ID: 1092495260

View in Genome Browser
Species Human (GRCh38)
Location 12:8986959-8986981
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 407
Summary {0: 9, 1: 14, 2: 43, 3: 81, 4: 260}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092495260 Original CRISPR CTCAGGAAACTTAGTCATGG TGG (reversed) Intronic
900648477 1:3719576-3719598 CTCAGGAGACTCAGACAGGGAGG - Intronic
900760775 1:4468697-4468719 CTCAGGAGACCAAGTCATGATGG - Intergenic
901682343 1:10920461-10920483 ATAAGGAAACGGAGTCATGGAGG - Intergenic
902820843 1:18942293-18942315 CTCTGGAAACATAGTCTTTGTGG - Intronic
902972220 1:20062083-20062105 CTCAGGAAGCTTAGTCATAGTGG - Intronic
903360284 1:22772661-22772683 CTCAGGAAACTCAGTCAGGCTGG + Intronic
904456051 1:30648849-30648871 CTCAGGGAACTTACTAAAGGCGG - Intergenic
905292126 1:36929074-36929096 ATGAGGAAACTGAGTCATAGAGG + Intronic
905688053 1:39922852-39922874 CTCAGTAAACTTATTCGTGGAGG + Intergenic
905698159 1:39991255-39991277 CTCAGTAAACTTATTCGTGGAGG + Intergenic
906187928 1:43875682-43875704 CTCAGGAAACACAATCATGGCGG - Intronic
906871575 1:49487608-49487630 CTCAGGAAACATAATCATGGTGG - Intronic
907633439 1:56107515-56107537 CTCAGGAAACCTGGTCATGAAGG + Intergenic
907724052 1:57002242-57002264 CACAGGAGACTAAGTCATGCAGG + Intronic
908346009 1:63233831-63233853 CTCAGGAAACATAATCATGGAGG + Intergenic
909259799 1:73472880-73472902 CTCAGAAAACACAATCATGGCGG + Intergenic
909798459 1:79774603-79774625 CTCAGGAAACATAATCATGGTGG + Intergenic
910104100 1:83611914-83611936 CTCACGAAATTTTGTCATGCTGG - Intergenic
910265693 1:85334651-85334673 CTCAGGAAACCTAATCATGGTGG - Intronic
910826744 1:91417126-91417148 TTCAGGAAACTTAATAATCGTGG - Intergenic
911735373 1:101331172-101331194 CTCAGGAAACTCAATCATGGTGG + Intergenic
911868283 1:103056462-103056484 CCAAGGAGACTCAGTCATGGGGG + Intronic
911972283 1:104453316-104453338 CTCAGGAAATGTAGTCATGGAGG - Intergenic
912112876 1:106364524-106364546 CTCAGGAAACTTAGTCATGGTGG - Intergenic
913677153 1:121151506-121151528 ATGAGGAAACTCAGACATGGAGG - Intergenic
914028991 1:143939135-143939157 ATGAGGAAACTCAGACATGGAGG - Intergenic
914160460 1:145128815-145128837 ATGAGGAAACTCAGACATGGAGG + Intergenic
914419516 1:147516517-147516539 CTCAGGAAACTCAGTCTGGTTGG - Intergenic
915886518 1:159728185-159728207 CTCAGGAAACACAATCAAGGTGG + Intergenic
916512361 1:165483578-165483600 CTCAGAAAACTTAATCATGGTGG + Intergenic
918752582 1:188290884-188290906 CACAGGAAACCTAATCATGGTGG + Intergenic
919165628 1:193887930-193887952 CTCAGGAAACTTAATCGTGGCGG - Intergenic
919422186 1:197383705-197383727 CTCAGGAAACACTGGCATGGAGG - Intronic
919629239 1:199943814-199943836 CTAAGGAAACGTAGGGATGGAGG + Intergenic
920380029 1:205529803-205529825 CTGAGGAAACTGAGGCATGGAGG - Intronic
921465218 1:215478674-215478696 CTCAGGAAATTAAATTATGGTGG + Intergenic
921880651 1:220250867-220250889 CTCAGGAAACACAGTGGTGGAGG - Intronic
922174001 1:223180751-223180773 CTCAGGAAACAAACTCATGCAGG - Intergenic
923179026 1:231498414-231498436 ATCAGGAAACACAATCATGGTGG + Intergenic
923410004 1:233698715-233698737 CTCAGGAAACACAATCATGGTGG + Intergenic
923752376 1:236757774-236757796 CTTAGGACACTTAGTTTTGGTGG - Intronic
1062906562 10:1183530-1183552 CACAGGAAACCTAGTCATCAAGG + Intronic
1063129836 10:3168712-3168734 CTCAGGAAACACAATCGTGGTGG - Intronic
1063783085 10:9349441-9349463 CTCAGGAAACTTAATCGTGGTGG + Intergenic
1064039140 10:11943424-11943446 CTCAGGAAACTTCTTCATTGTGG - Intronic
1064627955 10:17280880-17280902 CTCAGGAAACACAATCATGGTGG + Intergenic
1066016081 10:31245377-31245399 CTCTGCACACTTAGTCATGTGGG - Intergenic
