ID: 1092505237

View in Genome Browser
Species Human (GRCh38)
Location 12:9092107-9092129
Sequence ACTGGGAAGCAGAAGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 804
Summary {0: 1, 1: 0, 2: 2, 3: 100, 4: 701}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092505229_1092505237 24 Left 1092505229 12:9092060-9092082 CCACTTTATCAGTTGCTGACTGA 0: 1
1: 0
2: 0
3: 16
4: 153
Right 1092505237 12:9092107-9092129 ACTGGGAAGCAGAAGGAGCAGGG 0: 1
1: 0
2: 2
3: 100
4: 701
1092505228_1092505237 25 Left 1092505228 12:9092059-9092081 CCCACTTTATCAGTTGCTGACTG 0: 1
1: 0
2: 2
3: 20
4: 185
Right 1092505237 12:9092107-9092129 ACTGGGAAGCAGAAGGAGCAGGG 0: 1
1: 0
2: 2
3: 100
4: 701

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092505237 Original CRISPR ACTGGGAAGCAGAAGGAGCA GGG Intronic
900013646 1:135335-135357 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
900014410 1:138301-138323 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
900043716 1:491318-491340 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
900044275 1:493503-493525 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
900065154 1:726321-726343 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
900065683 1:728409-728431 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
900672823 1:3866329-3866351 CCTGGGAGGCAGAGGGTGCAGGG - Intronic
900708200 1:4093921-4093943 GCTGGAAAGAAGAAGGAGGAGGG - Intergenic
900868906 1:5287977-5287999 ACCGAGTAGCAGAAGGAGGAAGG - Intergenic
900908760 1:5579272-5579294 TCTGGAAAGCAGAATGAGCAAGG - Intergenic
901182013 1:7348314-7348336 ACTGGGAAACAGCATGGGCATGG - Intronic
901574679 1:10191358-10191380 ACAGAGAAACAGCAGGAGCAAGG + Intergenic
902227468 1:15005710-15005732 CCTGGGAAGCAGAGGTGGCAGGG + Intronic
902329427 1:15724050-15724072 ACAGGGCAGGAGAGGGAGCACGG - Intronic
902530260 1:17086297-17086319 CGTGGGGAGCAGAAGCAGCAAGG + Intronic
903006790 1:20303879-20303901 ACTGGGAAGCAGCCTGAGCAGGG + Intronic
903287035 1:22283836-22283858 ACAGGGAAGCAGAGACAGCAAGG - Intergenic
903292569 1:22324083-22324105 ACTGGGAAGCACAGTGAGTATGG - Intergenic
903489370 1:23716500-23716522 ACTGTGAATCAGAAGGATCAGGG - Intergenic
903560371 1:24222429-24222451 AGTGGGAAGAGGGAGGAGCAGGG + Intergenic
903759915 1:25690648-25690670 GCTGGGTGGCAGAAAGAGCATGG + Intronic
904377061 1:30088316-30088338 CCTGGCCTGCAGAAGGAGCAGGG - Intergenic
905256468 1:36688560-36688582 AATGGGAAGGGGAAGGAGTATGG + Intergenic
905256489 1:36688614-36688636 AATGGGAAGGGGAAGGAGTATGG + Intergenic
905256510 1:36688668-36688690 AATGGGAAGGGGAAGGAGTATGG + Intergenic
905489408 1:38331916-38331938 ACTGGGAAGCTGGAGGGGAAGGG - Intergenic
905645044 1:39619426-39619448 TGTGGGAATCAAAAGGAGCAAGG - Intergenic
905910963 1:41654036-41654058 GCTGGGAAGGAGTAGGTGCAAGG - Intronic
906170011 1:43717071-43717093 TCTGGGAAGCTGAAGCAGAAGGG - Intronic
906289876 1:44612904-44612926 AGTGGGAAGAAGAAGAAGGAAGG + Intronic
906546164 1:46620870-46620892 GCTGGGAAGGAGGAGGAGCTTGG - Intergenic
906697122 1:47830438-47830460 GCTGGGAATCAGAAGGAACTGGG + Intronic
906737051 1:48140162-48140184 ACTGGGAAGAAGAAGAAAGAAGG + Intergenic
908230060 1:62095657-62095679 ACTGGGAAGCACAATGTGAAAGG - Intronic
908267543 1:62394145-62394167 CCTGGGAAGCAGCAAGAGGAGGG - Intergenic
908389970 1:63675472-63675494 AGTGGGGAGCAGCAGGAGCCGGG - Intergenic
908983136 1:69983279-69983301 CATGGGAAGCTGAGGGAGCAGGG + Intronic
909365187 1:74812584-74812606 AGTGGTAAGAATAAGGAGCAGGG - Intergenic
909583826 1:77266890-77266912 ACAGGGAAGCAGAATGAAGAAGG + Intergenic
909595345 1:77399973-77399995 CCAGGAAATCAGAAGGAGCAAGG - Intronic
909899942 1:81120709-81120731 AATGGGAAGAGGAAAGAGCATGG - Intergenic
910190583 1:84590921-84590943 AATGGAAAACAGAAGAAGCAGGG + Intergenic
911216757 1:95203332-95203354 ACTGGGAGGCAGAGGCTGCAGGG - Intronic
912846066 1:113075769-113075791 CCTGGGAAGCAGAGGTTGCAGGG - Intronic
913060356 1:115199063-115199085 ACTGGAAAGGAGAAGGGACAGGG - Intergenic
914399647 1:147306139-147306161 AATGGAAAGCAAAAGAAGCAGGG + Intergenic
915479537 1:156175488-156175510 AGTGGGAAGAGGAAGGAGGAAGG - Intronic
915601538 1:156925609-156925631 TATGGGAAGGAGCAGGAGCAAGG + Intronic
915840135 1:159206521-159206543 TCTGGGGAGAAGAAGGAGAATGG + Intergenic
915974297 1:160375006-160375028 AGTGGGAAGAGGAGGGAGCAGGG + Intergenic
916606017 1:166343147-166343169 AGTGGGGAGCAGGGGGAGCAGGG + Intergenic
916851056 1:168704070-168704092 ACAAGGAAGCAGAATGATCAGGG + Intronic
918469241 1:184853651-184853673 AGTGGGAAGGATAAGGAGCATGG - Intronic
918611363 1:186496123-186496145 ACTGGCAAGGAGAAGGTGAAAGG + Intergenic
919600938 1:199621518-199621540 AATGGGAAGAAGAAGGAACTAGG - Intergenic
919799510 1:201344937-201344959 AATGGGAAGCAGCAGGAGGCAGG - Intergenic
919820689 1:201469923-201469945 TCTGCGGAGCGGAAGGAGCAAGG - Intergenic
919857249 1:201714329-201714351 ACAAGGAAGGAGAAGGAGAAGGG - Intronic
919909119 1:202099581-202099603 CCTGGGAAGCAGAGGTTGCAGGG - Intergenic
920534393 1:206728375-206728397 ACTGGGAAGCAGGGGGTGAAGGG - Intronic
920586394 1:207166974-207166996 ACAGGGAAACAGAAGGAAAAGGG - Intergenic
920623966 1:207577905-207577927 TCTTGGAAGCAGAGGGAGAAAGG + Exonic
920636605 1:207710482-207710504 TCTTGGAAGCAGAGGGAGAAAGG + Intronic
920674357 1:208029083-208029105 AGTGGGCAGCAGAAGGGGCACGG - Intronic
920971921 1:210750081-210750103 TGTGGGCAGCAGAAAGAGCATGG + Intronic
921150443 1:212397726-212397748 AATGGGAAGCACAGGGAGAAGGG + Intronic
921195573 1:212754330-212754352 ACCGGTAAGCAGAAGTAGCCAGG + Intronic
921283813 1:213591411-213591433 GGTGGGAAACAGAAGGAGAATGG - Intergenic
921968440 1:221118418-221118440 TCTGGGAAGCAGAGGCAGTAGGG - Intergenic
922015679 1:221644273-221644295 ACTGGGGAGGACAAGAAGCAAGG - Intergenic
922100059 1:222472330-222472352 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
922100264 1:222473158-222473180 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
922100465 1:222473958-222473980 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
922214144 1:223507041-223507063 GCTGGGAAGAAGATGGAGGATGG + Intergenic
922262083 1:223951796-223951818 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
922481843 1:225944775-225944797 TCAGGGAAGCAGCAGCAGCAGGG - Intergenic
922734185 1:227970782-227970804 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
922734981 1:227973918-227973940 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
923128355 1:231053063-231053085 CCTGGGAGGCAGAAGTTGCAGGG - Intergenic
923146581 1:231202791-231202813 GCTGAGAAGCAGGAGGAGCCTGG + Intronic
923521630 1:234739428-234739450 AAGGGGCAGCAGAAGGGGCATGG - Intergenic
923601693 1:235409241-235409263 ATTGGTAGGCAGAAGGAGGAAGG + Intronic
923716855 1:236432311-236432333 CCTGGGAAGCAGAGGTTGCAGGG + Intronic
924343257 1:243053995-243054017 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
924343728 1:243055875-243055897 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
924502178 1:244647996-244648018 ACTGGAAGGCAGGAGGAGGAGGG + Intergenic
1062925287 10:1311708-1311730 AGTGGGAGACAGAAGAAGCAAGG - Intronic
1063570423 10:7210401-7210423 ACTGGGCAGCAGAGGCAGGAGGG + Intronic
1064292101 10:14044596-14044618 GCTGGCAAGCAGCAGGAGCTGGG + Intronic
