ID: 1092510418

View in Genome Browser
Species Human (GRCh38)
Location 12:9149655-9149677
Sequence GTGACTAGACAGATTTAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 86}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092510418 Original CRISPR GTGACTAGACAGATTTAGCA TGG (reversed) Intronic
901489229 1:9588420-9588442 TTGACTAGACAGGATTAGCGAGG + Intergenic
901688406 1:10957486-10957508 GAGACTGGACAGATTTAGGCAGG - Intronic
906859952 1:49348773-49348795 GTGATTGGTCAGAGTTAGCATGG - Intronic
908156700 1:61360670-61360692 GTGACTATAAAGGTGTAGCACGG + Intronic
911447476 1:98015878-98015900 GTGACTAGTCAGATTTCAAATGG - Intergenic
912670018 1:111616834-111616856 GTGACTAGAGAAGCTTAGCATGG - Intronic
913692770 1:121295172-121295194 GTGAGTAGACTGGTTTAGCTGGG + Intronic
914144789 1:144984916-144984938 GTGAGTAGACTGGTTTAGCTGGG - Intronic
914428882 1:147601656-147601678 GTGATTGGAAAGTTTTAGCAAGG + Intronic
920480089 1:206313537-206313559 GTGAGTAGACTGGTTTAGCTGGG + Intronic
1070706469 10:78642656-78642678 GTGACTTCACAGATATAGCCTGG - Intergenic
1073756502 10:106586568-106586590 GTAACTAGACTGAGTTAGCCAGG - Intronic
1074383937 10:113002369-113002391 ATGTCTAGAGACATTTAGCATGG + Intronic
1074676715 10:115859575-115859597 GTGACTAGAAGGAATTTGCAGGG - Intronic
1074708174 10:116154560-116154582 GTGACTAGAAGGAGTTAGGAGGG + Intronic
1082021195 11:47534855-47534877 GTGACAACACACATTTAGCTGGG - Intronic
1088270157 11:108026194-108026216 GTGAAGAGACAGATTTAACCAGG - Intronic
1092510418 12:9149655-9149677 GTGACTAGACAGATTTAGCATGG - Intronic
1093342020 12:17988689-17988711 GTGGCTGGTCATATTTAGCAGGG - Intergenic
1093640549 12:21522823-21522845 ATGGCTAGACAGAAATAGCAGGG - Intergenic
1101267873 12:103110801-103110823 TTGAGAAGACAGATTTGGCAAGG + Intergenic
1102860144 12:116329402-116329424 GTATCTCGACAAATTTAGCATGG - Intergenic
1103382475 12:120505180-120505202 GTGACTAGACAAAGTTAGCTGGG + Intronic
1109089040 13:58015837-58015859 CTGGCTAGACTGACTTAGCAGGG - Intergenic
1111166175 13:84460561-84460583 GTGAGTAGAGAGATTTTGAATGG - Intergenic
1115476155 14:33814853-33814875 GTGACAAGATAGATTCTGCAAGG - Intergenic
1117575540 14:57093553-57093575 GAAACTAGACAGAGTGAGCATGG + Intergenic
1119008440 14:70957087-70957109 GTTAGTAGACAGATTTAGCCCGG - Intronic
1121293636 14:92798152-92798174 GTCAATAGACAGTTGTAGCAGGG + Intronic
1126493747 15:49267386-49267408 CTCACTAAACTGATTTAGCAAGG + Intronic
1128167395 15:65477856-65477878 GTAACTTAACAGATTTGGCATGG - Intronic
1129304235 15:74647312-74647334 GTGCCTAGACAGAGTGAGAAAGG - Intronic
1130579573 15:85123975-85123997 GTGGCTAGAAAGATATATCAAGG - Intronic
1138062611 16:53907695-53907717 GTGATTAGACTGATTGAGAAAGG - Intronic
1141916809 16:87103524-87103546 GTGACTACACAGCTTCAGGATGG - Intronic
1147894499 17:43741701-43741723 GTGACAAGTCAGAGTTTGCAGGG - Intergenic
1154246132 18:12701510-12701532 GTGACGAAACAGATTTATAAAGG - Intronic
1156911452 18:42415566-42415588 TTCACTAAGCAGATTTAGCATGG + Intergenic
925521275 2:4748191-4748213 GTGAATATAAAGTTTTAGCAAGG - Intergenic
928400918 2:30978135-30978157 GTGACTGGGCTGGTTTAGCAGGG - Intronic
928990895 2:37232056-37232078 GTGAATGGTCAGATTTATCATGG + Intronic
930610854 2:53541530-53541552 ATAAGTAGACAGATTAAGCATGG - Intronic
931741973 2:65254144-65254166 GTGAGTAGACAGATATTTCAAGG + Intronic
943922978 2:193733739-193733761 TTGAATAGACAGATGTAACAAGG + Intergenic
946015996 2:216604436-216604458 CTTGCTAGACTGATTTAGCAGGG + Intergenic
