGTACTCAACAGGACAATGG - Intronic
993029241 5:82685335-82685357 CAAGGTCTTCAGCTGGAAAATGG - Intergenic
993212814 5:84976297-84976319 CAATCTACTCAACTGACAAAGGG - Intergenic
994280613 5:97898055-97898077 CAATGTACTCATCTGACAAAGGG - Intergenic
994390073 5:99181816-99181838 CAATCTACTCATCTGAAAAAGGG - Intergenic
994496025 5:100515170-100515192 CAACCTACTCAACTGACAAAGGG - Intergenic
994500638 5:100573153-100573175 CAACCTACTCAACTGACAAAGGG - Intronic
994616571 5:102111733-102111755 CAATGTACTCATCTGACAAAGGG - Intergenic
994621308 5:102166194-102166216 CAATCTACTCATCTGAAAAAGGG + Intergenic
995058126 5:107784943-107784965 CAAGGAACCCAGCTGGAAAAAGG - Intergenic
995117296 5:108495646-108495668 CAATCTACTCATCTGAAAAAGGG + Intergenic
995664955 5:114531548-114531570 CAAGCTACTCATCTGACAAAGGG - Intergenic
995950479 5:117706454-117706476 CAATCTACTCAACTGACAAAGGG - Intergenic
996025609 5:118642358-118642380 CAAGCTACTCATCTGACAAAGGG + Intergenic
996051697 5:118942080-118942102 CAATCTACTCATCTGAAAAAGGG - Intronic
996461422 5:123747927-123747949 CAGGGTACTTTACTGGAAAATGG + Intergenic
996660061 5:125991685-125991707 CAAGGTGTTCAAATGCAAAATGG - Intergenic
996725505 5:126670419-126670441 CAACCTACTCATCTGAAAAAGGG + Intergenic
997490802 5:134274285-134274307 CAAGGCACTCAAATGGATAATGG + Intergenic
997612140 5:135222793-135222815 CAGTTTACTCATCTGGAAAATGG - Intronic
997708627 5:135983417-135983439 CAACCTACTCATCTGGCAAAGGG - Intergenic
997805563 5:136913776-136913798 CAACGTACTCATCTGACAAAGGG - Intergenic
998930194 5:147173103-147173125 CAATGTACTCATCTGTAAAATGG - Intergenic
1000188292 5:158882449-158882471 CCAGGTACTCAACCAGCAAAGGG + Intronic
1000767234 5:165307563-165307585 CAATGTATTCATCTGTAAAATGG - Intergenic
1001179728 5:169508526-169508548 CAAGCTACTCATCTGACAAAGGG - Intergenic
1001336263 5:170799682-170799704 CAATGTACTCATCTGACAAAGGG - Intronic
1001843440 5:174901006-174901028 CCAGGTACTCAGCAGAAAAAGGG - Intergenic
1202774700 5_GL000208v1_random:58345-58367 CAACCTACTCATCTGAAAAAGGG - Intergenic
1002919584 6:1557406-1557428 CAGTGTACTCAGGTGGAAAATGG - Intergenic
1003144003 6:3494365-3494387 CAATTTCCTCATCTGGAAAATGG + Intergenic
1003181232 6:3793558-3793580 CAATGTCCTCATCTGGCAAATGG + Intergenic
1004265212 6:14143496-14143518 CAATTTACTCATCTGGTAAATGG + Intergenic
1004273338 6:14213732-14213754 CAAGGTCCACAACTGGTAAATGG + Intergenic
1004667890 6:17765460-17765482 CAAAGAACCCAACTGCAAAAGGG + Intronic
1004954863 6:20718198-20718220 CAGGGAAATGAACTGGAAAATGG - Intronic
1005137684 6:22589594-22589616 CAGTGGACTCAACTGTAAAATGG + Intergenic
1005762927 6:28984485-28984507 CAATTTTCTCAACTGTAAAATGG + Intergenic
1005779717 6:29177499-29177521 CAAGCTACTCATCTGACAAAGGG - Intergenic
1006792879 6:36715282-36715304 TCAGGTACTCATCTGTAAAATGG + Intronic
1006797021 6:36738314-36738336 CAGTGTTCTCATCTGGAAAATGG + Intergenic