1064693902 10:17946470-17946492 AATGGAAAGCAAAAAGAGCAGGG + Intergenic
1065899513 10:30192602-30192624 CCTGGGAAGCAGAGGTTGCAGGG - Intergenic
1066733235 10:38451597-38451619 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
1066754708 10:38699743-38699765 ACTGGGAAGTTCAAGAAGCATGG + Intergenic
1067140739 10:43654471-43654493 CCTGGGAGGCAGAGGTAGCAGGG - Intergenic
1069020800 10:63486277-63486299 ATTGGGAGACAGAAGAAGCATGG + Intergenic
1069941810 10:71961914-71961936 TCTGGGAAGTAGCAGGAGCAAGG - Intergenic
1069948372 10:72002618-72002640 TGAGGGAAGCAGAAGGAGCTAGG - Intronic
1070089248 10:73268767-73268789 CCTGGGAGGCAGAAGTTGCAGGG - Intronic
1070365502 10:75732970-75732992 ACTGGGAAGCTAAAGGTTCATGG + Intronic
1070615914 10:77969057-77969079 ACTGGGAAACAGATGCAGAAGGG + Intergenic
1070831060 10:79418399-79418421 CCTGGCAGGCAGAGGGAGCATGG - Intronic
1072039649 10:91594713-91594735 TCAGGGAAGCAAAAGGAGCAAGG + Intergenic
1072132539 10:92509515-92509537 CCTGGGAAGCAGAGGTTGCAGGG + Intronic
1072153239 10:92700169-92700191 AGTGGGGAGCAGAAGAAGGATGG - Intergenic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1072709030 10:97703640-97703662 GCCAGGAGGCAGAAGGAGCAAGG + Intergenic
1073579888 10:104655785-104655807 ACACGGAAGAAGCAGGAGCAAGG - Intronic
1073649676 10:105344872-105344894 ACTGAGAAGATGCAGGAGCAGGG - Intergenic
1074401144 10:113142078-113142100 ACTGGGAGGCAGAGGTTGCAGGG - Intronic
1075575773 10:123576462-123576484 ACTTGGAGGCAGATAGAGCAGGG - Intergenic
1075593391 10:123708992-123709014 AGTGAGAACTAGAAGGAGCAGGG + Intronic
1076481678 10:130789042-130789064 GCAGGGGAGCAGGAGGAGCAGGG + Intergenic
1076590093 10:131576952-131576974 ACTGACACGCAGAAGGCGCATGG + Intergenic
1076598452 10:131640602-131640624 AATGGAAAACAGAAAGAGCAGGG + Intergenic
1076644660 10:131944666-131944688 ACTGGACAGCAGAGGGAGGACGG - Intronic
1076704511 10:132293856-132293878 CCGGGGACGCAGAAGGAGCCAGG + Intronic
1076969990 11:127549-127571 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
1076970607 11:129978-130000 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
1077433160 11:2526074-2526096 GCTGGGCAGCAGCAGGTGCACGG + Intronic
1079318142 11:19427338-19427360 AAAGGGAAGCAGAAGGAAGAAGG - Intronic
1079347450 11:19665364-19665386 GCTGAGAAGCAGATGGTGCATGG + Intronic
1079386838 11:19987951-19987973 ACTGGGAAGAAGAAGAAATATGG + Intronic
1079787077 11:24686850-24686872 TCGGGGAAGCAGCATGAGCAGGG - Intronic
1080181455 11:29431175-29431197 TTTGGGAGGCAGAGGGAGCAAGG - Intergenic
1080401093 11:31936157-31936179 TCTGGGAAGCAGGAGATGCAGGG + Intronic
1080463486 11:32475809-32475831 TCTGGGAAGCGGAAGTTGCAGGG + Intergenic
1080647112 11:34195288-34195310 GCTGGGAAGGAAAAAGAGCAGGG - Intronic
1080818689 11:35784039-35784061 ACTGGGGAGCAGAATGTGCTAGG + Intronic
1080943125 11:36941556-36941578 TTTGGGAACCAGAAGCAGCAAGG + Intergenic
1081931674 11:46875774-46875796 CCTGGGAAGCAGCAGGGACACGG + Intronic
1082260224 11:50072475-50072497 ATTGGGAGGCAGGAGGAGCTGGG + Intergenic
1082260623 11:50074202-50074224 ATTGGGAGGCAGGAGGAGCTGGG + Intergenic
1082740064 11:56900964-56900986 CCTGTGAAGCAGAGGGAGCAAGG + Intergenic
1083052281 11:59788004-59788026 CGTGGGAAGCAGGAGGAGGATGG - Intronic
1083172948 11:60933788-60933810 ACTGGGACGGAGAGGGCGCAGGG + Intronic
1085151141 11:74253731-74253753 ACAGGGAAGGGAAAGGAGCAGGG - Exonic
1085741410 11:79080910-79080932 ACTAGGAAGCAGAGGGAAGAGGG + Intronic
1085779076 11:79392311-79392333 ACTTGGAGGCAGAGGGAGCAAGG + Intronic
1086175893 11:83890509-83890531 ACTGTGATGGGGAAGGAGCATGG + Intronic
1087515437 11:99154176-99154198 GTGGGGAAGCAGCAGGAGCAGGG + Intronic
1088066700 11:105728192-105728214 AATGGAAAGCAAAAGAAGCAGGG + Intronic
1088692867 11:112342767-112342789 CCTGGGAAGCAGAGGTTGCAGGG - Intergenic
1088762146 11:112941835-112941857 ACTGGGAAATAGAATCAGCAGGG - Intergenic
1089079000 11:115760687-115760709 GCTGTGAAACAGAGGGAGCATGG - Intergenic
1089125280 11:116172363-116172385 TGTGGGAAGCAGAAGGACCTTGG + Intergenic
1089343175 11:117773296-117773318 GCTGGAACACAGAAGGAGCAGGG - Intronic
1089652321 11:119922365-119922387 ACTGGGAAGTAAGAGGGGCAAGG - Intergenic
1089705161 11:120272443-120272465 AATGGGAGGTAGAAGGAGTAGGG + Intronic
1089715219 11:120352934-120352956 AGTGGGAAGAAGAAGGGGAATGG - Intronic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090408629 11:126492537-126492559 AGTGGGAAGGAGGAGGAGGAGGG + Intronic
1090628887 11:128629067-128629089 AGTAGGAAGCAAAAGGAGAAGGG - Intergenic
1090921952 11:131214687-131214709 AGTTGGGAGCAGCAGGAGCATGG + Intergenic
1091326090 11:134689242-134689264 CCTGTGAAGCAGACTGAGCAGGG + Intergenic
1091512057 12:1137395-1137417 ACTGGTAAGTAGAAGGACTATGG - Intronic
1092505237 12:9092107-9092129 ACTGGGAAGCAGAAGGAGCAGGG + Intronic
1092783076 12:12005206-12005228 ACTTGAAAGCAGAAGGATCATGG - Intergenic
1093141566 12:15516064-15516086 CCTGGGAGGCAGAAGTTGCAGGG - Intronic
1093203178 12:16214514-16214536 TCTGGGGAGCAGAAGGAGGGTGG + Intronic
1093353873 12:18138721-18138743 ACTGGGGAGCAGAAGGAAGCTGG + Intronic
1094058086 12:26286463-26286485 GCTGGGAGGCAGCAGGAGAAAGG + Intronic
1095264140 12:40133751-40133773 TCTAGGAATCAGAAGGAGAATGG - Intergenic
1095815431 12:46417052-46417074 CCTGGGAAGCAGAAGTTGCAAGG - Intergenic
1097437421 12:59568346-59568368 ACTGAGAAGCAGAATGAGAGGGG + Intergenic
1097736389 12:63186263-63186285 ACTGGAAAGGAGATGGAGGATGG + Intergenic
1098151956 12:67555986-67556008 TCTGGGAAGCACAAGGGGTAGGG - Intergenic
1098213960 12:68196092-68196114 AGTGGGAAGAAGAGGGAGCTTGG + Intergenic
1098694874 12:73539555-73539577 AATGGAAAGCAGAAAAAGCAAGG + Intergenic
1099009304 12:77272723-77272745 TCTGGGTTTCAGAAGGAGCAAGG + Intergenic
1099022599 12:77424811-77424833 CCTGGGAAGCACAAGGGGTAAGG - Intergenic
1099788883 12:87304556-87304578 ACTGGGCAGCTTAAGGAGCTTGG - Intergenic
1100879367 12:98999394-98999416 AATGGGAAACAGAATGACCAGGG - Intronic
1101408918 12:104453332-104453354 CCTGGGAAAGAGAAGGAGGAAGG - Intergenic
1101521120 12:105483383-105483405 ACATGGAAGCAGAATGTGCAAGG + Intergenic
1102759755 12:115375126-115375148 CCTGGGAAGAAGAAGAGGCAGGG + Intergenic
1103720386 12:122971527-122971549 CCTGGGAAGCAGAGGTTGCATGG - Intronic
1104207446 12:126653479-126653501 CCTGGGAGGCAGAAGTTGCAGGG - Intergenic
1104252956 12:127113311-127113333 GCTGGGAGGCAGAAGGAGGCTGG + Intergenic
1104268304 12:127259052-127259074 ATTGTGAAGCAAAAGGAGAAAGG + Intergenic
1104466774 12:128996813-128996835 AGTGGGATGCAGGAGGGGCAGGG + Intergenic
1104483499 12:129129136-129129158 ACTAGGGAGGAGAAGGAGGAAGG - Intronic
1104538130 12:129637792-129637814 ACATGGCAGGAGAAGGAGCAAGG + Intronic
1105439788 13:20405667-20405689 GCTGGGGAGCAGCAGGAGCGTGG - Intronic
1105531142 13:21221740-21221762 ATTGGGGAGAAAAAGGAGCAGGG - Intergenic
1105771896 13:23619908-23619930 ACGGGGAAGCAGGAGGAACCAGG - Intronic
1105922911 13:24982284-24982306 AGTGGGGAGGAGGAGGAGCAAGG + Intergenic
1106164758 13:27233917-27233939 CCTGGGAGGCAGAAGTTGCAGGG + Intergenic
1106174828 13:27321202-27321224 ACCGGGAAGGAGAAGGAGTGAGG + Intergenic
1106429349 13:29665464-29665486 CCTGGGAAGCACAAGGAGTGGGG + Intergenic
1106552144 13:30781211-30781233 GCTGGGAAGTTCAAGGAGCATGG - Intergenic
1106883001 13:34152258-34152280 ACTGCAAAGCAGAATGAGAAGGG + Intergenic
