ID: 1092510976

View in Genome Browser
Species Human (GRCh38)
Location 12:9156359-9156381
Sequence CAAGATCCAGAGATGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 536
Summary {0: 1, 1: 0, 2: 3, 3: 56, 4: 476}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092510976_1092510979 4 Left 1092510976 12:9156359-9156381 CCTTCCTCCATCTCTGGATCTTG 0: 1
1: 0
2: 3
3: 56
4: 476
Right 1092510979 12:9156386-9156408 TGTCAGAGAACATCTCAGCGTGG 0: 1
1: 0
2: 3
3: 10
4: 189
1092510976_1092510980 19 Left 1092510976 12:9156359-9156381 CCTTCCTCCATCTCTGGATCTTG 0: 1
1: 0
2: 3
3: 56
4: 476
Right 1092510980 12:9156401-9156423 CAGCGTGGCTGATGAGATCCTGG 0: 1
1: 0
2: 3
3: 11
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092510976 Original CRISPR CAAGATCCAGAGATGGAGGA AGG (reversed) Intronic
900917950 1:5651438-5651460 GAGGAACCAGAGCTGGAGGAAGG + Intergenic
901003101 1:6158709-6158731 CGAGGTCAAGAGATGGAGGCCGG + Intronic
901037915 1:6347312-6347334 CCAGATCCGGAGAAGGAGCAAGG + Intronic
901470596 1:9453861-9453883 CACAGCCCAGAGATGGAGGAGGG + Intergenic
901770228 1:11526443-11526465 CAAGGCTCAGAGAGGGAGGAAGG + Intronic
902151018 1:14443403-14443425 ACACATCCAGAGATGGAGGATGG + Intergenic
902617969 1:17634354-17634376 TGAGACCCAGAGATGAAGGAAGG + Intronic
902686712 1:18082025-18082047 CAACCTCCAGAGATGGATGTGGG - Intergenic
902755903 1:18548941-18548963 CAAGATCAAGAGGTGGAGCTGGG + Intergenic
903616745 1:24665074-24665096 TAGGATTTAGAGATGGAGGAAGG + Intronic
904293609 1:29503615-29503637 CAAGTTCAGGAGAGGGAGGAGGG - Intergenic
904352659 1:29918976-29918998 GAAGAAACAGAGATGGAGAAAGG - Intergenic
904816930 1:33210783-33210805 CAAAATAAAGGGATGGAGGAAGG - Intergenic
905149269 1:35914347-35914369 CAAGAGCCAGAGCTGAGGGAAGG - Intronic
905759408 1:40541662-40541684 CAAGAGCCATGGATGGTGGAGGG + Exonic
907635827 1:56134012-56134034 CAAGATCCAGCCATCTAGGAAGG + Intergenic
907838404 1:58133079-58133101 CAAGAATCAGAAATGGAAGAAGG - Intronic
908267466 1:62393551-62393573 CAGGATCCAGAGCAGAAGGAAGG - Intergenic
908358356 1:63344083-63344105 CTGGATGCAGAGAGGGAGGAAGG - Intergenic
909198442 1:72657422-72657444 CAAGTCCCTGAGATAGAGGAAGG - Intergenic
910709983 1:90169112-90169134 CAAAATAAAGGGATGGAGGAAGG + Intergenic
910832209 1:91472469-91472491 CGAGAGCCTGAGATAGAGGAGGG - Intergenic
911753502 1:101525943-101525965 CAAAATGCAGAGATGGAAAAGGG - Intergenic
911791598 1:102023023-102023045 AAAGATACAGAGAGGTAGGAAGG - Intergenic
912364033 1:109118216-109118238 CAGTAGGCAGAGATGGAGGAAGG + Intronic
913316977 1:117561769-117561791 CAGAAGCCAAAGATGGAGGATGG + Intergenic
913467186 1:119155130-119155152 CAAAATAAAGGGATGGAGGAAGG - Intergenic
913942964 1:125125205-125125227 CAAAATAAAGGGATGGAGGAAGG + Intergenic
914986129 1:152458645-152458667 GAAGTTTCAGAGATGGAAGACGG + Intergenic