1006998517 6:38285543-38285565 CCAGGTAAGCAAATGGAAAACGG + Intronic
1007486695 6:42185370-42185392 CAATTTCCTCATCTGGAAAATGG - Intronic
1007979135 6:46132055-46132077 CAATCTACTCATCTGAAAAAGGG - Intronic
1008762101 6:54863424-54863446 CATGGTGCTCACCAGGAAAAAGG - Intronic
1008917588 6:56806276-56806298 CAAAATACTCCAGTGGAAAATGG + Intronic
1009330880 6:62418379-62418401 CAATCTACTCATCTGAAAAAGGG + Intergenic
1009592311 6:65688613-65688635 CAAACTACTCATCTGAAAAAGGG + Intronic
1009757699 6:67960911-67960933 AAAGGTATTAAACTGGTAAATGG + Intergenic
1009829284 6:68910307-68910329 CAATCTACTCAACTGACAAAGGG - Intronic
1009855315 6:69255603-69255625 CAACCTACTCATCTGAAAAAGGG - Intronic
1010077447 6:71816867-71816889 CAATCTACTCATCTGAAAAAGGG - Intergenic
1010604675 6:77873505-77873527 CAACGTACTCACCTGACAAAGGG - Intronic
1010780254 6:79937511-79937533 CAGTTTACTCACCTGGAAAATGG + Intronic
1011390148 6:86843414-86843436 CAAGCTACTCATCTGACAAAGGG - Intergenic
1011711494 6:90059214-90059236 CAAGCTACTCATCTGACAAAGGG + Intronic
1012147943 6:95709735-95709757 CAATCTACTCATCTGAAAAAGGG + Intergenic
1012416070 6:99015380-99015402 CAATGTACTCATCTGTAAATGGG - Intergenic
1012421186 6:99066979-99067001 CAGGCTTCTCAACTGTAAAATGG - Intergenic
1012829828 6:104189931-104189953 CAATCTACTCATCTGAAAAAGGG + Intergenic
1012834355 6:104246428-104246450 CAATCTACTCATCTGAAAAAGGG + Intergenic
1012862138 6:104572515-104572537 CAATGTCCTCATCTGTAAAATGG + Intergenic
1013042083 6:106445393-106445415 CAATGAACTCATCTGAAAAATGG + Intergenic
1013094441 6:106931875-106931897 GAAGGTACCCAAAGGGAAAAAGG - Intergenic
1013284613 6:108670474-108670496 CAAGATAGTGAAATGGAAAATGG + Intronic
1013468470 6:110438878-110438900 CTAGGTACCCGACTGCAAAAGGG + Intronic
1013574522 6:111468441-111468463 CAAGAGTCTCAACAGGAAAATGG + Intronic
1013613741 6:111821724-111821746 CAATCTACTCATCTGAAAAAGGG + Intronic
1013656162 6:112248904-112248926 CAATGAACTCATCTGTAAAATGG + Intronic
1013921697 6:115413288-115413310 CAATGTCTTCATCTGGAAAATGG + Intergenic
1014121154 6:117726522-117726544 CAAACTACTCATCTGAAAAAGGG + Intergenic
1014141232 6:117945444-117945466 CAATCTACTCATCTGTAAAATGG - Intronic
1014222574 6:118812704-118812726 GAAGGTACTAAAATGGAAAGTGG + Intergenic
1014764643 6:125392598-125392620 CAAGGTAACCAACTAGTAAATGG + Intergenic
1016066978 6:139694100-139694122 CAAAGTATTCAACTGGATCAAGG - Intergenic
1016296845 6:142582232-142582254 CAAGCTACTCATCTGACAAAGGG + Intergenic
1018155190 6:160979042-160979064 CACTGTAAACAACTGGAAAATGG + Intergenic
1018350838 6:162957170-162957192 CAGGGTCCTCACCTGGAGAATGG + Intronic
1018962597 6:168459102-168459124 CAAGTTCCTCATCTGCAAAATGG - Intronic
1019487937 7:1297912-1297934 CAATATATTCATCTGGAAAAGGG - Intergenic
1019499535 7:1358103-1358125 CAGCGTCCTCATCTGGAAAATGG - Intergenic