1107968920 13:45622642-45622664 ACTGGGAAGCACAAGGGGTCAGG - Intergenic
1108494226 13:51008135-51008157 ACTGAAAAGCAGAAGGAGAAAGG - Intergenic
1109390006 13:61681189-61681211 ACTGGAAAGCAGAAGGAAATGGG + Intergenic
1109490741 13:63096883-63096905 ACTGGTAAGAAGCTGGAGCATGG - Intergenic
1110470372 13:75853344-75853366 ACTGTGAAGCTGAAGGGGAATGG - Exonic
1112394203 13:99013660-99013682 CCTGGGAAGTAGAAACAGCAAGG + Intronic
1113131630 13:107043193-107043215 TCTGGGAAGCACAAGGAGTCGGG - Intergenic
1113612174 13:111654889-111654911 ACTGGGAAGCATGAGAAGCAGGG + Intronic
1114286532 14:21249508-21249530 ACCGGGAAGCAGAGATAGCAGGG + Intronic
1114341874 14:21753955-21753977 TCTGGGAAGCAGAAGGGGTCAGG + Intergenic
1114568510 14:23649488-23649510 ACTGGACAGCCCAAGGAGCATGG - Intergenic
1115768231 14:36645645-36645667 ACTGGGTAGCAGCACGTGCAGGG + Intergenic
1115801487 14:36999130-36999152 ACTGGGAAGCAGTAGGTGAATGG + Intronic
1116090067 14:40293733-40293755 ATTGGGAATCAGAAGGGGGATGG + Intergenic
1117109735 14:52439048-52439070 ACTGGGAGGCCAAAGGTGCAAGG - Intronic
1117172318 14:53113622-53113644 CCTGGGAAGCGCAAGGAGCCAGG + Intronic
1117236217 14:53779616-53779638 AGTGGTCAGCAGAAGGAGAATGG + Intergenic
1117477820 14:56115487-56115509 AATGGCAAGCAGAGAGAGCAGGG + Intergenic
1117661564 14:58011201-58011223 ACTGAGAAGCAGAAATAGTAAGG + Intronic
1118754260 14:68827225-68827247 CCTGGGAAGCAGAAGTTGCAGGG + Intergenic
1118787760 14:69060280-69060302 ACTGGGAAGAACAAAGGGCAGGG + Intronic
1119562030 14:75598183-75598205 AGTGGGAAGCAGTGGGAGCTTGG + Intronic
1120005915 14:79357910-79357932 ACTGAGCAAAAGAAGGAGCAAGG - Intronic
1120478952 14:85024283-85024305 CCTGGGAAGCACAAGGAGTCGGG - Intergenic
1120515167 14:85461998-85462020 ACTGGAAAGAACAAGGATCAAGG + Intergenic
1120650925 14:87131717-87131739 TCTGAGAAGCAGGAGAAGCAAGG + Intergenic
1120722672 14:87905463-87905485 AGTGGGAACCAGAAAGAGAAAGG - Intronic
1120838625 14:89063320-89063342 ACTGGGAGGAAGAATGAGCTGGG + Intergenic
1120946697 14:90004555-90004577 GCTGGGAAGCAGGAAGAGCTAGG + Intronic
1121236460 14:92394888-92394910 GCTGGGAAGCAGAAGAGCCAGGG - Intronic
1121519523 14:94576564-94576586 GCTGGGAAGGAGGAGGACCAGGG - Intronic
1121675422 14:95748559-95748581 TCTGGGAAGCATAAAGATCATGG - Intergenic
1122218191 14:100218216-100218238 CTTGGCAAGCAGAAGGGGCACGG - Intergenic
1122416248 14:101550991-101551013 CCTGGCAGGCAGAAGTAGCAGGG - Intergenic
1122492180 14:102125477-102125499 AGAGGGAAGCAGAATGAGCTGGG + Intronic
1122518209 14:102323412-102323434 ACGGGGAAGCAAAAGAAACAAGG - Intronic
1122939123 14:104973428-104973450 CCTGCCAAGCAGCAGGAGCAGGG + Intronic
1123072016 14:105646639-105646661 GGTAGGAAGCAGGAGGAGCAGGG - Intergenic
1123091879 14:105745565-105745587 GGTGGGAAGCAGGAGGAGCAAGG - Intergenic
1123097464 14:105773295-105773317 GGTGGAAAGCAGGAGGAGCAAGG - Intergenic
1123505403 15:20938237-20938259 GCTGGGAAGCATAGGGTGCAGGG - Intergenic
1123562642 15:21511947-21511969 GCTGGGAAGCATAGGGTGCAGGG - Intergenic
1123598887 15:21949231-21949253 GCTGGGAAGCATAGGGTGCAGGG - Intergenic
1124210870 15:27764083-27764105 ACTGAGAAACAGAAGGGACAGGG + Intronic
1124448842 15:29765814-29765836 CCTGGGAAGCAGAGGTTGCAGGG + Intronic
1125309403 15:38362129-38362151 AATGGGAAGCAGATAGACCAGGG - Intergenic
1125352192 15:38779515-38779537 ACTGGGAAGTACAAGGGGTAGGG - Intergenic
1125546182 15:40507323-40507345 ACTGGGAAGCAGCAGGCGGGCGG - Intergenic
1125910371 15:43432538-43432560 TCTGGGAAGCAGGAGAAACAGGG + Exonic
1127055225 15:55124724-55124746 GCTGGGATGCAGAAGATGCAGGG + Intergenic
1127687455 15:61362937-61362959 AATGGAAAGCAGAAAAAGCAGGG - Intergenic
1128184670 15:65634471-65634493 ACTGGGCTGAAGAAAGAGCAGGG + Intronic
1128333912 15:66773989-66774011 ACTTGGAAGGTGAAGGAGTAGGG + Intronic
1128557463 15:68641466-68641488 GGGAGGAAGCAGAAGGAGCAGGG + Intronic
1128814727 15:70599275-70599297 ACATGGAAGCAGAAAGATCAGGG - Intergenic
1129027397 15:72590267-72590289 ACTGAGAAGCAGATACAGCATGG - Exonic
1129685901 15:77686026-77686048 ATTTGGAAGCAGCTGGAGCATGG + Intronic
1129968447 15:79757181-79757203 CCCAGGAGGCAGAAGGAGCAGGG + Intergenic
1130050506 15:80480100-80480122 TCTGAGAAGAAGATGGAGCATGG + Intronic
1130381897 15:83378931-83378953 ACTGGGAAGGGGAGGGACCAAGG + Intergenic
1130425879 15:83798729-83798751 ACTGGGAGGCAGAGGTTGCAGGG + Intronic
1130537946 15:84800271-84800293 GCTGTGAAGCAGAAAGAGAATGG - Intronic
1131461866 15:92623180-92623202 AGTGGGAGACAGCAGGAGCATGG - Intronic
1131614673 15:94003938-94003960 AGGGGGCAGCAGAAGGAGAATGG - Intergenic
1132085005 15:98901265-98901287 ACTGGGGAGCAGCAGCAGCAGGG - Intronic
1132240267 15:100252483-100252505 GCCAGGAAGCAGGAGGAGCACGG + Intronic
1202970992 15_KI270727v1_random:239080-239102 GCTGGGAAGCATAGGGTGCAGGG - Intergenic
1134049083 16:11124414-11124436 ACTGGGAAGGGGAAGGAGGAAGG - Intronic
1134215645 16:12315161-12315183 ACTGTGAAGCAGAAGAAGAGTGG + Intronic
1136727978 16:32377105-32377127 ACTGGGAAGTTCAAGAAGCATGG - Intergenic
1137702496 16:50507034-50507056 ACTGGGAAGACAAAGGACCAAGG - Intergenic
1137830137 16:51536496-51536518 ACTGGGAAGTAGATAGGGCATGG + Intergenic
1139474617 16:67196846-67196868 GGTGGGCAGCAGAAGGAGGAGGG - Intronic
1139837265 16:69849203-69849225 ATTGGGAAGCAGAGCTAGCAGGG + Intronic
1139844348 16:69909047-69909069 TCTGGGAAACAAAAGGCGCATGG + Intronic
1139868125 16:70080073-70080095 ACTGGGGAGAAGAAAGAGAAGGG - Intergenic
1139918815 16:70445909-70445931 AAAGGGAAGGAGAAGGAGAAGGG - Intergenic
1139934270 16:70556961-70556983 ACTGAGAAGCAGGATGAGCTGGG + Exonic
1140375380 16:74441344-74441366 ACTGTCAAGAAGAAGGAGGAAGG - Intergenic
1140387210 16:74551780-74551802 ACTGGGGAGAAGAAAGAGAAGGG + Intronic
1140480329 16:75258955-75258977 CCTGGGAAGGAGGAGGAGGAGGG + Intronic
1140977446 16:80073671-80073693 ACTGCGAGGCAGAAGGAGTGAGG + Intergenic
1141119591 16:81341951-81341973 AATGGAAAGCAGAAGAAGCAGGG + Intronic
1141920390 16:87131924-87131946 ACAGTGAAGCAGGAGGTGCAGGG + Intronic
1142449641 16:90167504-90167526 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
1142450689 16:90171583-90171605 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
1202998460 16_KI270728v1_random:140649-140671 ACTGGGAAGTTCAAGAAGCATGG + Intergenic
1203130054 16_KI270728v1_random:1677053-1677075 ACTGGGAAGTTCAAGAAGCATGG + Intergenic
1142456876 17:62108-62130 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
1142457446 17:64341-64363 ACTGGGAGGCCGGAGGAGCTGGG + Intergenic
1142521488 17:507883-507905 ACTGGGATGGAGAAGGGGCTTGG - Intergenic
1143407024 17:6684394-6684416 CATGGCTAGCAGAAGGAGCAGGG + Intergenic
1143873949 17:9977810-9977832 ACTGGTAAGCAGAGGCAGCCAGG - Intronic
1144202398 17:12953289-12953311 AGTGTGAAGCAGCAGGAGCCAGG - Intronic
1144504838 17:15821242-15821264 TCCGGGAAGCAGCTGGAGCAGGG - Intergenic
1145062151 17:19740074-19740096 CCTCTGAAGCAGCAGGAGCAGGG - Intronic
1145110625 17:20158234-20158256 AGGGGGAAGCAGAAGGAGAAGGG + Intronic
1145111036 17:20161868-20161890 CCTGGGAGGCAGAAGTTGCAGGG - Intronic
1145169011 17:20639125-20639147 TCCGGGAAGCAGCTGGAGCAGGG - Intergenic
1146299612 17:31677946-31677968 AGTCAGAAGCTGAAGGAGCAGGG + Intergenic
1146471479 17:33128435-33128457 ACTGGGAAGCAGAATGGGGATGG + Intronic