915255986 1:154629189-154629211 GAAGATCCAGAGATTGGGGGTGG + Intergenic
915388017 1:155514190-155514212 AAAGATCCAGAGCTGGTGGGTGG + Intronic
915400246 1:155616735-155616757 CTAGATTTAGAGATGGGGGAAGG + Intergenic
916719964 1:167477391-167477413 ACAGACCCAGAGATGGAAGATGG + Intronic
918206530 1:182314623-182314645 CAAGAGCCAGACATGGTGGTTGG - Intergenic
919569122 1:199223710-199223732 CAAGATCCAGAGTCTGGGGAGGG + Intergenic
920021564 1:202960405-202960427 AAAGATTCAGAAAGGGAGGAAGG - Intergenic
920092420 1:203464111-203464133 AAAGAGCCAGAGAGGGAGGAAGG + Intergenic
920497814 1:206467991-206468013 CAAGGACCAGAGGTGGAAGAGGG - Intergenic
921320392 1:213932855-213932877 AAAGATCCAAAGAAGGAGGATGG - Intergenic
922392382 1:225158328-225158350 GAAAATCCAGAGATGGGGCAGGG + Intronic
922939289 1:229447589-229447611 CAATATCCAGGGAGGGAAGAGGG + Intronic
922944840 1:229504596-229504618 TAGGATCCAGAAATGGAGGTAGG + Intronic
923342396 1:233018995-233019017 GAAGAGCCAGAGAGGGAGGGTGG - Intronic
923427031 1:233881269-233881291 CTAAATGCAGAGATGGAGGTGGG - Intergenic
923878721 1:238079325-238079347 CAAAAACCAGAAATGAAGGAAGG - Intergenic
924110292 1:240692153-240692175 ACAGAACAAGAGATGGAGGACGG + Intergenic
924346999 1:243082047-243082069 CAAGAACCACAAATGGAAGAAGG + Intergenic
924423424 1:243930523-243930545 CAAGATTCAAAGGTGGAGGTTGG - Intergenic
1063227943 10:4033856-4033878 CCAGATTTAGAGATGGAGCACGG + Intergenic
1064667058 10:17664855-17664877 ACAGATTCAGAGATGGTGGAAGG + Intronic
1065077130 10:22091554-22091576 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1067789838 10:49279517-49279539 TAAGATCCTGAGATGCAGGCTGG - Intergenic
1067808543 10:49409698-49409720 GAAGAGCCAGGGATGCAGGAGGG - Intergenic
1070750674 10:78962320-78962342 CCAGCTCCAGACAAGGAGGAGGG + Intergenic
1071207318 10:83296321-83296343 CAAGAACAAGAAATGGAGAAAGG + Intergenic
1071212346 10:83358479-83358501 CAAGATGTGGAGATGGAGGGGGG - Intergenic
1071566524 10:86674078-86674100 CAAGATCCACAGCTGGCAGAGGG - Intronic
1072136503 10:92551763-92551785 AAAGTTCTAGAGATGGATGATGG + Intronic
1072439280 10:95439409-95439431 CAAGGGCCAGAGAAGGAGGAAGG - Intronic
1072946613 10:99816260-99816282 CAAAAAACAGAGATGGAGGCCGG - Intronic
1073855995 10:107673966-107673988 CAAGATCCAGAGTAGGAGAATGG + Intergenic
1074484725 10:113864289-113864311 TGAGTTCCGGAGATGGAGGATGG + Intronic
1075566058 10:123505184-123505206 AAAGGGCCAGAGATGTAGGATGG - Intergenic
1077439054 11:2559842-2559864 CCAGAGACAGAGAGGGAGGAAGG - Intronic
1077479921 11:2808973-2808995 ATAGATGCAGAGATGGAGGGAGG + Intronic
1077871619 11:6267433-6267455 CAAGATGTAGAGGTGGAAGATGG - Intronic
1078866434 11:15302357-15302379 CAGGATCCAGAGATGGGGATGGG - Intergenic
1080050881 11:27857772-27857794 CAGGAGCCAGAGATAGAGAATGG - Intergenic