1019838017 7:3410003-3410025 CAATGTCCTCACCTGTAAAAGGG + Intronic
1022301821 7:29108975-29108997 CAAGTTACTCAACTAGAAATTGG - Intronic
1022618057 7:31952674-31952696 CAAGTTCCACATCTGGAAAATGG + Intronic
1022695204 7:32698552-32698574 CAAGCTACTCATCTGACAAAGGG - Intergenic
1022775437 7:33522648-33522670 CAAGCTACTCATCTGACAAAGGG - Intronic
1022778198 7:33549517-33549539 CAAGCTACTCATCTGACAAAGGG + Intronic
1023169892 7:37380362-37380384 CCAGGTACTATACTGGGAAATGG - Intronic
1023494014 7:40775273-40775295 CAGGGTACGTAATTGGAAAAAGG - Intronic
1023625740 7:42113500-42113522 GAAGGTACCCAAAGGGAAAAAGG + Intronic
1023814339 7:43938166-43938188 CAAGGTACAGAGCTGGAAGAGGG - Intronic
1023860237 7:44213997-44214019 CAGGGTCCTCAAGTGGGAAAGGG - Exonic
1025038328 7:55617003-55617025 CAGGTTAGTCAACTGGCAAAAGG - Intergenic
1027933707 7:84574722-84574744 AAAGATAATGAACTGGAAAACGG - Intergenic
1028585949 7:92451818-92451840 CAATGTTCTCATCTAGAAAATGG - Intronic
1029827089 7:103209048-103209070 CAAGCTACTCATCTGACAAAGGG + Intergenic
1029918402 7:104236145-104236167 CAACCTACTCATCTGGCAAAGGG - Intergenic
1030483399 7:110133099-110133121 CAATGTACTCATCTGACAAAGGG - Intergenic
1030500218 7:110350647-110350669 CAAGCTACTCATCTGACAAAGGG + Intergenic
1030536350 7:110771834-110771856 CAAGTTACTCATCTGTAAAGTGG - Intronic
1030581267 7:111358772-111358794 CAAGGGAGACAACTGGAAATGGG + Intronic
1030590072 7:111469964-111469986 CAAGCTACTCATCTGACAAAGGG + Intronic
1030833074 7:114250698-114250720 CAATCTACTCATCTGGCAAAGGG - Intronic
1031179173 7:118393214-118393236 CAATGTACTCATCTGACAAAGGG + Intergenic
1031577075 7:123427753-123427775 CAACCTACTCAACTGACAAAGGG - Intergenic
1031739804 7:125415958-125415980 CAAGCTACTCATCTGACAAAGGG + Intergenic
1032362206 7:131266335-131266357 CAATGTACTCATTTGTAAAATGG + Intronic
1032552181 7:132794365-132794387 CAATGCTCTCAACTGGAAAATGG + Intronic
1035900221 8:3451216-3451238 CAATGTACTCATCTGACAAAGGG - Intronic
1036015732 8:4781648-4781670 CAATGTATTCAACTGTAAAATGG + Intronic
1036116227 8:5963143-5963165 CTAGATCCTCAACTGCAAAATGG + Intergenic
1036978523 8:13442444-13442466 CAATCTACTCATCTGAAAAAGGG + Intronic
1037123317 8:15316042-15316064 CAACGTACTGAACTGAAACAAGG + Intergenic
1037146299 8:15577213-15577235 CAAGCTACTCATCTGACAAAGGG - Intronic
1037471942 8:19219308-19219330 CAATTTTCTCATCTGGAAAATGG - Intergenic
1037696234 8:21226640-21226662 CAAGGTCATCAGCTGGGAAAAGG - Intergenic
1038230019 8:25691103-25691125 CAGGGTCCTCATCTGTAAAATGG - Intergenic
1039324604 8:36470897-36470919 CAATTTACTCATCTGGCAAAGGG + Intergenic
1039764706 8:40615976-40615998 CAATCTACTCATCTGAAAAAGGG + Intronic
1040445593 8:47490092-47490114 CAATCTACTCATCTGAAAAAGGG + Intronic
1040451253 8:47549666-47549688 CAATCTACTCATCTGAAAAAGGG - Intronic
1040774890 8:51029954-51029976 CAATCTACTCATCTGAAAAAGGG - Intergenic