1146550800 17:33778872-33778894 ACTGGGTAGCAATAGGGGCAGGG + Intronic
1146742552 17:35299223-35299245 ATGGAGAAGGAGAAGGAGCAGGG - Intergenic
1146962325 17:36993263-36993285 AGTGGGAAGAAGAAGGGGAATGG - Intronic
1147031705 17:37643280-37643302 ACTGAGAAGGAGCAGGAGCCCGG - Intronic
1147476163 17:40713470-40713492 AATGGGAGGGAGAAGGGGCAGGG - Intergenic
1147607850 17:41784597-41784619 TCTGGGGAGCAACAGGAGCAGGG - Intronic
1148492499 17:48032351-48032373 ACTGGGAAGGAGAATGTGAAGGG + Intronic
1148623560 17:49052586-49052608 ACCAGAAAGCAAAAGGAGCATGG + Exonic
1148716623 17:49720369-49720391 AGTGGGAAAGAGAAGGAGCGAGG - Exonic
1149444672 17:56704485-56704507 ACTGGGAATCAGGAGAGGCAGGG - Intergenic
1149654353 17:58302452-58302474 AATGTGAGACAGAAGGAGCAAGG + Intronic
1150417824 17:65001698-65001720 ACTTGGAAGCAGCAGGTGGAGGG - Intergenic
1150557126 17:66264337-66264359 AATGGGAAGTGGAAGGAGCAAGG + Intergenic
1150793826 17:68222097-68222119 ACTTGGAAGCAGCAGGTGGAGGG + Intergenic
1151635710 17:75346418-75346440 CCTGGGAGGCAGAAGTTGCAGGG + Intronic
1152175407 17:78783543-78783565 CCTGGGAAGCAGAGGTTGCAGGG - Intergenic
1153502495 18:5763269-5763291 ACTGGGAGACAGAAGTAACAAGG - Intergenic
1153912644 18:9717774-9717796 GCTGGCAAGGAGAAAGAGCAAGG + Intronic
1153994527 18:10428805-10428827 AATTGGCAGCAGCAGGAGCAGGG + Intergenic
1155128169 18:22901359-22901381 ACTGTGAAGCAAAAGTAACATGG + Intronic
1155402780 18:25457370-25457392 AATGACATGCAGAAGGAGCAGGG + Intergenic
1156250567 18:35348243-35348265 ACAGGGAAGCAGAATGGTCATGG - Intergenic
1156731026 18:40193441-40193463 CCTGGGAAGCACAAGGGGCCAGG - Intergenic
1157167849 18:45374818-45374840 ACTGCAAAGCAGAAGGATTAGGG + Intronic
1157298782 18:46464775-46464797 ACTGGGGAGGAGAGAGAGCAAGG - Intergenic
1157965729 18:52206164-52206186 ACAGGTGAGCAGAGGGAGCAAGG + Intergenic
1158085312 18:53643950-53643972 AAAGGGAAGCAAAAGGAGTAAGG - Intergenic
1158145750 18:54310024-54310046 CCTGGGAAGCACAAGGGGCCGGG - Intronic
1158275297 18:55760519-55760541 AATGGAAAGAAGAAGGAGGAGGG - Intergenic
1158790748 18:60777590-60777612 CCTGGGAAGCAGAGGTTGCAGGG + Intergenic
1158835502 18:61327440-61327462 ACTTGGAAGCAGGACGAGAAAGG - Intergenic
1159914716 18:74178382-74178404 ACCAGGAAGCAGAGGGAGGAAGG + Intergenic
1160507330 18:79434430-79434452 CCTGGGGTGCAGAGGGAGCATGG - Intronic
1160646788 19:197467-197489 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
1160975343 19:1790095-1790117 AGTGGGGAGGAGAAGGGGCAGGG - Intronic
1161621746 19:5301389-5301411 CCTGGGAGGCAGAGGGTGCAGGG - Intronic
1162119422 19:8453680-8453702 CTGGGGAAGCAGAAGGTGCAAGG + Intronic
1162248878 19:9425897-9425919 ACTGAGAGGCAGAAGGGGTAAGG + Intronic
1162433297 19:10642321-10642343 TCTGGGAAGGACACGGAGCAGGG + Intronic
1162870005 19:13579170-13579192 ACTTGAAAGCAGAAGCTGCAAGG - Intronic
1163168540 19:15514593-15514615 CCTGGGAGGCAGAAGTTGCAGGG + Intronic
1163297709 19:16422880-16422902 CCTGGGAGGCAGAAGTTGCAGGG + Intronic
1163386699 19:17004462-17004484 TCAGGGAAGGAGAAGGAGCAGGG - Intronic
1163710802 19:18845663-18845685 ACTGAGGACCACAAGGAGCAGGG - Intronic
1163786622 19:19278030-19278052 CCTGAGAAGCAGGAGGAGCTTGG - Intronic
1164655029 19:29914639-29914661 ACTGGAAAGCTGAAGGGGCAGGG + Intergenic
1165003790 19:32787874-32787896 CCTGGGAAGCACAAGGGGAAAGG - Intronic
1165731272 19:38147135-38147157 CCTGGGAGGCAGAAGTTGCAGGG - Intronic
1166478739 19:43151780-43151802 ACCAGGAAGCAGAGGGTGCATGG - Intronic
1166501410 19:43344111-43344133 ACCAGGAAGCAGAGGGTGCATGG - Intergenic
1166508703 19:43389347-43389369 ACCAGGAAGCAGAGGGTGCATGG + Intergenic
1166814196 19:45532517-45532539 ACTGGGAAGGGGTAGGAGAAGGG - Intronic
1167412480 19:49353172-49353194 CCTGGGAAGCAGAGGTTGCAGGG - Intronic
1167436460 19:49481320-49481342 ACTGGGGACCTGAAGGAGCAAGG + Intronic
1167687353 19:50964847-50964869 ACTGGGGGGCAGAAGGTGCTGGG - Intronic
1167769899 19:51508582-51508604 TGGGGGTAGCAGAAGGAGCAGGG - Intergenic
1168251571 19:55145308-55145330 AAGGGGAAGGAGAAGGAGAAGGG + Intronic
1168255569 19:55162910-55162932 GCTGGGAAGCTGGAGGAGGAGGG - Intronic
925332602 2:3070727-3070749 GCTGGGAAGCAGCAAGAGCTTGG - Intergenic
926113619 2:10197468-10197490 ACTGGGAAGCAGAAGGGCTGGGG + Intronic
926232388 2:11014202-11014224 ACTGGCAAGCAGAAGAAGCCTGG + Intergenic
926686560 2:15702891-15702913 ATTGGGAGGCAGAGGAAGCAAGG - Intronic
927045180 2:19271175-19271197 CCTGGGAAGCAGAGGTTGCAGGG - Intergenic
927746379 2:25625688-25625710 ACTCAGAAGCAGAAGGTACAAGG - Intronic
927755178 2:25702502-25702524 ACTGGGACCCAGGAAGAGCATGG - Intergenic
928401215 2:30980005-30980027 ACTGGAAAGCAAAATGAGCGAGG - Intronic
928481048 2:31683969-31683991 CCTGGGAAGCACAAGGGTCAGGG - Intergenic
928534558 2:32227455-32227477 GCTGGGAAGCATATGGAGAAGGG - Intronic
928638775 2:33276033-33276055 TCTAGGAAGCAGAAAGAGCTTGG - Intronic
929705306 2:44205493-44205515 ACTGGAAAGCAGAAACATCAAGG - Intronic
929934136 2:46282065-46282087 ATGGGGAAGGAGAAGGAACAAGG + Intergenic
930047553 2:47186512-47186534 ACTGGGAAGCGGCAGGTGAAAGG + Intergenic
930112874 2:47694190-47694212 CCTGATAAGCAGAAGGAGCCAGG + Intergenic
930191463 2:48464115-48464137 GCTGGGAAGCAAAACAAGCAAGG + Intronic
930238915 2:48915804-48915826 ACTGTAAAGCAGATGGGGCAGGG - Intergenic
930474848 2:51868723-51868745 ACTTGGAATCAGAAACAGCAGGG + Intergenic
930753013 2:54950191-54950213 ACCAGGCAGCAGAACGAGCATGG + Intronic
930884821 2:56313779-56313801 AGTGGGCAGCAGAAGGAACAGGG + Intronic
932064089 2:68534773-68534795 ACTTGGAAGAAGTAGGAGAAAGG - Intronic
932794544 2:74682989-74683011 GTTGGGATGCAGAGGGAGCAGGG - Intronic
933088515 2:78088749-78088771 ACTGGGAAGCTGGAGGAGAAGGG + Intergenic
933103955 2:78297514-78297536 GCTGGGAAGTATAAGAAGCAAGG - Intergenic
933190389 2:79327789-79327811 ACCTGGATGCAGAAGGGGCAGGG + Intronic
933775748 2:85770290-85770312 ACAGGGAAGCAGTAGGAGCTGGG - Intronic
934317991 2:91943977-91943999 ACTGGGAAGTTCAAGAAGCATGG + Intergenic
934921245 2:98346888-98346910 GGCGGGAGGCAGAAGGAGCAGGG + Intronic
935702126 2:105821908-105821930 CCCGGGAAGCAGAAGGAACGTGG - Intronic
935858363 2:107299751-107299773 CCTGGGAAGCACAAGGAGTCAGG - Intergenic
935942375 2:108254197-108254219 CCTGGGGAGGAGATGGAGCAGGG - Intronic
937273802 2:120671652-120671674 TCTGGGAAGCAGGAGGAGCCCGG - Intergenic
937315969 2:120932327-120932349 AGTGGAAAGCAGGAGGTGCAAGG - Intronic
937344322 2:121114979-121115001 CCTGGGAGGCAGAAGTTGCAGGG - Intergenic
937430184 2:121831793-121831815 ACGGGGAAGAGGAAGGAGCCAGG - Intergenic
937638062 2:124179233-124179255 CCTGGGAGGCAGAAGTTGCAGGG - Intronic
938108277 2:128547860-128547882 CCTGGGAAGCAGAAGGGGAAAGG + Intergenic
939675735 2:145069841-145069863 TCTGGCAAGCAGAATAAGCATGG + Intergenic
940111965 2:150164840-150164862 ACTCAGAGGGAGAAGGAGCAAGG - Intergenic
940227420 2:151414208-151414230 CCTGGGAAGCAGAGGTTGCAGGG + Intronic
940368343 2:152873735-152873757 ATTGGGAAGCTGAAGCAGGAGGG + Intergenic
940713238 2:157187538-157187560 CCTGGGAAGCAGAGGTTGCAGGG + Intergenic
940921945 2:159317274-159317296 GCTGGAAAAGAGAAGGAGCATGG + Intergenic
941823422 2:169865647-169865669 GCTGGAAAGCAGAAAGAGAAAGG - Intronic
942363063 2:175193136-175193158 TGTGTGAAGCAGAATGAGCAAGG - Intergenic
942423833 2:175838234-175838256 ACTGGGGAGGAGAATGACCAAGG - Intergenic