1066128138 10:32362520-32362542 CTTAGGAAACATAGTCATGGTGG - Intronic
1068036647 10:51767861-51767883 TCCAGGAAAATTAGCCATGGAGG + Intronic
1068823693 10:61409335-61409357 CTCAGGGAACATGGTGATGGAGG - Exonic
1068944120 10:62711439-62711461 TTCAGGAATCTTAATCATGATGG + Intergenic
1069972648 10:72186234-72186256 CTCAGGAGGCTGAGTCAGGGAGG - Intronic
1070428441 10:76312233-76312255 CTCAGGAATCTGAGGCATGATGG + Intronic
1070984194 10:80673961-80673983 TTCAGGAAACTTCCACATGGTGG - Intergenic
1071197492 10:83178025-83178047 CTCAGGAAACACAATCATGGAGG + Intergenic
1071390805 10:85173658-85173680 CTGAGGAAACTGAGTCTTAGAGG - Intergenic
1071698424 10:87903213-87903235 CTCTGGAAGCTTCGTCTTGGGGG + Intronic
1071860624 10:89669047-89669069 CTTAGGGAACTTAGTCATGGCGG + Intergenic
1072641825 10:97216730-97216752 CTCAGGAAACACAATTATGGTGG - Intronic
1073670764 10:105585205-105585227 CTTAGGAAATTTAGTCATTTTGG + Intergenic
1075987819 10:126803421-126803443 AGCAGGAAACTAGGTCATGGTGG - Intergenic
1080986286 11:37470365-37470387 CTCAGGAAACTTAATGATCATGG + Intergenic
1081003145 11:37699734-37699756 CTAAGGAACCATAATCATGGTGG + Intergenic
1082613775 11:55334641-55334663 CTCTGGAAGCTTCGTCTTGGAGG + Intergenic
1083279461 11:61617722-61617744 CTCAGCATCATTAGTCATGGGGG - Intergenic
1083561090 11:63673764-63673786 CTTTGGAACCTGAGTCATGGTGG - Intergenic
1086731173 11:90251258-90251280 CTCAGGAAAAATATTCGTGGTGG - Intergenic
1087077278 11:94136932-94136954 CTCGGGAAACACAGTCATGGCGG + Intronic
1087185864 11:95194272-95194294 CTCAGGTTACCTAGTAATGGGGG - Intronic
1087939333 11:104076180-104076202 TTCAGGAAACATAATCATGGTGG - Intronic
1090117204 11:123985452-123985474 CACAGGAAACTTGGATATGGGGG + Intergenic
1090312781 11:125756683-125756705 CTCTGGAAGCTTTGTCCTGGAGG - Intergenic
1091020115 11:132091812-132091834 CTCAGGAAACTTACTGATAATGG - Intronic
1092495260 12:8986959-8986981 CTCAGGAAACTTAGTCATGGTGG - Intronic
1092940394 12:13402376-13402398 CTCAGGAAACTTAACAATCGTGG - Intergenic
1093022353 12:14215704-14215726 CTCAAGGAACTTAGTCTTGTTGG + Intergenic
1093293639 12:17360463-17360485 GCCGGGAAACTCAGTCATGGTGG - Intergenic
1093570855 12:20664133-20664155 CTCAGGAAACATAATCATGGTGG - Intronic
1093791216 12:23252578-23252600 GTGAGGAAACTGAGTCATGAGGG + Intergenic
1095109747 12:38279935-38279957 CTCAGGAAACTTAGTCATGGTGG - Intergenic
1097846535 12:64372187-64372209 TTGAGGAAACTGAGGCATGGAGG + Intronic
1098223180 12:68291894-68291916 CTTGGGAAACTGAGTAATGGTGG + Intronic
1098899195 12:76095316-76095338 CTCAGGAGGCTGAGGCATGGAGG + Intergenic
1099076436 12:78114458-78114480 CTCAGGAAACAGAATCATGGTGG + Intronic
1099767675 12:87009473-87009495 ATAAGGTAAATTAGTCATGGTGG + Intergenic
1099969221 12:89483319-89483341 CTCAGGAAACTTACAAATTGTGG - Intronic
1100216774 12:92458528-92458550 ATCAGGAAACACAATCATGGTGG + Intergenic
1100708564 12:97228717-97228739 CTCTGGAATCTCAGTCTTGGAGG + Intergenic
1101421719 12:104556258-104556280 CTCAGGAGACTTATTCTAGGTGG + Intronic
1102600162 12:114023593-114023615 CTCAGGAAACTTAGTCATGGCGG - Intergenic
1103031832 12:117621246-117621268 CTCAGGAAACTTAGTTATGGTGG - Intronic
1104981332 12:132574260-132574282 CTCAGGAGGCTGAGTCCTGGGGG - Intronic
1106014111 13:25851948-25851970 CTCAGGAAACTGAGGCAGGACGG - Intronic
1106677554 13:31977129-31977151 CTGAGGAAACTGAGGCCTGGGGG - Intergenic
1107672167 13:42757420-42757442 CTCAGGAAACAGAATCATGGTGG + Intergenic
1109804839 13:67425644-67425666 CTCAGGAAACACAATCATGGTGG + Intergenic
1109928078 13:69173856-69173878 TTCAGGAAACTGAGTAAAGGTGG - Intergenic
1110827233 13:79986859-79986881 CTAAGGGAACCCAGTCATGGAGG - Intergenic