1041841669 8:62279273-62279295 CAATCTACTCACCTGAAAAAGGG - Intronic
1041891969 8:62879413-62879435 CAATCTACTCATCTGGAAAAGGG - Intronic
1041918693 8:63160632-63160654 CGGGGCACTCCACTGGAAAAGGG - Intergenic
1041999374 8:64103595-64103617 CAATGTGATCAACTGGAAGAAGG + Intergenic
1042518871 8:69689239-69689261 CAAGCTACTCATCTGACAAAGGG - Intronic
1042698710 8:71586836-71586858 CAATGTACTCATCTGACAAAGGG + Intronic
1043455702 8:80409829-80409851 CACGGTTCTCAGCTGGAACATGG - Intergenic
1043857544 8:85278883-85278905 CAAGTTTCTCATCTGTAAAAGGG + Intronic
1044273045 8:90269334-90269356 CAATGTACTCATCTGACAAAGGG + Intergenic
1044478993 8:92662901-92662923 CAATCTACTCATCTGGCAAAGGG + Intergenic
1045057424 8:98381686-98381708 CCATGTACTCATCTGTAAAATGG - Intergenic
1045145288 8:99336602-99336624 CAAGCTACTCATCTGACAAAGGG + Intronic
1045163234 8:99573200-99573222 CAAGCTACTCATCTGACAAAGGG - Intronic
1045241572 8:100407032-100407054 CAATCTACTCATCTGGCAAAGGG + Intronic
1045263908 8:100602966-100602988 CAATTTACTCATCTGTAAAATGG - Intronic
1045497831 8:102723062-102723084 CAGTTTCCTCAACTGGAAAATGG + Intergenic
1045774785 8:105789986-105790008 CAAGCTACTCATCTGACAAAGGG - Intronic
1046099961 8:109602890-109602912 CAAGGAACTCAAATGAGAAAGGG + Intronic
1046468809 8:114641022-114641044 CAAGCTACTCATCTGACAAAGGG - Intergenic
1047102728 8:121695748-121695770 CAAGGTGATCAAATGGTAAAGGG + Intergenic
1047721950 8:127649302-127649324 CAAAGCACTCAACTGGAACCAGG + Intergenic
1047846042 8:128806456-128806478 CAAGCTACTCATCTGACAAAGGG + Intergenic
1048200787 8:132372384-132372406 CAAGCTTCTCATCTGTAAAATGG + Intronic
1048325312 8:133434592-133434614 CAACGTCCTCACCTGTAAAATGG - Intergenic
1048499871 8:134965747-134965769 CAGGGTTCTCATCTGAAAAATGG - Intergenic
1048561606 8:135544582-135544604 CAAGGTGCTCATCAGCAAAATGG - Intronic
1048818239 8:138354383-138354405 AAAGGTACAGAAATGGAAAAGGG - Intronic
1050067844 9:1779372-1779394 CAATCTACTCATCTGAAAAAGGG - Intergenic
1050870300 9:10559648-10559670 CAACCTACTCACCTGAAAAAGGG + Intronic
1050985707 9:12079390-12079412 CAATCTACTCATCTGAAAAAGGG - Intergenic
1051116576 9:13700876-13700898 CAATCTACTCATCTGGCAAAGGG + Intergenic
1051139263 9:13961134-13961156 CAGCTTCCTCAACTGGAAAATGG - Intergenic
1051514427 9:17912587-17912609 CAAGCTACTCATCTGACAAAGGG - Intergenic
1051708176 9:19902340-19902362 CAAGGCAGGCAAATGGAAAAAGG + Intergenic
1052024928 9:23563649-23563671 CAAGATACTCAACAGGCCAACGG - Intergenic
1052150351 9:25107221-25107243 CAAGCTACTCATCTGACAAAGGG + Intergenic
1052154892 9:25173386-25173408 CAAGCTACTCATCTGACAAAGGG + Intergenic
1052273098 9:26647992-26648014 CAATGTCCTCATCTGTAAAAGGG + Intergenic
1054276871 9:63087700-63087722 CAAGCTACTCATCTGACAAAGGG - Intergenic
1054397966 9:64677230-64677252 CAAGCTACTCATCTGACAAAGGG + Intergenic
1054432606 9:65182424-65182446 CAAGCTACTCATCTGACAAAGGG + Intergenic