942592329 2:177559237-177559259 GCTGGGAAGTACAAGAAGCACGG - Intergenic
943094812 2:183416499-183416521 CCTGGGAAGTGCAAGGAGCAGGG + Intergenic
943202843 2:184851370-184851392 ACTCAGAAGCAGAAAGAGAATGG - Intronic
943233580 2:185290025-185290047 CCTGGGAAGCACAAGGAGTTGGG + Intergenic
945052417 2:205836581-205836603 ACCGGGCAGCAGAAGCAGCGGGG - Intergenic
945163510 2:206918293-206918315 ACTGGGAACAGGAAGAAGCAAGG + Intergenic
945703181 2:213197532-213197554 ACAGGGAAGCAAAATGAGGAAGG + Intergenic
946368724 2:219267076-219267098 AGTGGGGAGAAGAAGGAGGAGGG + Intronic
947533010 2:230924676-230924698 ACTGGGGACCAGAAGGAGCCTGG - Intronic
947672990 2:231952205-231952227 CCTGGGAGGCAGAAGTTGCAGGG + Intergenic
947705621 2:232273243-232273265 ACAGGGAAGCAAAAGGAAAATGG - Intronic
947784559 2:232804565-232804587 CCTGGGAAGCAGAGGTTGCAGGG - Intronic
948756950 2:240165539-240165561 CCTGGGAAGTGGAAGGAGGATGG + Intergenic
1168846960 20:951897-951919 ACCAGGAAGCAGAAGGAGCCAGG - Intergenic
1168880202 20:1199967-1199989 ACTGGGATTCAGTAGGAGGAAGG - Intergenic
1168923534 20:1560594-1560616 ACTGGGTAGAAGAAGAAGCTGGG + Intronic
1169612091 20:7392883-7392905 ATTGGGAAGCAAATAGAGCAGGG + Intergenic
1169631279 20:7635219-7635241 CCTGGGAGGCAGAAGTGGCAGGG - Intergenic
1169974280 20:11305964-11305986 GTTGGGAAGTAGAAGGAGAAAGG + Intergenic
1170102644 20:12719647-12719669 ACTGGGAGGCAGAGGTTGCAGGG - Intergenic
1170711968 20:18799349-18799371 ATAGGGAAGGAGGAGGAGCAAGG - Intergenic
1171085830 20:22237438-22237460 AAGGGGAAGGAGGAGGAGCAGGG - Intergenic
1172105608 20:32515547-32515569 AGTGGGAAAGAGACGGAGCAGGG + Intronic
1172519300 20:35556882-35556904 ACAGGAAAGGGGAAGGAGCAGGG + Intronic
1172863484 20:38076567-38076589 GCTGAGAAGCAGAGGCAGCAAGG - Intronic
1172953662 20:38739501-38739523 ACTGGGAAACTGAAGGGGCGGGG - Intergenic
1173301436 20:41807189-41807211 CCTGGGAAGCACAAGGGGTAGGG - Intergenic
1174183031 20:48686942-48686964 CCTGGGAAGGAGCAGGAGCCCGG - Intronic
1175169266 20:57068584-57068606 ACTGAGAATGAGTAGGAGCAAGG + Intergenic
1175241314 20:57551463-57551485 ACTGGGGAGGGGAAGAAGCAAGG + Intergenic
1175313579 20:58028834-58028856 ACTGGAATACAGAAGGAACAGGG - Intergenic
1175451470 20:59072408-59072430 ACTGGGAGCCAGAAGAGGCAAGG + Intergenic
1176278714 20:64288759-64288781 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
1177146903 21:17416603-17416625 ACTGGGAAGGGAAAGGAGGAAGG + Intergenic
1179086588 21:38223825-38223847 GGTGGGAAGCAGAGGGAGGATGG - Intronic
1179323448 21:40315889-40315911 ATTGGCAAGCAAAAGGAGGAGGG + Intronic
1179842774 21:44088020-44088042 ATCGGGAATCAGAAGGAGCCAGG - Intronic
1180306164 22:11127650-11127672 ACTGGGAAGTTCAAGAAGCATGG + Intergenic
1180544683 22:16489833-16489855 ACTGGGAAGTTCAAGAAGCATGG + Intergenic
1181292019 22:21802468-21802490 ACTGGGAGGCAGCAGGAAGAAGG - Intronic
1182880081 22:33725501-33725523 ACTGGTAATCAAAAGGGGCAGGG + Intronic
1182886407 22:33777666-33777688 AAGGGGAAGGAGAAGGAGAAGGG + Intronic
1183580563 22:38723639-38723661 ATTTGGAACCAGAAGGAACAAGG - Intronic
1183637028 22:39070371-39070393 CCTGGGAAGGAGGAGGAGGAAGG - Intronic
1184879630 22:47296749-47296771 GCTGGGAAGATGAAAGAGCACGG + Intergenic
1184974478 22:48051383-48051405 CCTGGGAGGCAGAAGTTGCAGGG + Intergenic
1184990895 22:48169341-48169363 ACAGGGAGGAAGAAGGAGGAGGG + Intergenic
1184993044 22:48183411-48183433 ATTGGGAAGCCGAAGGAACATGG + Intergenic
1185107690 22:48883579-48883601 CCTGGGAAGGAGAGGGAGTAGGG + Intergenic
949954975 3:9260030-9260052 CCTGGGAAGCACAAGGAGTCAGG + Intronic
950138005 3:10596133-10596155 GCTGGGAAGGATAAAGAGCAAGG - Intronic
950571897 3:13806162-13806184 TCTGGGAAGGAGAAGGGGCTAGG - Intergenic
950660103 3:14461879-14461901 TCTGGGCAGCAGCAGCAGCAGGG - Intronic
950773365 3:15330028-15330050 GCAGGGAAGCAGAAGGAGGCGGG + Intronic
950895820 3:16449934-16449956 ACCAGGAAGCAGCAGGAGGAGGG + Intronic
951820663 3:26807363-26807385 TCTGGGTAGCAGTAAGAGCAAGG - Intergenic
952054186 3:29424481-29424503 ACTGGGAAGTAGAAGGAAACAGG + Intronic
952108055 3:30092056-30092078 ACTGGGAAGCAAAAGGAACTAGG - Intergenic
952436947 3:33280975-33280997 ATTGGGAAGCAGAAGATGGAGGG + Intronic
952712035 3:36441241-36441263 ACTGGCAAGCACAGGGAGAAGGG - Intronic
953405858 3:42659438-42659460 ACGGGGAAGCCGAAGCAGCCGGG + Exonic
953607208 3:44419773-44419795 ACTGGGAACAAGAGGTAGCATGG - Intergenic
954030873 3:47819033-47819055 CCTGGGACGCAGCAGCAGCATGG - Intronic
954333072 3:49901110-49901132 ATTGGGAAGGAGAAGGGGCCAGG + Intronic
954460176 3:50622026-50622048 CCTGGGAACCAGAAGGAAGATGG - Intronic
954477637 3:50763355-50763377 CCCGGGAAGCAGAAGTTGCAGGG - Intronic
955316211 3:57941303-57941325 GCTGGGAAGTCCAAGGAGCATGG + Intergenic
955690005 3:61581683-61581705 CCTGGGAAGCAGAGGTTGCAGGG - Intronic
956169942 3:66425131-66425153 GCTGGGAAGCAAGAGGAGCCGGG + Intronic
956665157 3:71635462-71635484 ATTGGGAAGCAGTGGGAGGAGGG - Intergenic
956792818 3:72693255-72693277 CCTGTGAAGCAAAAGGAGAAAGG + Intergenic
957423076 3:79997676-79997698 ACTGAAAAGCAGAAAAAGCAAGG - Intergenic
958104524 3:89055018-89055040 ACTTGGAAGGAGAAGGCCCATGG + Intergenic
959844060 3:111012767-111012789 GCAGGGAAGCAGCAGGAGCAGGG - Intergenic
960672845 3:120168912-120168934 AATGGGAAGAACAAGGAGAAGGG + Intronic
961084794 3:124057625-124057647 ACTCCCAAGCAGAAGGAGCCTGG + Intergenic
961577959 3:127853968-127853990 GCTGGAACGCAGAGGGAGCATGG + Intergenic
962314457 3:134350591-134350613 ACTTGGGAACAGAAGGGGCAGGG + Intergenic
962648113 3:137460765-137460787 CCTGGGAAGCACAAGGAGTCAGG - Intergenic
962828912 3:139122741-139122763 ACATGGAGGCAGAAGGAGAATGG - Intronic
963044138 3:141090094-141090116 ACTGGGAAGCAGGAGAAGAGAGG - Intronic
963419871 3:145048118-145048140 ACAGGGAAGAAGGAGCAGCAGGG + Intergenic
963918851 3:150886726-150886748 CCAGGGAAGCAGAGGGAGGAGGG - Intronic
963994590 3:151693203-151693225 AATGGTAACCAGAAGGAGGAAGG - Intergenic
964710422 3:159665937-159665959 ACTGGAAGGCAGGAGGAGGAAGG - Intronic
965185275 3:165454898-165454920 ACTGGGAGCCAGAAGGGGGATGG + Intergenic
965847379 3:172979995-172980017 ACTGGGAAGAAAAAGGGGCTTGG - Intronic
965909370 3:173752782-173752804 ACTGGGAAGTAGAAGGAGAATGG - Intronic
966294373 3:178401968-178401990 TATGGGAAGGAGAAGGAGAAGGG - Intergenic
968261104 3:197324794-197324816 ATTGGGAGGCAGAAGGGGCCAGG + Intergenic
968261119 3:197324840-197324862 ATTGGGAGGCAGAAGGGGCCAGG + Intergenic
968370893 3:198222055-198222077 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
968376067 4:42484-42506 CCTGGGAAGCACAAGGGGCTGGG - Intergenic
968626694 4:1629131-1629153 GCTGGGAAGAGGAAGGAGCAGGG + Intronic
969201203 4:5607867-5607889 AGAAGGAAGCAGAAGGAACAGGG + Intronic
969234710 4:5857697-5857719 ACTAGTAAGCAGAAGAAGGAAGG + Intronic
969352266 4:6604546-6604568 AGCGGGGAGCAGAAGGTGCAGGG + Intronic
969587078 4:8100329-8100351 GCTGGGAAGTGGAAGAAGCAAGG - Intronic
969979526 4:11140470-11140492 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
970214597 4:13745630-13745652 GCCGGGAAGTACAAGGAGCAGGG - Intergenic
970637040 4:18021384-18021406 GCTGGGAAGGCGAAGGAGCGCGG + Intronic
970655421 4:18225307-18225329 CCTGGGAAGCACAAGGAGCTGGG - Intergenic
970708098 4:18829723-18829745 AATGGGAAGGGGAAGAAGCATGG + Intergenic
970727107 4:19060031-19060053 CCCGGGAAGCAGAAGGAGTCAGG + Intergenic