1169845297 20:9984417-9984439 GCTACTAGACAGATTAAACATGG - Intergenic
1170322617 20:15117063-15117085 TTGTCAAGACAGTTTTAGCATGG - Intronic
1174745559 20:53058365-53058387 TTGACTAGGTAGATTTATCAAGG - Intronic
1177380870 21:20342776-20342798 GTGATTAAACAGTATTAGCAAGG + Intergenic
951252039 3:20405082-20405104 GTGAATAAACAGATATAGAATGG - Intergenic
952615174 3:35262492-35262514 GTGACAAGACAAATTTTGGAGGG + Intergenic
954774626 3:53005714-53005736 GTGACTAGACCAATTTGGCTGGG + Intronic
957645024 3:82910431-82910453 GTGACAAGACGCATTTATCAGGG + Intergenic
957898131 3:86450102-86450124 GTGCATAGAGAGTTTTAGCAAGG - Intergenic
963530987 3:146473086-146473108 GTGTCTAGACAGATATAATAAGG - Intronic
964592366 3:158378893-158378915 GTGAATAAACAGATTTTGGAGGG - Intronic
965627061 3:170691749-170691771 GGGCCTAGACAGATTTATAATGG + Intronic
970550625 4:17177438-17177460 ATGGCTAGACATATTTATCAAGG - Intergenic
971648553 4:29240085-29240107 GTGGCTTGATAGATTTAGCATGG + Intergenic
974787404 4:66636967-66636989 GTGACTAGAGGAAATTAGCATGG - Intergenic
981728668 4:147874317-147874339 GTGAAGTGACAGAATTAGCAAGG - Intronic
984619361 4:181935500-181935522 GAGACTAGACTGAATTAGCAAGG - Intergenic
987143887 5:14972435-14972457 GGAACTAGACAGAGTTTGCATGG + Intergenic
993080853 5:83298560-83298582 GTGAATAAACAGATATACCAGGG - Intronic
993953361 5:94202048-94202070 CTGGCTAAACTGATTTAGCAAGG + Intronic
995246084 5:109937151-109937173 GTGACTAGACAGATTGAGTCAGG - Intergenic
997843249 5:137261793-137261815 ATGGCTGGAGAGATTTAGCATGG - Intronic
1003011276 6:2429633-2429655 GTGATTATACCGATTTACCATGG + Intergenic
1005050323 6:21678204-21678226 GTGACTAGACAGACAAAACATGG - Intergenic
1005967583 6:30738294-30738316 GTGACTTGACAGGTTGAACATGG - Intronic
1009315694 6:62216907-62216929 GGGACTCAACACATTTAGCAGGG + Intronic
1012020632 6:93914175-93914197 GTGAATAAACAGCTTTAGCGAGG + Intergenic
1014940426 6:127431827-127431849 GTGATTACACAAATTTTGCATGG + Intergenic
1023875707 7:44285180-44285202 GTGACTAGTCAGATTCTGCGGGG - Intronic
1028690527 7:93644587-93644609 ATGACTAGACAGAGATAGTAGGG - Intronic
1029170017 7:98623919-98623941 GTGACTAGAAAGCTTGAGGAAGG - Intronic
1031049156 7:116927638-116927660 GTGACTAGGGGGATTTAGTAGGG + Intergenic
1033872944 7:145779188-145779210 GTGAGTAGACAGATTAGGGAAGG + Intergenic
1036295768 8:7535805-7535827 GCCATTACACAGATTTAGCAGGG + Intergenic
1036326799 8:7785215-7785237 GCCATTACACAGATTTAGCAGGG - Intergenic
1036485979 8:9179036-9179058 CTGAATAGGCAGATTTAACAGGG - Intergenic
1036992277 8:13611779-13611801 AAGACAAGACAGATTTAGGAAGG - Intergenic
1038763173 8:30403629-30403651 GTGTATACACAGATTTAGCTAGG - Intronic
1045253256 8:100498798-100498820 GTGCTTAGACAGAGTTAGGAAGG - Intergenic
1046262178 8:111782815-111782837 GTAACGAGGCAGATTTAGCCAGG + Intergenic
1050066900 9:1769446-1769468 GTGACTGGACACCATTAGCAGGG - Intergenic
1056036042 9:82606912-82606934 GGGAGTAGTCAGATTTAGCAGGG + Intergenic
1057730265 9:97602398-97602420 GTGACTATACAGAGAAAGCATGG - Exonic
1058731219 9:107851647-107851669 GAAACTAGACAAATTTAACAGGG + Intergenic
1061494453 9:130963707-130963729 CTGACCACACTGATTTAGCAGGG + Intergenic
1189015755 X:37094868-37094890 GTGTATACACAGATTTAGCTAGG - Intergenic
1192582165 X:72293176-72293198 ATGACTAGACAAATTCAGCAAGG - Intronic
1196131134 X:112157772-112157794 GAGACTAGTCAGATTGAACAGGG - Intergenic
1201592061 Y:15626397-15626419 GTGTCTAGACAGATAGAGAATGG - Intergenic