1082938724 11:58680886-58680908 CAAAATACAGGGATGGAGGAAGG + Intronic
1083041821 11:59695512-59695534 CAAGAACCAGAAATGGAAGCTGG + Intergenic
1083387076 11:62319085-62319107 GAAGATCCAGAGAAGGAGGGAGG + Intergenic
1083614003 11:64017672-64017694 CCAGAGCCAGCGAGGGAGGAGGG + Intronic
1083955602 11:65981369-65981391 CAAGAGCCAGAGATGCAGAGAGG - Intergenic
1084581775 11:70028659-70028681 CAAGACCCAGACAGGGAGGAAGG - Intergenic
1084763007 11:71285911-71285933 CAAGTTCTGGAGATGGATGATGG - Intergenic
1084780828 11:71407273-71407295 GAAGAGCCAGAGATGGGAGACGG + Intergenic
1084919514 11:72457924-72457946 AAAGATATAGAGATAGAGGAAGG + Intergenic
1084941005 11:72613364-72613386 CAAGGCCCAGAGAGAGAGGAGGG - Intronic
1084951335 11:72667536-72667558 CAAGTGGCAGAGATGAAGGATGG - Intronic
1085150749 11:74251288-74251310 CAAAAGCCAGAGATGGAAGAGGG + Intronic
1085343367 11:75748596-75748618 CAAGGTCAAGAGATGGAGACCGG + Intergenic
1086478707 11:87209335-87209357 CAAAATAAAGAGATGGAGAAAGG + Intronic
1086490173 11:87351578-87351600 CAAGATCCAAAGAGGAATGATGG - Intergenic
1087291916 11:96329357-96329379 CAAGGTCCAGCCATGGCGGAAGG - Intronic
1088015264 11:105050722-105050744 TAAGCTGAAGAGATGGAGGAAGG + Intronic
1088211500 11:107461770-107461792 CAAAATCAAGAAATGGAGAAAGG - Intergenic
1088376900 11:109151246-109151268 CAAGATACAGAGATGCAGAGTGG - Intergenic
1089642132 11:119854679-119854701 CATGATCCAGAGATGCCGTAGGG + Intergenic
1089723394 11:120450966-120450988 AAAGATGAGGAGATGGAGGAGGG - Intronic
1089743213 11:120599368-120599390 GAGGCTCCAGGGATGGAGGAGGG + Intronic
1089898652 11:121958402-121958424 CAAGGTCTAGAGATGTAGGGGGG + Intergenic
1090268704 11:125370924-125370946 CTAGAACCACAGATGAAGGAAGG + Intronic
1090920756 11:131204093-131204115 CAAGCTCCAGAGAAAGAGGAGGG + Intergenic
1091907818 12:4203068-4203090 CAGGATCTAGAGAAGGAGGTGGG - Intergenic
1092510976 12:9156359-9156381 CAAGATCCAGAGATGGAGGAAGG - Intronic
1092617447 12:10228386-10228408 CTAGATCCTGAGGTGCAGGAAGG + Intergenic
1094342024 12:29423426-29423448 CAAGATCAAGATTTGTAGGATGG + Intronic
1095089849 12:38093598-38093620 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1095951193 12:47782956-47782978 GAAGATACAGACATGGAGGAGGG - Exonic
1096425152 12:51495257-51495279 AAAGTTCCAGAGCTGGAGGGTGG - Intronic
1097313633 12:58149199-58149221 CAAGAAAGAGAGAGGGAGGAAGG - Intergenic
1097786471 12:63765502-63765524 CAAAAGCCAGAGAGGGAGGGGGG - Intergenic
1098073199 12:66698608-66698630 CAAGAAACAGGGAAGGAGGAAGG - Intronic
1098232938 12:68391257-68391279 CAATATTCAGAGATGCGGGAAGG + Intergenic
1098299304 12:69037787-69037809 CAAGCTCCTGTGATGGATGAGGG - Intergenic
1098603846 12:72365976-72365998 GAAGATGCAAAGATGGAGAAAGG - Intronic
1098750748 12:74291547-74291569 CAAGATACAGTTTTGGAGGATGG - Intergenic