971360456 4:25933563-25933585 ACTGGGAAGGGGTACGAGCAGGG + Intergenic
971864682 4:32154301-32154323 ACGTGGCAGGAGAAGGAGCAAGG - Intergenic
972415619 4:38837337-38837359 ACTGCAAAGCAAAAGTAGCATGG + Intronic
972894595 4:43604172-43604194 TCTGGGAGGAAGAAAGAGCAAGG - Intergenic
973067245 4:45811044-45811066 GCTGGGAAGAAGAAGGGGAAGGG - Intergenic
973081922 4:46003511-46003533 CCTGGGAAGCACAAGGAGTCAGG - Intergenic
973713224 4:53649967-53649989 ACAGAGAAGAAAAAGGAGCAGGG + Intronic
974140747 4:57883434-57883456 ACTGGAAGCCAGAAGAAGCAAGG - Intergenic
974753773 4:66176784-66176806 AATGAGAAGGAGAAGGAGAAGGG + Intergenic
975479271 4:74859747-74859769 CCTGGGAAGTGCAAGGAGCAAGG + Intergenic
976455043 4:85236670-85236692 CCTAGGAAACAGAAGCAGCAAGG - Intergenic
976481835 4:85555669-85555691 GCTGGGAGGCAGCAGGAGAAGGG + Intronic
976786102 4:88823339-88823361 ATTGAGGAGCAGAAGGAGTAGGG - Intronic
978084093 4:104628932-104628954 TGTGGGCAGCAGAAGGAGAAAGG + Intergenic
978605282 4:110472852-110472874 GCTAGGAAGCACAAGAAGCATGG - Intronic
978715427 4:111836993-111837015 AGTGGGAAGGAGAAGCAGTATGG - Intergenic
979259347 4:118633682-118633704 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
979259575 4:118634543-118634565 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
979328799 4:119406081-119406103 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
979329003 4:119406881-119406903 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
980056923 4:128086661-128086683 ACTGGCAATAAGAAGGAGCTAGG + Intronic
981651916 4:147069903-147069925 ACTGCAAGGAAGAAGGAGCAGGG - Intergenic
981853593 4:149260266-149260288 ACAGGTAAGCAGAAGTACCATGG + Intergenic
982566416 4:156992501-156992523 AGGGGAAAGCAAAAGGAGCAAGG + Intergenic
983167765 4:164497982-164498004 CCTGGGAAGCACAAGGGGTAGGG - Intergenic
984155034 4:176186289-176186311 ACTGGGAAAGGGAAAGAGCAGGG - Intronic
985819032 5:2147526-2147548 CCTGGGAGGCAGAGGTAGCAGGG - Intergenic
986012757 5:3731491-3731513 ACTGGGATGCAGAAGTTCCAAGG - Intergenic
986149646 5:5115622-5115644 CCTGGGAAGCACAAGGGTCAGGG - Intergenic
986251236 5:6060304-6060326 AATAGGAAGCAGGAGGAGCCTGG + Intergenic
987247219 5:16060951-16060973 ACTGAGAACCTGAAGTAGCAGGG - Intergenic
987454112 5:18121661-18121683 AATGGGAAGCAAAAAAAGCAGGG + Intergenic
987600619 5:20064639-20064661 TCTGTGAAGCAAAAGAAGCAAGG - Intronic
988007515 5:25436251-25436273 ACTGGGAAGCAGCAGGTGAGTGG + Intergenic
988021387 5:25626839-25626861 CCTGGGAAGTACAAGGAGCCAGG + Intergenic
988680086 5:33476464-33476486 ACTGGGAAGAAGAAGGTACTGGG - Intergenic
989222864 5:38988515-38988537 AGTGGAAAGCAAAAGAAGCATGG - Intronic
989266017 5:39474975-39474997 ACTGGGATACAGAAGGTGTAGGG + Intergenic
989400076 5:40999388-40999410 TCTGGGGAAAAGAAGGAGCAAGG + Intronic
989662418 5:43814105-43814127 CCTGGGAAGCACAAGGGGCCAGG - Intergenic
990194932 5:53303911-53303933 ACTGGGAAGTAGAAGATGGAGGG - Intergenic
990274889 5:54184798-54184820 ACTGGGATCCAGGAGGAACAGGG - Intronic
990513468 5:56510587-56510609 AAAGGGATGCAGAATGAGCAAGG - Intergenic
990803438 5:59631627-59631649 CCTGGGAAGCACAAGGGGCTCGG + Intronic
990916832 5:60915737-60915759 AGTGGGAGGCAGAAGGAGACGGG - Intronic
992039864 5:72819108-72819130 GCTGGGAAGTATAAGAAGCAAGG + Intronic
992826504 5:80554653-80554675 GTTGGGAGGCAGGAGGAGCAAGG + Intergenic
993138115 5:83996370-83996392 ACTGAGCAGCAGAAGGAACAAGG + Intronic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
995369269 5:111400619-111400641 CCAGAAAAGCAGAAGGAGCAAGG - Intronic
995457725 5:112369687-112369709 ACTAGGAAGCAGGAGGAACTTGG + Intronic
996548346 5:124704940-124704962 ACTGGGAAACAGAAGAAGGGTGG + Intronic
997434136 5:133862030-133862052 ACTGAGAAGCAGGAGGGGCCAGG + Intergenic
997518791 5:134508940-134508962 ACTGGGCAGCAGGAGCAGCCTGG - Intergenic
997592493 5:135084180-135084202 ACTGGAAAGCAGATGGATGAGGG - Intronic
997632180 5:135377192-135377214 CCTGGGAAGGAGAAGGTGCCTGG + Intronic
998510952 5:142713518-142713540 CCTGGGAAACAGGAGGAGAACGG - Intergenic
998620932 5:143793564-143793586 CCTGGTAAGCAGAAGGAGAATGG - Intergenic
999251079 5:150182746-150182768 CCTGAGAAGCAGAAGGAGCCGGG - Exonic
999795785 5:154988664-154988686 AGTGGGAAACAGAAAGAGGATGG - Intergenic
1000072963 5:157758188-157758210 CCTGGGAGGCAGAAGTTGCAGGG - Exonic
1000142482 5:158418998-158419020 ACTGAGTAGCAGAAGGAAGAGGG + Intergenic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000574782 5:162964626-162964648 ACTGGGAAGCACAAGGGGTCAGG - Intergenic
1000798455 5:165693673-165693695 CCTGGGAAGCAGAAGGTGTCAGG - Intergenic
1001123018 5:168995722-168995744 ACAGGGAAGCAGAGGGAGCAGGG - Intronic
1001308947 5:170596875-170596897 TCTGGGAAGCAGACACAGCAAGG + Intronic
1001737797 5:174021047-174021069 AAGGGGAAGCAGAAGGGGAAAGG + Intergenic
1001943288 5:175755881-175755903 CCTGGGAAGCAGAGGCTGCAGGG + Intergenic
1002427838 5:179186328-179186350 GCTGGACAGCAGAAGGAGCCCGG - Intronic
1002519830 5:179786162-179786184 CCTGGGAAGCAGAGGTTGCAGGG + Intronic
1002673131 5:180886355-180886377 CCTGGGAAGCACAAGGGGCAGGG - Intergenic
1002684493 5:180997492-180997514 AGTGGGGAGAAGGAGGAGCAAGG + Intronic
1002686046 5:181010349-181010371 AATGGAAAGCAAAAAGAGCAGGG + Intergenic
1002729568 5:181325426-181325448 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
1002730127 5:181327611-181327633 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
1002754405 6:146488-146510 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
1002966753 6:1974306-1974328 ACTGGCAAGCAAAAGGAAAATGG + Intronic
1003097656 6:3155382-3155404 ACTGGAAGGAAGAAAGAGCAAGG - Intronic
1003101340 6:3178689-3178711 ACTGGAAGGAAGAAAGAGCAAGG - Intergenic
1003884765 6:10511723-10511745 AATGGGAAGGGAAAGGAGCAGGG + Intronic
1003890069 6:10556143-10556165 ACGGGGAGGCAGAGGGAGGAGGG + Intronic
1004034178 6:11906612-11906634 AATGGGAAGGACAAGGAGAATGG - Intergenic
1004453157 6:15766229-15766251 ACTGGGAAGGATCAGCAGCAAGG + Intergenic
1005466788 6:26123590-26123612 TCCGGGAAGCAGCAGGCGCACGG + Exonic
1005473401 6:26184088-26184110 CCCGGGAAGCAGCAGGCGCACGG - Exonic
1005993604 6:30918727-30918749 ACTGGAAAGGGGAAGGGGCAGGG - Intronic
1006635440 6:35458203-35458225 ACTGGACAGCAGACAGAGCAGGG - Intronic
1007070577 6:39035115-39035137 CATGGTAACCAGAAGGAGCATGG + Intergenic
1007207229 6:40162795-40162817 CCTGGGAAGCAGGAGAACCAGGG - Intergenic
1007291825 6:40793365-40793387 ATTAGAAAGCAGATGGAGCAGGG + Intergenic
1007367307 6:41403965-41403987 ATTTGGAAGGAGCAGGAGCACGG - Intergenic
1007727863 6:43927524-43927546 ACTGGGAGGCTGTAGGAGCCTGG + Intergenic
1008077263 6:47158180-47158202 AGAGGGAAGCAGAAGGAGCGAGG + Intergenic
1008111248 6:47497362-47497384 ACAGGGAAGGAGAAGGGGAAGGG - Intronic
1008425293 6:51349568-51349590 CCTGGGAAGCACAAGGAGCCAGG - Intergenic
1008996929 6:57669697-57669719 ATTGGGAGGCAGAAGAAGGAGGG + Intergenic
1009403585 6:63285798-63285820 ACTGAGAAGCAAAAGGAGACTGG + Intronic
1009563352 6:65276766-65276788 ATTGGGTAGTAGAAGAAGCAGGG + Intronic
1009628056 6:66162035-66162057 ACAGGGAGGCACAAAGAGCAAGG + Intergenic
1010034361 6:71306344-71306366 ACTAGAATGCAGAAGGAGCAGGG - Exonic
1011289884 6:85765911-85765933 CCTGGGAGGCAGAGGTAGCAAGG + Intergenic