1054497779 9:65839252-65839274 CAAGCTACTCATCTGACAAAGGG - Intergenic
1054826195 9:69575947-69575969 CAAGCTACTCATCTGACAAAGGG + Intronic
1054923842 9:70568617-70568639 CAATTTACTCATCTGTAAAATGG - Intronic
1055263652 9:74470428-74470450 CAATGTCCTCATCTGCAAAATGG + Intergenic
1056559715 9:87719391-87719413 CACTGTACTCATCTGTAAAATGG + Intergenic
1056566403 9:87776683-87776705 CACTGTACTCATCTGTAAAATGG - Intergenic
1056675046 9:88668560-88668582 CAATCTACTCATCTGGCAAAAGG - Intergenic
1056730592 9:89162833-89162855 CAAGCTACTCATCTGACAAAGGG + Intronic
1056757932 9:89393907-89393929 CAATTTACTCATCTGCAAAATGG + Intronic
1057052137 9:91933334-91933356 CAAAGTACTGGACTGGAAATTGG + Intronic
1057295879 9:93840249-93840271 CAAGCTACTCATCTGACAAAGGG - Intergenic
1057754410 9:97820371-97820393 CAGGGTCCTCATCTGAAAAATGG - Intergenic
1058741392 9:107946261-107946283 CAAAGTTCTCAACTGGTCAAAGG + Intergenic
1058986601 9:110213735-110213757 CAAGTTTCCCATCTGGAAAATGG - Intergenic
1059002150 9:110359716-110359738 CAATGTACTCATCTGACAAAGGG - Intergenic
1059003722 9:110378499-110378521 CAATGTACTCATCTGACAAAGGG - Intronic
1059071098 9:111137051-111137073 CAAGTAACTCAACTGAAAATGGG + Intergenic
1059590785 9:115659063-115659085 CAAGATTCTCAAATGGCAAATGG - Intergenic
1059666054 9:116447643-116447665 CAAGGTACTCACCTGTACAACGG + Intronic
1059940824 9:119358055-119358077 CAATGTTCTCATCTGGAAAATGG + Intronic
1060152269 9:121296272-121296294 CAAGTCACTCAACTGGAAAGAGG - Intronic
1060158278 9:121335705-121335727 CAAGTTACCCACCTGCAAAATGG + Intergenic
1060235156 9:121857464-121857486 TAGGGTACTCATCTGTAAAAAGG + Intronic
1060342189 9:122787557-122787579 CAATGTTCTCATCTGGATAATGG - Intergenic
1060641503 9:125242493-125242515 CAATGTCCTCATCTGGAAAACGG - Intergenic
1061429113 9:130519932-130519954 CCATGGACTCAACTGGAAGAGGG + Intergenic
1061766805 9:132886646-132886668 CATGGTACTGATCTGTAAAATGG + Intronic
1203683318 Un_KI270757v1:8449-8471 CAACCTACTCATCTGAAAAAGGG + Intergenic
1186351314 X:8742459-8742481 CAGTGTTCTCAAATGGAAAATGG + Intergenic
1187302891 X:18068430-18068452 CAAGCTACTCATCTGACAAAGGG - Intergenic
1187307551 X:18109993-18110015 CAAGCTACTCATCTGACAAAGGG + Intergenic
1188239138 X:27763793-27763815 CAATCTACTCATCTGAAAAATGG + Intergenic
1188894990 X:35656396-35656418 CATGGTACTGAAATGCAAAAAGG - Intergenic
1189494150 X:41494033-41494055 CAATGCACTCATCTGTAAAATGG - Intergenic
1189669029 X:43388046-43388068 GAGGGCACTCCACTGGAAAAGGG - Intergenic
1189921583 X:45908105-45908127 CTAGGAACTCAAGTGAAAAAGGG + Intergenic
1189970216 X:46410787-46410809 CAAGCTACTCATCTGACAAAGGG - Intergenic
1190162101 X:48039932-48039954 CAACCTACTCATCTGGCAAAGGG - Intronic
1190492483 X:50996505-50996527 CAAGTTTCTTAACTGGATAAAGG + Intergenic
1190844413 X:54178541-54178563 TCAGTTACTCAACTGTAAAATGG + Intronic