1099809144 12:87558452-87558474 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1100573164 12:95861912-95861934 CAAGTTCCAGAAATGGACAACGG - Intronic
1100792254 12:98143404-98143426 CAGGAACTAGAGAGGGAGGAGGG + Intergenic
1100881316 12:99020181-99020203 AAAGTGCCAGAGATGGATGATGG - Intronic
1102520008 12:113472224-113472246 CAAGTTCCAGGGATGGCGAAGGG - Intronic
1102720772 12:115014106-115014128 AAAGATCCATAGAGAGAGGAAGG - Intergenic
1102947790 12:117005179-117005201 CAAGATCCAGGAGTGGAGGAAGG + Intronic
1103905957 12:124327301-124327323 CAAGCTCCAAAGCTCGAGGAGGG + Intronic
1104052808 12:125207667-125207689 AAAGTTCCAGAGATGGATGGCGG - Intronic
1104509418 12:129363044-129363066 CAATAAACAAAGATGGAGGAAGG - Intronic
1104993500 12:132640208-132640230 CAGGACCCAGGGATGGAGGATGG + Intronic
1106635777 13:31527081-31527103 CAAGATCCAGGAGTGGAGAAGGG + Intergenic
1107805373 13:44148850-44148872 CAGTACCCAGAGCTGGAGGATGG + Intronic
1109873123 13:68363656-68363678 AAAAATCCAGAGGAGGAGGAAGG + Intergenic
1110891778 13:80705398-80705420 CAAGAGCCAGGGGTGGAAGAGGG - Intergenic
1111992716 13:95132973-95132995 TAAGTTCAGGAGATGGAGGATGG + Intronic
1112183130 13:97104598-97104620 CTAGAGCCAGAGATGAGGGAGGG + Intergenic
1112243895 13:97710560-97710582 CAACATGCAGTGATGGAGCAGGG - Intergenic
1112634960 13:101206202-101206224 AAAGATACAGGGAGGGAGGAAGG - Intronic
1114668485 14:24396264-24396286 CAAGTTCCAGAGATGGGGCAGGG - Intergenic
1114910922 14:27194844-27194866 CAAGATCCTGAGATGCCAGAAGG + Intergenic
1115114590 14:29864745-29864767 CAAGAGCATGAGATTGAGGAGGG + Intronic
1115512055 14:34147394-34147416 CAAGCTCCGGATAAGGAGGAGGG + Intronic
1115995434 14:39190842-39190864 CAAGATCCACAGATGTAAGAAGG - Intergenic
1116933750 14:50716287-50716309 CAAGAACCAGAGGTGGATGTGGG - Intergenic
1117019764 14:51557806-51557828 GAAGGTCGAGAGAGGGAGGAGGG + Intronic
1117087848 14:52219822-52219844 CATGCTCCAGAAATGGAAGAAGG - Intergenic
1117717066 14:58592334-58592356 CAAAAACAAGAAATGGAGGAAGG + Intergenic
1118245287 14:64104350-64104372 CAAGAAAAGGAGATGGAGGAGGG - Intronic
1118689937 14:68328633-68328655 CAACCTCTAGAGTTGGAGGATGG - Intronic
1118903241 14:70003775-70003797 AAAGCTTCAGGGATGGAGGATGG + Intronic
1119032009 14:71200142-71200164 CAAGATGCACAGATGCAGTAAGG + Intergenic
1119712025 14:76829250-76829272 CAGGCAGCAGAGATGGAGGAAGG + Intronic
1119810952 14:77518978-77519000 CAAGATACAGATGTGGAGTAAGG - Intronic
1119933193 14:78567426-78567448 GAAGATCCAGAGATGGAGCAGGG - Intronic
1120554813 14:85916509-85916531 GAAGTTCCAGAGCTGGAGGGGGG + Intergenic
1120894138 14:89514736-89514758 CAAGATGCACAGATGGAGTGAGG - Intronic
1121878266 14:97474915-97474937 AAAGTTCCAGAGATGGATGGTGG - Intergenic
1122005557 14:98700590-98700612 TGAAATGCAGAGATGGAGGAAGG + Intergenic