1011366588 6:86588788-86588810 AGCAGGAGGCAGAAGGAGCAGGG + Intergenic
1012373786 6:98537170-98537192 CCTGGGAGGCAGAAGTTGCAGGG + Intergenic
1012510994 6:100001665-100001687 ACGGGGAAGCATCATGAGCATGG - Intergenic
1014588585 6:123232513-123232535 TCTGAGAAGCAGAAAGGGCAAGG + Intronic
1014708108 6:124773290-124773312 AATGGGAAGGAGAAAGAGGAGGG + Intronic
1015219502 6:130788006-130788028 TCTGGGAAGGAGTGGGAGCAAGG + Intergenic
1015392998 6:132703879-132703901 AATGGAAAACAAAAGGAGCAGGG + Intronic
1016161323 6:140884000-140884022 AAGGGGAAGGAGAAGGAGAACGG - Intergenic
1016269498 6:142272389-142272411 ACTGGGGAGCAGAAAGAAAAGGG + Intergenic
1016701189 6:147056042-147056064 ACGGGGAAGAAGAAGGAAAAAGG + Intergenic
1017097869 6:150820787-150820809 CCTGGGAAGCAGAGGTTGCAAGG + Intronic
1017658056 6:156648912-156648934 ACAGGGGAGCAGGAGGGGCACGG - Intergenic
1017968780 6:159290797-159290819 CCTGGGAAGCACAAGGAGTTGGG - Intergenic
1018642595 6:165917911-165917933 ACAGGGCAGCAGGAGGAACAGGG - Intronic
1018950177 6:168373984-168374006 CCAGGGAAGGAGAAGGAGCTGGG + Intergenic
1019287779 7:232125-232147 GCTGGGTAGCAGCGGGAGCAAGG + Intronic
1019801968 7:3094513-3094535 ACTGGAAACCAGAAGGAGGCGGG + Intergenic
1019959826 7:4449804-4449826 AGGGGGCAGCAGCAGGAGCAGGG - Intergenic
1021393193 7:20119543-20119565 GCTGGGAAGTTGGAGGAGCATGG + Intergenic
1022021468 7:26403448-26403470 CCTGGGAGGCAGAAGTTGCAGGG - Intergenic
1022195998 7:28067884-28067906 ACTTAGAAGCAGAAGGAGACGGG - Intronic
1023400792 7:39792213-39792235 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
1023894238 7:44418806-44418828 CCTGGGAAGTGCAAGGAGCAGGG + Intronic
1023998133 7:45174485-45174507 CCCGGGTAGCAGAAGGAGCGTGG - Intronic
1024074257 7:45810728-45810750 GCTGGGAGGCAGGAGGAGCTGGG - Intergenic
1024075286 7:45814811-45814833 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
1024118322 7:46213353-46213375 CTCAGGAAGCAGAAGGAGCAGGG + Intergenic
1024189960 7:46996121-46996143 CCTGGGAACCTGAAGCAGCAGGG - Intergenic
1024461655 7:49665945-49665967 ACTGGGAAGCACAAGGGGTCAGG + Intergenic
1024648313 7:51386512-51386534 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
1024648844 7:51388585-51388607 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
1024649077 7:51389470-51389492 ACTGGGAGGCAGGAGGAGGTGGG + Intergenic
1025052163 7:55740981-55741003 ACTGGGAGGCAGGAGAAGCTGGG + Intergenic
1025053155 7:55744800-55744822 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
1025140530 7:56459786-56459808 TCTGGGAAGCAGAAGTTGCAGGG + Intergenic
1025181929 7:56827723-56827745 ACTGGGAGACAGGAGGAGCTGGG + Intergenic
1025182075 7:56828345-56828367 ACTGGGAGACAGGAGGAGCTGGG + Intergenic
1025689852 7:63748650-63748672 ACTGGGAGACAGGAGGAGCTGGG - Intergenic
1026014538 7:66662657-66662679 ACAGGGAGGAACAAGGAGCAGGG - Intronic
1026310043 7:69175505-69175527 ACAAGGAAGCAAAAGGACCAGGG + Intergenic
1026671821 7:72397445-72397467 ACTGGGGAGATGAATGAGCATGG - Intronic
1026817567 7:73524006-73524028 ACTGGGAAGCTGAGGCAGAATGG + Intergenic
1026890325 7:73977881-73977903 ACAGGGAAGAACAAGGAGCCAGG - Intergenic
1027582793 7:80020006-80020028 CCTGGGAAGCACAAGGGGTAGGG + Intergenic
1027617409 7:80440652-80440674 AATAGGAAGCAAAAAGAGCATGG - Intronic
1028114457 7:86981865-86981887 ACTGGGAAGCACAAGGGGTCAGG + Intronic
1028479039 7:91284539-91284561 CCTGGGAAGTTGAAGAAGCATGG + Intergenic
1029049884 7:97674697-97674719 ACAGGGAAGCCCAAGGAGAATGG - Intergenic
1029139482 7:98400376-98400398 ACTGGGGAGAAGAAGGGACAGGG + Intronic
1029416781 7:100448112-100448134 CCCGGGAAGCAGAAGTTGCAGGG + Intergenic
1029611733 7:101630248-101630270 ACTGGGAGGGAGCAGGAGGAGGG - Intergenic
1030221054 7:107099446-107099468 ACTGGGAAGCACAAGGGGTCAGG - Intronic
1030380908 7:108810965-108810987 CCTGGCAAGCAGAAGCAGCTGGG - Intergenic
1030564601 7:111137898-111137920 CCTGGGAAGCAGAGGTTGCAGGG - Intronic
1031762665 7:125734156-125734178 ACTTGGAAAAAGCAGGAGCAAGG + Intergenic
1031798822 7:126215396-126215418 ACAGGAGAGCAGAAAGAGCATGG - Intergenic
1032051289 7:128652547-128652569 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
1032051800 7:128654534-128654556 ACTGGGAGGCAGGAAGAGCTGGG - Intergenic
1032669984 7:134073888-134073910 ACTGTGTCGCAGAAGGAGCCCGG - Intergenic
1032763791 7:134971197-134971219 ACTGGCAATGAGAAGGAGGATGG - Intergenic
1033041707 7:137925178-137925200 AGTGGGAAGGAGAAGGAGAGAGG + Intronic
1033563987 7:142560981-142561003 GCTGGGAGGTAGAAGGAGAAGGG - Intergenic
1034151564 7:148920845-148920867 ACTGGGAAGCACATAGACCAGGG - Intergenic
1034195507 7:149244009-149244031 ACTGGGAGGCAGAGGTTGCAAGG - Intronic
1034971712 7:155423630-155423652 ACGGGGAAGCAGAGGGGGCCGGG + Intergenic
1035044582 7:155955254-155955276 ACTGGTAAGCACCAGCAGCAGGG - Intergenic
1035306263 7:157934673-157934695 TCTGGGAAGCAGGAGGTCCAAGG - Intronic
1035458914 7:159027379-159027401 GATGGGAGGCAGAAGGTGCAGGG - Intergenic
1035581852 8:745087-745109 ACTCGGAAGCAGCGGGAGAAGGG - Intergenic
1035704428 8:1664316-1664338 CCTGGGAAGCAGGAGTAGGACGG - Intronic
1035941555 8:3907098-3907120 AGTGGGAAGCCGAAGAAGAAGGG - Intronic
1037676977 8:21059417-21059439 AGTGGCAAGGAGAAGGAGAAGGG - Intergenic
1037915745 8:22772263-22772285 TCTGGGCAGGAGAGGGAGCAGGG + Intronic
1038198514 8:25390121-25390143 GCTGTGAAGCAGGAGGAACAGGG + Intronic
1039456797 8:37712596-37712618 ACAGGGAAACAGAAGGAGGTGGG - Intergenic
1039889564 8:41674837-41674859 ACTAGGAAGAACAAGGAGGAAGG + Intronic
1040793260 8:51258560-51258582 AATGGGAAGAAGAATGAGAAGGG + Intergenic
1041338313 8:56812506-56812528 CCTGGGAAGCACAAGGGGCCAGG - Intergenic
1041705303 8:60840576-60840598 ATTGGGAAGCTGAAGGTGGAAGG - Intronic
1042113499 8:65406890-65406912 GCTGGGAAGTATAAGAAGCATGG + Intergenic
1042414236 8:68500904-68500926 ACAGGGAGGCAGAAGAAGCTTGG + Intronic
1042420152 8:68578902-68578924 ATTGGAAAGCAAAAGGAGTATGG - Intronic
1042852748 8:73233107-73233129 AGTGGGAAGAAGAAGGAGGAAGG - Intergenic
1043322169 8:79001127-79001149 ACTGCGAATATGAAGGAGCACGG - Intergenic
1043414980 8:80038476-80038498 CCTGTGAAGAACAAGGAGCAGGG - Intronic
1043654967 8:82651727-82651749 AGAAGGGAGCAGAAGGAGCAAGG + Intergenic
1043938900 8:86174323-86174345 CCTGGGAAGCAGAAGGGGTGGGG - Intergenic
1044402224 8:91786119-91786141 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1044402229 8:91786137-91786159 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1044405196 8:91818637-91818659 CCTGGGAAGCGCAAGGAGCCAGG + Intergenic
1044809092 8:96039052-96039074 CCTGGGAAGCACAAGGAGTGGGG - Intergenic
1045009234 8:97943382-97943404 ACAGAGAAGGAGAAGGAGAAAGG - Intronic
1045504861 8:102771262-102771284 ACTTGGAAGCACAGGGAGGAGGG - Intergenic
1045505016 8:102772140-102772162 CCTGGGAAGCAGAGGTTGCAGGG + Intergenic
1045522391 8:102914600-102914622 CCTGGGGAAGAGAAGGAGCATGG - Intronic
1046154843 8:110274805-110274827 ACTGGGAAACAGGCTGAGCATGG + Intergenic
1046984314 8:120370485-120370507 GCAGGGATGCAGAAGAAGCAGGG - Intronic
1047023870 8:120806676-120806698 ACTGGAAAGCATAGGGAGCTGGG - Intronic
1047121226 8:121907824-121907846 ACCGGGAAGTACAAGGAGCCGGG + Intergenic
1048266871 8:132995061-132995083 ACAGGCAAGCAGAAGGAGCCAGG + Intronic
1048577797 8:135706573-135706595 TCTAGCAAGCTGAAGGAGCAGGG - Intergenic