1190982156 X:55465756-55465778 CAGTTTACTCATCTGGAAAAAGG - Intergenic
1190986542 X:55507426-55507448 CAGTTTACTCATCTGGAAAAAGG + Intergenic
1191627757 X:63286903-63286925 CAATGTACTCATCTGACAAAGGG - Intergenic
1191647455 X:63497328-63497350 CAATGTACTCATCTGACAAAGGG + Intergenic
1191745810 X:64485292-64485314 CAATCTACTCATCTGAAAAAGGG + Intergenic
1191785761 X:64915804-64915826 CAGTGTCCTCATCTGGAAAATGG - Intronic
1191789431 X:64953411-64953433 CAATGTACTCATCTGACAAAGGG + Intronic
1192041529 X:67627532-67627554 CAACGTACTCATCTGACAAAGGG - Intronic
1192175820 X:68884766-68884788 CAACGTCCTCATCTGTAAAATGG - Intergenic
1192206719 X:69101212-69101234 CAATGTCCTCATCTGTAAAATGG + Intergenic
1192596904 X:72419754-72419776 GAAGTTACTCAACATGAAAAAGG - Intronic
1192669242 X:73122016-73122038 CAATGTACTCATCTGACAAAGGG + Intergenic
1192748840 X:73966644-73966666 CAAGGTACACACCTGGGAGAGGG - Intergenic
1192980935 X:76340588-76340610 CAATCTACTCATCTGGCAAAGGG + Intergenic
1193030009 X:76887428-76887450 CAACCTACTCATCTGGCAAAGGG + Intergenic
1193243903 X:79206600-79206622 CAACCTACTCATCTGAAAAAGGG - Intergenic
1193684518 X:84560766-84560788 CAATCTACTCATCTGGCAAAGGG + Intergenic
1194514346 X:94832379-94832401 CATTTTACTCATCTGGAAAATGG - Intergenic
1195099965 X:101545443-101545465 CAACGTACTCATCTGACAAAGGG + Intergenic
1196147204 X:112331247-112331269 CAACCTACTCAACTGACAAAGGG + Intergenic
1196163061 X:112507141-112507163 CAACCTACTCATCTGAAAAAGGG + Intergenic
1196509370 X:116488906-116488928 CACCTTACTCAACTGCAAAATGG - Intergenic
1196600534 X:117596961-117596983 CAATCTACTCATCTGGCAAAGGG + Intergenic
1196689184 X:118541193-118541215 CATGGTACTGAACTGGGAATGGG - Intronic
1196993449 X:121354099-121354121 CAAGTTACTCTTCTGTAAAATGG + Intergenic
1197059594 X:122161478-122161500 CAACCTACTCATCTGGCAAAGGG - Intergenic
1197556615 X:127963554-127963576 AAAGATACACAACTGCAAAATGG - Intergenic
1197860408 X:130964034-130964056 CAACGTACTCATCTGACAAAGGG + Intergenic
1197888774 X:131246444-131246466 CAACCTACTCATCTGAAAAAGGG - Intergenic
1198342171 X:135725387-135725409 CAATCTACTCATCTGAAAAAGGG - Intergenic
1198345820 X:135757908-135757930 CAATCTACTCATCTGAAAAAGGG + Intergenic
1198673215 X:139104027-139104049 CAAGTTTCTCATCTGCAAAATGG + Intronic
1199097861 X:143763198-143763220 CAATGTACTCATCTGGCAAAGGG - Intergenic
1201304330 Y:12537604-12537626 CACCGTACTCTACTGGACAAGGG + Intergenic
1201414568 Y:13735407-13735429 CATTGTTCTCAACTGCAAAATGG - Intergenic
1202072503 Y:21006816-21006838 CAACCTACTCATCTGAAAAAGGG - Intergenic
1202075146 Y:21030097-21030119 CAACCTACTCATCTGAAAAAGGG - Intergenic
1202077207 Y:21048652-21048674 CAACCTACTCATCTGAAAAAGGG - Intergenic
1202296140 Y:23359412-23359434 CAACGTACTCATCTGACAAAGGG - Intergenic
1202574667 Y:26311184-26311206 CAACGTACTCATCTGACAAAGGG + Intergenic