1122083206 14:99281233-99281255 CTGGATCGAGACATGGAGGAAGG + Intergenic
1122731864 14:103806188-103806210 CAAGACCCAGAGATAGACTAAGG - Intronic
1123000353 14:105290711-105290733 CAAGACAGAGTGATGGAGGAGGG - Intronic
1123832414 15:24154406-24154428 TAAGATCCTGTGATGGAGCAGGG + Intergenic
1123837946 15:24214870-24214892 TAAGATCCTGTGATGGAGCAGGG - Intergenic
1123866527 15:24524547-24524569 TAAGATCCTGTGATGGAGCAGGG - Intergenic
1123889129 15:24757752-24757774 GAACATGCAGAGATGGTGGAGGG + Intergenic
1125100178 15:35903222-35903244 CCAGAGCCAGAGATGTAAGAGGG + Intergenic
1125128493 15:36253102-36253124 CAGGCTCCAGATATGGAGGAAGG + Intergenic
1128028465 15:64459953-64459975 CAAGATTTAGTGATAGAGGATGG + Intergenic
1128340388 15:66818500-66818522 CAATGTCCAGTGATGGAGGAAGG - Intergenic
1129009833 15:72405520-72405542 CTAGAGCCAAAGATGGAAGAAGG + Intronic
1129664828 15:77573715-77573737 CAGGAGCCAGAAGTGGAGGATGG + Intergenic
1130106569 15:80932930-80932952 CCAACTGCAGAGATGGAGGAGGG - Intronic
1130133205 15:81160729-81160751 GACGATGCAGGGATGGAGGAAGG - Intronic
1131023202 15:89117319-89117341 CAAAATACAGATCTGGAGGAAGG - Intronic
1131292501 15:91118841-91118863 GAGGAACCAGAAATGGAGGAAGG - Intronic
1132412711 15:101596487-101596509 CATGATCAAGAGTTGCAGGATGG + Intergenic
1132698731 16:1213264-1213286 CCAGACCCAGAGATGGAGTGGGG + Intronic
1133548549 16:6831707-6831729 CAAACCCAAGAGATGGAGGAAGG - Intronic
1134111863 16:11520145-11520167 AAAGTTCTAGAGATGGAGGGTGG + Intronic
1134165376 16:11925483-11925505 CGAGACCCAGAGAGGGAGGCAGG + Intergenic
1134489927 16:14688959-14688981 CGAGACCCAGAGAGGGAGGCAGG - Intronic
1134495308 16:14728076-14728098 CGAGACCCAGAGAGGGAGGCAGG - Intronic
1134500696 16:14767199-14767221 CAAGACCCAGAGAGGGAGGCAGG - Intronic
1134527234 16:14953806-14953828 CGAGACCCAGAGAGGGAGGCAGG - Intergenic
1134545166 16:15102533-15102555 CGAGACCCAGAGAGGGAGGCAGG + Intronic
1134579886 16:15361850-15361872 CGAGACCCAGAGAGGGAGGCAGG + Intergenic
1134714822 16:16352348-16352370 CAAGACCCAGAGAGGGAGGCAGG - Intergenic
1134722699 16:16395710-16395732 CAAGACCCAGAGAGGGAGGCAGG - Intergenic
1134944729 16:18316161-18316183 CGAGACCCAGAGAGGGAGGCAGG + Intergenic
1134951993 16:18356311-18356333 CAAGACCCAGAGAGGGAGGCAGG + Intergenic
1135310335 16:21400379-21400401 CGAGACCCAGAGAGGGAGGCAGG + Intergenic
1135324866 16:21519958-21519980 CTCGATCCAGAGCTTGAGGAAGG + Intergenic
1135420206 16:22300717-22300739 ACAGTCCCAGAGATGGAGGATGG - Intronic
1136336353 16:29613233-29613255 CTCGATCCAGAGCTTGAGGAAGG + Intergenic
1136770939 16:32840540-32840562 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1137083546 16:36095781-36095803 CAAAATAAAGAGATGGAGGGAGG - Intergenic
1137232055 16:46575546-46575568 CAAGTTCTAGAGATGCAGAATGG + Intergenic
