ID: 1092501108

View in Genome Browser
Species Human (GRCh38)
Location 12:9049117-9049139
Sequence AGAGTAGGTCCCTGCTCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092501108_1092501112 9 Left 1092501108 12:9049117-9049139 CCTTCAGAGCAGGGACCTACTCT No data
Right 1092501112 12:9049149-9049171 TACTCTCTGAGTAAGTATCAGGG No data
1092501108_1092501113 19 Left 1092501108 12:9049117-9049139 CCTTCAGAGCAGGGACCTACTCT No data
Right 1092501113 12:9049159-9049181 GTAAGTATCAGGGCTTCAGAAGG No data
1092501108_1092501111 8 Left 1092501108 12:9049117-9049139 CCTTCAGAGCAGGGACCTACTCT No data
Right 1092501111 12:9049148-9049170 GTACTCTCTGAGTAAGTATCAGG No data
1092501108_1092501114 23 Left 1092501108 12:9049117-9049139 CCTTCAGAGCAGGGACCTACTCT No data
Right 1092501114 12:9049163-9049185 GTATCAGGGCTTCAGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092501108 Original CRISPR AGAGTAGGTCCCTGCTCTGA AGG (reversed) Intergenic
No off target data available for this crispr