1111183880 13:84703318-84703340 CTAAGGAAACATATTCTTGGAGG - Intergenic
1111483878 13:88869251-88869273 CTCAGGAAATAAAATCATGGTGG - Intergenic
1113013102 13:105793419-105793441 CTCAGGAAACATATTCATGGCGG + Intergenic
1113450881 13:110408398-110408420 TTCAGGAAGCATGGTCATGGAGG - Intronic
1113573131 13:111372909-111372931 CTCAGAAAACTCAGTCGTGGTGG - Intergenic
1114780576 14:25534008-25534030 CTCAGGAAACACAATCATGGTGG + Intergenic
1115505140 14:34086616-34086638 CTCAGGAAACACAATCATGGAGG + Intronic
1116003558 14:39268877-39268899 CTGTGGTAACTTATTCATGGAGG + Intronic
1116712917 14:48391935-48391957 CTCAGGAAACTTAGTCATGGCGG + Intergenic
1116713219 14:48396312-48396334 CTCAGGAAACTTAATCATGGTGG - Intergenic
1118046340 14:61975479-61975501 CTCAGCAAACTTAATCATGATGG + Intergenic
1118369508 14:65125487-65125509 CTCAGGAAACACAATCATAGTGG + Intergenic
1120406944 14:84102344-84102366 CTCAGGAAACAGAATTATGGTGG - Intergenic
1120771260 14:88382967-88382989 CTCAGGAAACACTATCATGGTGG - Intergenic
1120959619 14:90112761-90112783 CTCAGGAAAATTGATCTTGGTGG + Intronic
1121086097 14:91147101-91147123 CTCAGGAAACTCACTTAAGGGGG + Intronic
1122524664 14:102372506-102372528 TTCAGGAGACTGAGTCAGGGCGG - Intronic
1123180789 14:106468236-106468258 CCCAGGAAAATCAGACATGGAGG + Intergenic
1202946108 14_KI270726v1_random:28422-28444 CCCAGGAAAATCAGACATGGAGG - Intergenic
1123411200 15:20061270-20061292 CTCAGGAAACTCAGTCACGGTGG - Intergenic
1123520546 15:21068381-21068403 CTCAGGAAACTCAGTCACGGTGG - Intergenic
1123884343 15:24709536-24709558 CTCTGGAAACTTTGTCCTAGAGG - Intergenic
1124110189 15:26778087-26778109 CTCAGGAAACATAATCACGGCGG + Intronic
1127703976 15:61529099-61529121 CTCTGGAAACCTACTCAAGGCGG + Intergenic
1127744006 15:61945138-61945160 CTCAGGAAACTGAATCATGGTGG - Intronic
1131646914 15:94354537-94354559 CTCAGGAAACTTAATCACCATGG - Intronic
1133562852 16:6965851-6965873 ATAAGGAAACTGAGGCATGGGGG + Intronic
1135759047 16:25121612-25121634 CTCAGGAAACTTAGTCATGGCGG + Intronic
1135800738 16:25492745-25492767 CCAAGGAGACCTAGTCATGGAGG - Intergenic
1135815263 16:25626864-25626886 GTAAGGAAACTGAGTCTTGGAGG + Intergenic
1138683130 16:58701307-58701329 CTCAGGAAACTTAACAATCGTGG - Intergenic
1140581858 16:76240356-76240378 CTAGGTAAACTTTGTCATGGGGG - Intergenic
1140715022 16:77715555-77715577 CTCAGGAAAGGTACACATGGGGG - Intergenic
1140769098 16:78187308-78187330 CTCAAGGAACTTAGTCTTTGAGG + Intronic
1142169839 16:88615918-88615940 CACAGCAACCTTAGGCATGGCGG - Intronic
1143427340 17:6850498-6850520 CTCAGGAAACAAAATCATGATGG + Intergenic
1146369292 17:32255086-32255108 CCCAGAAACCTTGGTCATGGGGG - Intergenic
1146624347 17:34424450-34424472 CTCAGGAAACACTGTTATGGGGG - Intergenic
1148219762 17:45853177-45853199 CTGAGGACACTTATTCATGGTGG - Intergenic
1148693032 17:49543980-49544002 CTCAGGAAACATAACCATGGTGG + Intergenic
1148925771 17:51083706-51083728 ATCAGGAAAGTTAAACATGGTGG - Intronic
1149050432 17:52297888-52297910 CTCAGGAAACAGAATCACGGTGG - Intergenic
1149138865 17:53404985-53405007 CTCAGGAAACTTACACATGGTGG - Intergenic
1149648889 17:58263825-58263847 CTCAGGAAACTAAGCTTTGGTGG - Intronic
1150430944 17:65116650-65116672 ATGAGGTAATTTAGTCATGGGGG + Intergenic
1151106602 17:71623113-71623135 CTCAGGAAGCTAAGGCAGGGAGG - Intergenic
1151238196 17:72736855-72736877 CCAGGGAAACTAAGTCATGGGGG + Intronic
1152165821 17:78704915-78704937 CTTAGGAAACAAAGTCATGGGGG + Intronic
1153433698 18:5046382-5046404 CTCAGGAAACTTAACAATTGTGG - Intergenic
1154371065 18:13763672-13763694 ATGAGGAAACTGAGTCATAGAGG + Exonic
