ID: 1092498160

View in Genome Browser
Species Human (GRCh38)
Location 12:9018747-9018769
Sequence TTGTATATCAAGAGAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092498160_1092498163 -6 Left 1092498160 12:9018747-9018769 CCCTCCTCTCTCTTGATATACAA No data
Right 1092498163 12:9018764-9018786 ATACAAAAATTAAATAAAATTGG 0: 2
1: 11
2: 239
3: 2458
4: 18793

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092498160 Original CRISPR TTGTATATCAAGAGAGAGGA GGG (reversed) Intergenic
No off target data available for this crispr