1049067637 8:140330001-140330023 CCTGGGAGGCAGAAGTTGCAGGG + Intronic
1049199866 8:141334735-141334757 CCTGGTAAACAGTAGGAGCACGG + Intergenic
1049287479 8:141783660-141783682 AATGGGAAACAGCAGGAGAAGGG + Intergenic
1049367035 8:142244818-142244840 GCAGGGGAGCAGAGGGAGCAGGG + Intronic
1050404408 9:5292954-5292976 ACTGGGAAGCACAAGGGGTGAGG + Intergenic
1050412618 9:5382487-5382509 CCTGGAAAGAAGAATGAGCATGG + Intronic
1051218457 9:14823541-14823563 ACAGGGTTTCAGAAGGAGCATGG + Intronic
1051238591 9:15027503-15027525 AATGGAAAGCAGAAAAAGCAGGG + Intergenic
1051350152 9:16191414-16191436 ACTTGGGAGCAGAGGGAGGAAGG + Intergenic
1051380224 9:16450510-16450532 ACTGGCAAGCATAAGTAACAGGG + Intronic
1051840457 9:21391951-21391973 GCTGCGAAGCAGGAGGAGGAAGG + Intergenic
1052216813 9:25976050-25976072 AAGGGGAAGCAGAAGGTGAAGGG - Intergenic
1052639695 9:31151060-31151082 GCTGGGAAGCCCAAGAAGCATGG + Intergenic
1052784058 9:32812339-32812361 CCTGGGAAGCAGAGGTTGCAGGG + Intergenic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053157781 9:35792259-35792281 GCTGGGATGCAGAAGGTGCTGGG - Exonic
1053452161 9:38202342-38202364 ACCGGGAAGCACACAGAGCAGGG - Intergenic
1053582936 9:39425826-39425848 TCCGGGAAGCAGAAGGGGCCGGG + Intergenic
1053847121 9:42250691-42250713 CCTGGGAAGAAGAAGGGGCTGGG + Intergenic
1054104515 9:60984569-60984591 TCCGGGAAGCAGAAGGGGCCGGG + Intergenic
1054581827 9:66922280-66922302 CCCGGGAAGCAGAAGGGGCCAGG - Intronic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055474667 9:76650081-76650103 ACTGGGAAGCAGCATGGGCCAGG + Intronic
1055792235 9:79935203-79935225 ATGGGTAAGCAAAAGGAGCAGGG + Intergenic
1056251195 9:84750065-84750087 ACTGTGGAGCAGGTGGAGCAGGG + Intronic
1056253210 9:84771971-84771993 ATAGAGTAGCAGAAGGAGCAGGG + Intronic
1056514982 9:87341706-87341728 ACTGGGAAGCAGGAGCTGAAGGG - Intergenic
1057456659 9:95219250-95219272 TCTGTGAAGCAGCAGGAGTAAGG + Intronic
1057725985 9:97568514-97568536 ACAGGGAAGCAGAAAGGGAAGGG + Intronic
1059116496 9:111604402-111604424 ACTGGAAAGCTGAAAGTGCAGGG - Intergenic
1060175373 9:121493717-121493739 TCTAGGAAGCTGAAGGAGGATGG - Intergenic
1060294623 9:122334881-122334903 ACTGGGCAGCCAAAGGAGCAGGG - Intergenic
1060718311 9:125955319-125955341 CCTGGGGAGGAGCAGGAGCAAGG - Intronic
1061364294 9:130163388-130163410 CCTGGGAAGCAGAGGCTGCAGGG - Intergenic
1061998620 9:134204289-134204311 AATCAGAAACAGAAGGAGCAGGG - Intergenic
1062109873 9:134776455-134776477 ACTTGGAAGCAGAGGGTGGAAGG + Intronic
1062571420 9:137187431-137187453 GCGGGGAACCAGAAGGAGCAAGG + Intronic
1062638364 9:137503439-137503461 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638371 9:137503458-137503480 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638378 9:137503477-137503499 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638397 9:137503534-137503556 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062754542 9:138280125-138280147 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
1203573159 Un_KI270744v1:151666-151688 CCTGGGAAGCACAAGGGGCTGGG + Intergenic
1203577539 Un_KI270745v1:20695-20717 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
1203578444 Un_KI270745v1:24285-24307 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
1186155913 X:6726265-6726287 GCTGGGAAGCACAGAGAGCAGGG + Intergenic
1186452367 X:9684227-9684249 CCTGGGAAGCTGCAGGAGCTTGG + Intronic
1186557293 X:10573334-10573356 GCTGGGAAGTACAAGAAGCATGG + Intronic
1186893815 X:13986560-13986582 TCTGGGCAGCAGGAGGAGAAAGG + Intergenic
1187393983 X:18904215-18904237 AGTGGAAAACAGAAGGAGAAGGG + Intronic
1187520678 X:20011264-20011286 ACAGGGAAGCAGATTGAGCAGGG + Intronic
1187843796 X:23515450-23515472 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1188107106 X:26159209-26159231 GCTGGGAAGTAGTAGGAGCTGGG - Intergenic
1188770605 X:34148652-34148674 CCTGGGAAGCTCAGGGAGCAAGG + Intergenic
1188905313 X:35784538-35784560 AGTGGGAAGCAGAGTAAGCAGGG + Intergenic
1189028011 X:37418850-37418872 ACTAGAAAGCAAAAGGGGCAGGG - Intronic
1189039533 X:37528286-37528308 AATGGGAAGCAAAAAAAGCAGGG - Intronic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189590464 X:42505768-42505790 ATTTGGAAGCAGAATGAGGATGG + Intergenic
1190566354 X:51733818-51733840 GCTGGGAAGCTCAAGGGGCATGG - Intergenic
1190621534 X:52291981-52292003 ACTGGGAAGCGCAAGGGGCCAGG + Intergenic
1191070421 X:56394675-56394697 ACTGGGAAGCACAAGGAGTCAGG - Intergenic
1191129853 X:56995794-56995816 GGTGGAAAGCAGAAGGGGCAGGG - Intergenic
1192146568 X:68686639-68686661 ACAAGGAGGCAGAGGGAGCAGGG - Intronic
1192261935 X:69510752-69510774 TCTGGGAAGGAGCAGGAGCCAGG + Intronic
1192287782 X:69756522-69756544 ACAGGGAAGCAGATGGATGAGGG - Intronic
1192506622 X:71689526-71689548 GCTGGGAAGTAGGAGGAGCATGG + Intergenic
1192520075 X:71792020-71792042 GCTGGGAAGTAGGAGGAGCATGG - Intergenic
1192526106 X:71846035-71846057 GCTGGGAAGTAGAGGAAGCATGG + Intergenic
1192702958 X:73495859-73495881 AATGGAAAGCAGAAGAAGCAGGG - Intergenic
1192936425 X:75863177-75863199 ACTGGGAAGCACAAGGGGTTGGG - Intergenic
1192949167 X:75998065-75998087 CCTGGGAAGCACAAGGGGTAGGG - Intergenic
1193363954 X:80608368-80608390 AGTGAGAAGTAGAAGGGGCAGGG - Intergenic
1193511046 X:82400171-82400193 ACTGGAAGCCAGAAGGGGCACGG + Intergenic
1194143022 X:90228621-90228643 AGAGGCAAGCAGAAGGAGAAGGG - Intergenic
1194158471 X:90422299-90422321 CCTGGGAAGCACAAGGGGCCAGG + Intergenic
1194515402 X:94845451-94845473 CCAGGGAAGCACAAGGGGCAAGG - Intergenic
1195127509 X:101822772-101822794 TCTGGGAAGTGCAAGGAGCAGGG - Intergenic
1196050325 X:111297596-111297618 ACTGTGGAGGAGAAGGAGGAAGG + Exonic
1196219924 X:113101577-113101599 CCTGGGATGCAGCAGAAGCAGGG - Intergenic
1196922641 X:120600427-120600449 CCCGGGAAGCAGAGGGTGCAGGG + Intronic
1197489757 X:127102425-127102447 CCTGGGAAGCACAAGGGGCCAGG + Intergenic
1198133977 X:133728338-133728360 AATGAGAAGGAGAAGGAGAAAGG + Intronic
1198645568 X:138802353-138802375 CCTGGGAAGTACAAGGAGCTGGG - Intronic
1198680624 X:139177972-139177994 CCTGGGAAGCACAAGGAGCTGGG - Intronic
1198724372 X:139661533-139661555 TGTGGGAAGGAGAAGGAGAAAGG + Intronic
1198757947 X:140000790-140000812 CCTGGGAAGCGCAAGGGGCAGGG + Intergenic
1199067612 X:143438837-143438859 ACTGGGAAGGAGAATGAGCCAGG - Intergenic
1199849516 X:151715487-151715509 ACTGGGACTTAGAAGGTGCAGGG + Intergenic
1200379716 X:155822221-155822243 AAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1200379724 X:155822245-155822267 AAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1200488775 Y:3797940-3797962 AGAGGCAAGCAGAAGGAGAAGGG - Intergenic
1200504788 Y:3999267-3999289 CCTGGGAAGCACAAGGGGCCAGG + Intergenic
1201185553 Y:11399015-11399037 ACTGGGAAGTTCAAGAAGCATGG + Intergenic
1201549294 Y:15202524-15202546 GCTGGGAAGCATAGAGAGCAGGG + Intergenic
1201710164 Y:16982549-16982571 ACTAGAAAGCAGAAGGAGAAAGG - Intergenic
1201916838 Y:19191036-19191058 ACTGGGAAGCAAAAGGGGTCAGG - Intergenic
1201945175 Y:19503199-19503221 AGGGGGAAGGAGAGGGAGCAAGG + Intergenic
1202381082 Y:24276911-24276933 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
1202489703 Y:25393215-25393237 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
1202583724 Y:26404879-26404901 CCAGGGCAGCAGAAGGGGCAGGG + Intergenic