1155450819 18:25960823-25960845 CTCAGGCAAGTCAGTCCTGGAGG - Intergenic
1155816733 18:30320828-30320850 TTCAGGAAGCTTCATCATGGTGG + Intergenic
1156615961 18:38784414-38784436 CTCAAAAAACTTAATCATGGTGG + Intergenic
1158103192 18:53854270-53854292 CTGAGAAAACTCAGTCAAGGAGG + Intergenic
1158107281 18:53899922-53899944 CTCAGGAAACTTAGTCATGATGG - Intergenic
1160532853 18:79575707-79575729 CTCAGGCACCTTGGTGATGGTGG + Intergenic
1160617416 18:80142185-80142207 CTGAGGAAATTGAGGCATGGAGG + Intronic
1162593404 19:11608053-11608075 CTCAGGAAACTTAATCATGACGG + Intronic
1164751572 19:30659227-30659249 CTCAAGAAACTTAGTCATGGTGG + Intronic
1164810316 19:31149872-31149894 CTTATGAAACTTAATCATAGAGG + Intergenic
1164898497 19:31898103-31898125 CTCAGGAAACATAATCATGGTGG + Intergenic
1165546485 19:36541216-36541238 CTCAGGAGACTAAGTCAAGAGGG + Intronic
1166974170 19:46594184-46594206 CTCAGGAGACTAAGACAGGGAGG - Intronic
1168562434 19:57395495-57395517 CTCAGGAAACACAATCCTGGCGG + Intronic
925053151 2:832874-832896 CTCAGGAAACTTAGTCGTGGGGG - Intergenic
925140020 2:1543888-1543910 CTCTGGAAACACAGTCATGGTGG + Intergenic
925246739 2:2390215-2390237 CTCAGGAAACACAGTGATGGTGG + Intergenic
925429371 2:3778022-3778044 CTCAGGTAACCTACTGATGGAGG - Intronic
925429398 2:3778146-3778168 CTCAGGAAACCCACTGATGGAGG - Intronic
925876578 2:8316458-8316480 CTCAGGAAACTTAACCATCATGG + Intergenic
926316662 2:11715161-11715183 CGCAGGCCACATAGTCATGGAGG + Intronic
927098777 2:19770638-19770660 CTCAGGAAACACAATCATGGTGG + Intergenic
928062068 2:28124118-28124140 ATAAGAAAACTTAGTCATTGGGG + Intronic
928081627 2:28317212-28317234 CGCAGGACGCTTAGTCAGGGTGG - Intronic
928620295 2:33081924-33081946 CTCAGGAAACTTAACAATCGTGG - Intronic
928665711 2:33548794-33548816 CTCAGGAGGCTGAGTCACGGAGG - Intronic
928899390 2:36301180-36301202 CTCAGGAAACACAATCATGGTGG + Intergenic
929351216 2:40957730-40957752 CTCAGGAAACTGAATCATGGAGG + Intergenic
929843965 2:45502077-45502099 CTCTGGAAGCTTCGTCTTGGAGG - Intronic
930521206 2:52469920-52469942 CTCTGGAAACATAATCATGATGG - Intergenic
931944607 2:67291125-67291147 CTCAGGCAACTTAGAAATTGTGG - Intergenic
932273467 2:70432322-70432344 CTCATGAAACTTTTCCATGGTGG - Intergenic
932363655 2:71131134-71131156 CTGAAGAAGCTTAGTCATGGGGG - Intronic
933455880 2:82518453-82518475 CTCAGGAAACTAACTTATAGAGG + Intergenic
933539257 2:83618178-83618200 ATCAGGAAACTTCGTCATGATGG + Intergenic
933554502 2:83815194-83815216 ATGAGGAAACTGAGGCATGGGGG + Intergenic
933864279 2:86501606-86501628 CTCAGGAAACACAGTCGTGGCGG + Intergenic
933949619 2:87317370-87317392 CTCAGGAAACACAATTATGGTGG + Intergenic
934950292 2:98571266-98571288 GTGAGGAAACTGAGGCATGGAGG + Intronic
935023731 2:99256343-99256365 CTCAGGAAAGTGACCCATGGAGG + Intronic
935372984 2:102366705-102366727 CTCAGGAAACTTACAAAAGGGGG + Intronic
935868689 2:107420903-107420925 CTCAGGAAACACAATCATGATGG + Intergenic
936330574 2:111544227-111544249 CTCAGGAAACACAATTATGGTGG - Intergenic
937761184 2:125604917-125604939 GTGAGGTAACTTAATCATGGGGG + Intergenic
938055327 2:128209904-128209926 CTCAGCAAACCCAGTCATGCTGG - Intergenic
939147132 2:138429224-138429246 CTCAGGAAACATGATCATAGTGG - Intergenic
939687451 2:145216380-145216402 TTGGGGAAACTGAGTCATGGGGG + Intergenic
942736428 2:179119547-179119569 CTCAGGAAACAGAATCGTGGTGG - Intronic
945774404 2:214086601-214086623 CTCAGGAAACATAATCACGGTGG - Intronic
945886113 2:215377538-215377560 CTTGGGAAGCTTACTCATGGTGG - Intronic
946151281 2:217773152-217773174 CTCAGGAAACTTACAAATGGTGG - Intergenic
946632544 2:221685799-221685821 CTCATGAAAATAACTCATGGTGG + Intergenic
947995396 2:234523116-234523138 CTCAGGAAACACAATAATGGCGG - Intergenic
948012267 2:234658674-234658696 CTCAGGAAACATAATCACGGCGG + Intergenic
948209700 2:236183706-236183728 CTCAGGAAGCTCAATCATGGTGG - Intergenic
1169142182 20:3232946-3232968 CTCAGGGATCTCAGACATGGCGG - Intronic
1171498733 20:25577000-25577022 CTCAGGAAACTGTGTCAAGCAGG - Intronic
1172601513 20:36186853-36186875 CACAGGAAACTGAGGCCTGGAGG + Intronic
1173943649 20:46932987-46933009 CTCAGGAAACACAATCATGTTGG - Intronic
1174541461 20:51292987-51293009 CTCAGGAAACACAATCATGGCGG + Intergenic
1177285468 21:19042867-19042889 CTCAGGAAACATCATCTTGGAGG + Intergenic
1177651501 21:23965969-23965991 CACAGGAAACTGAGACATGTGGG - Intergenic
1177679758 21:24351529-24351551 CTCAGGAAACATAATCATGGTGG + Intergenic
1179230400 21:39498950-39498972 CTCAGGAAACTTAGTCATGGTGG + Intronic
1179807765 21:43850913-43850935 CTCAGGAAACTTACAAATTGTGG + Intergenic
1179924070 21:44522764-44522786 CTCAGGAAACAAGGCCATGGAGG + Intronic
1180927476 22:19566340-19566362 CTGAGGAAACTGAGACATAGAGG + Intergenic
1181129477 22:20722090-20722112 CTCAGGAAACAGAATCATGGTGG - Intronic
1181135448 22:20762936-20762958 CTCAGGAGACTGAGGCAAGGGGG - Intronic
1181655528 22:24294716-24294738 CTCTGGGAACCTAGTCAAGGAGG - Intronic
1181709408 22:24672334-24672356 CTCTGGGAACCTAGTCAAGGAGG - Intergenic
1183849761 22:40575111-40575133 CACAGGAAACTTAGGCATGGAGG - Intronic
1183876723 22:40789150-40789172 CTCAGGAAAATTAGCTGTGGGGG + Intronic
1184316684 22:43698715-43698737 CTCAGGGAACTCAGTCCTTGGGG - Intronic
1184851206 22:47122284-47122306 TTCGGGAAACCTCGTCATGGTGG - Intronic
1184859965 22:47167991-47168013 ATGAGGAAACTGAGGCATGGAGG + Intronic
1184956412 22:47889772-47889794 CTCAGGAAACACAATTATGGTGG - Intergenic
1185226677 22:49657442-49657464 CTCAGGAAACACAATCATGGCGG + Intronic
1185354642 22:50360468-50360490 CTCAGGAAACTGAGGCAGGAGGG - Intronic
949491675 3:4595268-4595290 TTCAGGAAACTTTGTCATGGTGG + Intronic
949521224 3:4855857-4855879 CTCAGGAAACTTAGTCATGGCGG - Intronic
950172268 3:10847130-10847152 ATGAGGAAACTGAGGCATGGAGG + Intronic
951034849 3:17921632-17921654 CTCAGGAAACACAATCATGGTGG - Intronic
951180489 3:19653674-19653696 CTCAGGAAACACAATCATGACGG + Intergenic
952120141 3:30232462-30232484 CTCAGGAAACACAATCAAGGTGG + Intergenic
952221240 3:31326367-31326389 CTCAGGAAACTCAATCATGGTGG + Intergenic
952841560 3:37650937-37650959 ATGAGGAAACTGAGTCCTGGAGG + Intronic
953315947 3:41926125-41926147 CTCTGGAAGCTTCGTCCTGGAGG - Intronic
953514003 3:43572242-43572264 CCCAGGAAACTTATTGTTGGTGG - Intronic
953741712 3:45544355-45544377 CTCAGGAAACTGAGGCTTAGAGG - Intronic
953835298 3:46338197-46338219 CTCAGGAAACACAGTTATGATGG + Intergenic
954150782 3:48656069-48656091 GTCAGGAATCTGAGTCAGGGCGG + Intronic
954337489 3:49928273-49928295 CTCTGGAAACTCAGACAGGGAGG + Intronic
957784636 3:84866335-84866357 CTCAGGAAACACAATCATGGTGG - Intergenic
957811508 3:85228686-85228708 CTCTGGAAGCTTTGTCATAGAGG + Intronic
957847407 3:85755622-85755644 CTCAGGAAACTCAATCATGGTGG + Intronic
959162630 3:102739522-102739544 CACAGGAAACTGAGACATGCAGG + Intergenic
959351398 3:105269146-105269168 CTCAGGAAACAAAATCCTGGTGG - Intergenic
960722435 3:120638117-120638139 CTCAGGAAATACAATCATGGTGG - Intronic
961972721 3:130987436-130987458 CTCAGGAGACTGAGTCATGAGGG - Intronic
963245987 3:143063156-143063178 CTCAGGAAGCTTAGTCATGGTGG - Intergenic
965112629 3:164447526-164447548 CTTAGGATACTTACTCATGGTGG - Intergenic
965394910 3:168151775-168151797 CTCAGGAAACTTAAGCATGGTGG - Intergenic
965943256 3:174210510-174210532 CTCAGAAAATCTAGTCATCGTGG - Intronic
966217533 3:177518878-177518900 CTCAGGAAACATAATCATGGTGG + Intergenic
966342921 3:178945543-178945565 CTCAGGAAACTTAACCATGGTGG + Intergenic
966414635 3:179676170-179676192 CTCAGGAAACAAAATCATGGCGG - Intronic
967480788 3:189970982-189971004 CAAAGGAAACTTACTAATGGAGG - Intronic
967566406 3:190978786-190978808 CTCAGGAAACATAATCACGGTGG - Intergenic
968290748 3:197537686-197537708 CTCAGGAAAAATAGACATAGAGG - Intronic
968524445 4:1048857-1048879 CTCAGGAAACTTAGTCATGGTGG + Intergenic
969103496 4:4787691-4787713 CTCAGGAAACACAATCATGGCGG - Intergenic
969136103 4:5030047-5030069 CTCAGGAAACTTAACCATCATGG - Intergenic
970100254 4:12513771-12513793 TTTAGGAAACATAATCATGGTGG - Intergenic
970410344 4:15800541-15800563 CTCAGCATCATTAGTCATGGGGG - Intronic
970904791 4:21203105-21203127 CTCAGGAAAATGACTCATGCAGG + Intronic
971119796 4:23690470-23690492 CTCAGGAAACTTAACCATCTTGG - Intergenic
971421747 4:26480065-26480087 CGCATGAAACTTTGTCATGAAGG + Intergenic
972517300 4:39820323-39820345 CTCAGGAAACTTAATCATGGTGG + Intergenic
973710370 4:53624065-53624087 CTCAAGAAAAGGAGTCATGGAGG - Intronic
974850797 4:67403223-67403245 CTCAGGAAAGCTGCTCATGGTGG + Intergenic
975170143 4:71223895-71223917 CTCAGGAACCTGAGTCTTCGTGG + Intronic
975401716 4:73945587-73945609 CTCTGGAAACATAGGCATTGTGG + Intergenic
975626886 4:76359159-76359181 CTCAGAAAACATAATCATGGTGG - Intronic
976159639 4:82184886-82184908 CTCTGGAAGCTTTGTCTTGGAGG - Intergenic
976711468 4:88075965-88075987 CTGAGAAGACTCAGTCATGGTGG - Exonic
977138726 4:93339789-93339811 CTCAGGAAACACAATCATGGTGG + Intronic
978967456 4:114758566-114758588 CACAGAAAAATTGGTCATGGTGG - Intergenic
979454729 4:120914572-120914594 CTCAGGAAACAGAATCATGGTGG + Intronic
981866261 4:149423204-149423226 CTCAGGAAACTTACAACTGGTGG + Intergenic
982272861 4:153609213-153609235 CTTAGGAAACACAGTTATGGTGG + Intronic
984306939 4:178005491-178005513 CTCAGGAAACATAATCATGGTGG + Intergenic
984733794 4:183092085-183092107 CTCAGGAAACTTATTGATTATGG + Intergenic
987003928 5:13689568-13689590 CTCAGGAAACGTAATCATGGTGG - Intergenic
988119455 5:26942114-26942136 CTCAGGAAACACAATCATGGTGG + Intronic
989179158 5:38558672-38558694 CTCAGGAAACTTAACAATCGTGG + Intronic
989197162 5:38726884-38726906 CTCAGGAAACACAATCATGGCGG + Intergenic
989254548 5:39352054-39352076 CTCAGGAAACCCAATCATGGTGG + Intronic
989386098 5:40855937-40855959 CTCAGGAAACACAATCATGATGG - Intronic
989817356 5:45752057-45752079 CTCAGGAAACATCATCATGGTGG + Intergenic
990182764 5:53180771-53180793 CTCAGGAAACATAATCATGACGG - Intergenic
990935675 5:61146265-61146287 CTCAGGGAACTTAGATTTGGTGG + Intronic
991111509 5:62905270-62905292 CTTAGGAAACATAATCATGGTGG + Intergenic
991992245 5:72351583-72351605 CTCAGGAAATACAGTCATGGGGG + Intronic
993098574 5:83508905-83508927 CTCAGGAAGCTGAGGCAAGGAGG + Intronic
993713662 5:91253019-91253041 CTCAGGAAACACAATCATGGTGG - Intergenic
994510713 5:100700294-100700316 CTCTGGAAGCTTTGTCCTGGAGG - Intergenic
995338022 5:111025023-111025045 CTCAGTAAGCCAAGTCATGGAGG + Intergenic
995576421 5:113540502-113540524 CTCAGGAAACTTAGTCATGATGG + Intronic
995636143 5:114193190-114193212 CTCAGAAAACTCAGTCATGCAGG - Intergenic
995895672 5:117007599-117007621 CTCAGGAAACTTACACATGGTGG + Intergenic
1000145699 5:158451287-158451309 CTCAGCAAACCTTTTCATGGTGG + Intergenic
1001526111 5:172430035-172430057 ATGAGGAAACTGAGTCATGGGGG - Intronic
1004176207 6:13342310-13342332 ATCAGCAAACTTTGACATGGTGG - Intergenic
1005078228 6:21929749-21929771 CTCAGGAAATGCAGTCATGGCGG + Intergenic
1005879776 6:30047260-30047282 CTCAGGAAACACAATAATGGTGG + Intergenic
1006132808 6:31878974-31878996 CTCCGGAGACTGAGCCATGGGGG - Exonic
1006992763 6:38229478-38229500 TTCAGGAAACTGTTTCATGGGGG - Intronic
1007228760 6:40333485-40333507 GTGAGGAAACTGAGGCATGGGGG - Intergenic
1008305362 6:49892643-49892665 CTCAGGGTTCTTAGTCTTGGTGG - Intergenic
1008848055 6:55992618-55992640 CTCAGGAGACATAATCATGGTGG + Intergenic
1009707884 6:67278163-67278185 CTCAGGAATCCTAGTTATGGCGG + Intergenic
1009773300 6:68173356-68173378 CTCAGGAAACAGAATCATGGTGG - Intergenic
1011518914 6:88182712-88182734 CTCAGAAAACATAATCATGGTGG - Intergenic
1011981560 6:93385853-93385875 CTCAGGAAACATAATCATGGTGG + Intronic
1012596367 6:101046068-101046090 CTCAGGGAGCTTACTCATAGTGG + Intergenic
1013528505 6:110997630-110997652 CTCAGGAGGCTGAGGCATGGAGG + Intronic
1014250016 6:119105487-119105509 CTCAGGAAACTGAATCATGGTGG - Intronic
1014951357 6:127559231-127559253 CTCAGGAAACACAATCATGGAGG - Intronic
1015239472 6:131007325-131007347 CTCAGGAAACAAAGTTACGGTGG - Intronic
1017287611 6:152694950-152694972 CTCATGAAACTTATTGCTGGTGG + Intergenic
1017408968 6:154149190-154149212 CTCAGGAAACTTAACAATCGTGG + Intronic
1018177033 6:161186178-161186200 ATCAGGAGACTGAGGCATGGGGG - Intronic
1018511288 6:164527109-164527131 CTCAGCAAACATAATTATGGAGG - Intergenic
1020245261 7:6424459-6424481 CTCAGGGAAGTTAGGCAGGGAGG + Intronic
1022858250 7:34338609-34338631 CTCAGGAAACTTAACCATCATGG + Intergenic
1023921327 7:44632408-44632430 CTCAGGAAGCTGAGGCGTGGGGG - Intronic
1024865685 7:53903368-53903390 CTCAGGAAACTTTCACATGGTGG + Intergenic
1024895874 7:54261344-54261366 CTCAGGAAACACAGTCATGGTGG + Intergenic
1025193851 7:56917382-56917404 CTAAAGAAACTTAGGCATGTGGG + Intergenic
1027441405 7:78222993-78223015 CTCATGAAACATGGTTATGGGGG + Intronic
1027529668 7:79314688-79314710 CTCAGGAAAATGAGCCATGTTGG - Intronic
1027542427 7:79484134-79484156 CACAGAAAACTTGATCATGGGGG + Intergenic
1028385567 7:90249307-90249329 CTCAAGAAAAACAGTCATGGCGG - Intronic
1028393220 7:90338414-90338436 CTCAGGAAACTTAATCATGGTGG - Intronic
1028432012 7:90758663-90758685 CTCGGGAAACTTAATCTTGAAGG + Intronic
1028610835 7:92709853-92709875 CTAAGGAATCATAGTCCTGGTGG + Intronic
1028940871 7:96520916-96520938 CTCAGGACAATCAGCCATGGAGG - Intronic
1031194079 7:118590333-118590355 CTCAGGAAACTCAAACATGGTGG - Intergenic
1031342384 7:120619320-120619342 CTCAGGAAACTGAGCCAGGGAGG + Intronic
1032007376 7:128313863-128313885 CTCAGGAAACTTAATCATAGTGG - Intronic
1032366630 7:131306140-131306162 CTCAGGAAACGTAATCATGGTGG - Intronic
1032846801 7:135758244-135758266 CTCAGGAGAAATAGTCAGGGAGG + Intergenic
1033790781 7:144790512-144790534 CTCAGGAAACTTAACAATCGTGG + Intronic
1034113616 7:148562814-148562836 CTTAGGAAACTTAGTCATGGCGG + Intergenic
1034477640 7:151296021-151296043 CTCAGGAAACACAATCATGGTGG + Intergenic
1034778286 7:153852355-153852377 CTCAGGGAACTTAGTCATGATGG + Intergenic
1035548066 8:498942-498964 CTCAGGAAACTTACGTAAGGAGG - Intronic
1035572389 8:681228-681250 CTGAGGAGGCTGAGTCATGGTGG + Intronic
1035634562 8:1134719-1134741 CTCAGGAAACTTATTCATGGTGG + Intergenic
1036057275 8:5270231-5270253 CTCAGGAAACACATTCATGGAGG - Intergenic
1036198328 8:6743546-6743568 TATAGGAAACTTAGACATGGAGG + Intronic
1037151696 8:15643176-15643198 CTCAGTAAACATGATCATGGCGG - Intronic
1037294448 8:17385782-17385804 CACAGGAAACACAATCATGGTGG - Intronic
1037384374 8:18322021-18322043 CTCAGGAAACTTACAAATGGCGG + Intergenic
1039344047 8:36684415-36684437 ATGAGGAAACTGAGTCCTGGAGG - Intergenic
1040741489 8:50580710-50580732 CTCAAGAAACACAGTCATGATGG - Intronic
1040945793 8:52883014-52883036 TTCAGGAAACATAATCATGGTGG + Intergenic
1041265607 8:56061239-56061261 CTCAGGAAACTTAATCATGGCGG - Intergenic
1042383714 8:68149635-68149657 ATCAGGAAATTTAGTCAGTGGGG - Intronic
1042638534 8:70905982-70906004 TTCTGGAAGCTTAGTCTTGGAGG + Intergenic
1043102330 8:76061240-76061262 CTCAGGAAACATAATCATGGTGG - Intergenic
1043953815 8:86339325-86339347 GTCAGGTAATTTAATCATGGGGG - Intergenic
1044221195 8:89672250-89672272 CTCTGGAAACAAAATCATGGTGG + Intergenic
1046014708 8:108590845-108590867 CTCTGGAAGCTTAGTCCTAGAGG - Intergenic
1046365661 8:113227722-113227744 CTCAGAAAACATAATTATGGTGG - Intronic
1046611378 8:116429417-116429439 CTCAGGAAACACAGTCATGGTGG + Intergenic
1047151369 8:122267269-122267291 CTCAGGAAACATAATCATGGCGG + Intergenic
1047827904 8:128597782-128597804 CTCACAAAACTTAGTCATGGTGG + Intergenic
1047939464 8:129815197-129815219 CTCAGGAAACTTAGCAATCATGG - Intergenic
1048693876 8:137001910-137001932 CTCCTGAAACCAAGTCATGGAGG - Intergenic
1049190820 8:141286348-141286370 CTCAGGAAACTCAGTCCGAGAGG + Intronic
1050025914 9:1334449-1334471 TTGAGGAAACTTAGGCATAGAGG + Intergenic
1050843660 9:10186916-10186938 CTCAAGAACATTAATCATGGGGG - Intronic
1052498388 9:29257805-29257827 CTCAAGAAATTTTGTCATGTGGG + Intergenic
1053458325 9:38249088-38249110 CCCAGGAAACTTGGGCTTGGTGG - Intergenic
1054989646 9:71308636-71308658 CTCAGCAAACAAAGTAATGGGGG + Intronic
1055926895 9:81519612-81519634 CTCAGGAAACTTAGTGATGGTGG + Intergenic
1056459067 9:86791746-86791768 CTCAGAAGACCCAGTCATGGGGG + Intergenic
1057694376 9:97312828-97312850 GTGAGGAAACTCAGTCATGGGGG - Intronic
1058209057 9:102144622-102144644 CACAGGAAACTTAGTCATGGTGG + Intergenic
1058501312 9:105620611-105620633 CTGAGGAAACTTAGGCAGAGAGG - Intronic
1058653310 9:107197181-107197203 CTCAGGAAACACAATCATGGCGG + Intergenic
1059401564 9:114073603-114073625 CTCAGGAAGCTTAGGCAGGAGGG - Intronic
1059518949 9:114921816-114921838 CTCAGGAAACTTTGTCTCCGTGG + Intronic
1059565070 9:115376056-115376078 CTCAGGAAACTTAGAAATCATGG + Intronic
1059617959 9:115971464-115971486 CTCAGAAAACATAATCATGGTGG + Intergenic
1060345933 9:122815860-122815882 ATGAGGAAACTGAGGCATGGAGG + Intronic
1062424885 9:136501638-136501660 CTCTGGAAACTTAGAATTGGGGG - Intronic
1062670141 9:137703979-137704001 CTCAGGAAACTTAGCAATCATGG + Intronic
1187579406 X:20592339-20592361 CTCAGCAAGCTTCGCCATGGTGG - Intergenic
1187599713 X:20814656-20814678 CTCAGGAAACATAGACATTAAGG - Intergenic
1188473235 X:30563289-30563311 CTCAGGAAACACAATCATGGTGG - Intronic
1189508112 X:41633719-41633741 CTTTGGTAACTTAGTCATGATGG - Intronic
1189728871 X:43997769-43997791 TTCAGGAAACATAATCATGGTGG + Intergenic
1192695692 X:73413477-73413499 CTCAGAAAACTTAATCTTGGAGG - Intergenic
1192721394 X:73702191-73702213 CTCTGGAAACTTTGTCACAGAGG - Intergenic
1192929105 X:75785895-75785917 ATGAGGAAACTGGGTCATGGAGG + Intergenic
1193021881 X:76800512-76800534 CACAGAAAACTGAGACATGGGGG + Intergenic
1193409410 X:81144273-81144295 CTCTGGAAGCTTCGTCCTGGAGG - Intronic
1193934246 X:87596124-87596146 TTCGGGAAACTTATTTATGGTGG - Intronic
1195197592 X:102515050-102515072 CAAAGGAAAGTAAGTCATGGGGG - Exonic
1196753963 X:119141788-119141810 ATCAGGAAACTGAGGCATGAAGG - Intronic
1197581767 X:128293227-128293249 CTGAGGAAACATAATCATGGTGG - Intergenic
1197740470 X:129888623-129888645 CTCAGGAAACAGAATCATGGTGG - Intergenic
1198632286 X:138654110-138654132 ATGAGGAAACTGAGGCATGGAGG - Intronic
1198999964 X:142624121-142624143 CTCAGGGAACTTACTCGTGGCGG + Intergenic
1199552936 X:149077607-149077629 CACAGGAAACTTGGACATGCGGG + Intergenic
1201331768 Y:12831072-12831094 CTTAGGAAACTTAATCATGGTGG - Intronic