1137413927 16:48254620-48254642 TAAAATTCAGAGATGGAGGCCGG - Intronic
1137495036 16:48963021-48963043 CAAGACCCAGGGAGGAAGGAAGG + Intergenic
1137701953 16:50503748-50503770 CCAGATGGAGGGATGGAGGAAGG - Intergenic
1138097233 16:54221338-54221360 CGACATCCAGAGTAGGAGGAAGG - Intergenic
1138843415 16:60537129-60537151 CAAAATGAAGAGATGGAGGAAGG - Intergenic
1139329534 16:66176642-66176664 CATGATGAAGTGATGGAGGAAGG + Intergenic
1139532390 16:67548782-67548804 CAGGTTCCTGAGATGGTGGAGGG + Intergenic
1139582119 16:67879978-67880000 CAAGGGTCAGAGATGGAGGATGG + Intronic
1140489214 16:75320071-75320093 CTTGCTCTAGAGATGGAGGATGG - Intronic
1140768539 16:78182404-78182426 CAAGATGCAGAGAGACAGGAAGG - Intronic
1142037071 16:87869015-87869037 CTCGATCCAGAGCTTGAGGAAGG + Exonic
1203073362 16_KI270728v1_random:1102653-1102675 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1143325101 17:6093480-6093502 CACAATCCAGAGATGGGGGAGGG - Intronic
1143385553 17:6527992-6528014 CAAAAGCCAAAGATGGAGCAGGG - Intronic
1143632402 17:8146702-8146724 CCAGACCCAGAGCTGGAGGCGGG - Exonic
1143975208 17:10824414-10824436 CTAGATGCAGAGATAGAGGCAGG + Exonic
1144025900 17:11275384-11275406 TGAGAGCCAGAGAAGGAGGATGG + Intronic
1144113321 17:12060901-12060923 AAAGTTCTAGAGATGGATGATGG - Intronic
1144459730 17:15448716-15448738 CAAGCTTCAGAGGAGGAGGAAGG - Intronic
1144992869 17:19245963-19245985 CAAGGTCAAGAGATGAAGAAGGG - Intronic
1146567862 17:33928767-33928789 GCAGATCCACAGATGGAGGAGGG + Intronic
1146702968 17:34978240-34978262 CAAGATGTAGAGGTGGAGGATGG - Intronic
1146721571 17:35127711-35127733 AAACATCTAGAGGTGGAGGAGGG + Intronic
1147279583 17:39347951-39347973 CAAAATCAAGAAATGGAGAAAGG - Intronic
1147546081 17:41402790-41402812 CAAGAACCAGGGAGGAAGGAAGG + Intergenic
1148238815 17:45986557-45986579 CAAGATCCAAGGATGGGGGTGGG - Intronic
1148680006 17:49468207-49468229 GAAGCTTCAGAGATGGTGGAAGG + Intronic
1148682844 17:49484525-49484547 AAAGAACCAGAGAAGGAGAAAGG - Intergenic
1149574130 17:57699413-57699435 CAAGATTCTGAAAGGGAGGATGG - Intergenic
1149853028 17:60052759-60052781 CCAGTTCCAAAGATGGATGAAGG - Intronic
1150753686 17:67890465-67890487 TAAAATCCAGAGATGGAGAAGGG - Intronic
1151043626 17:70893963-70893985 CACGAACCAGGGATGGGGGATGG + Intergenic
1151550042 17:74817356-74817378 CAACGTCCATAGATGGATGATGG - Intronic
1152393379 17:80016527-80016549 AAAGATCCAGAGCTGGTTGAGGG + Intronic
1152715062 17:81895513-81895535 CAAGGTCAAGAGATGGAGGCCGG + Intronic
1152715081 17:81895592-81895614 CAAGGTCAAGAGATGGAGGCCGG + Intronic
1153441484 18:5124273-5124295 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1154055014 18:11004328-11004350 CCAGAATCAGAGATGGAGTAGGG - Intronic
1154199480 18:12289348-12289370 AAAGATCCAGAGATGGGGAAGGG + Intergenic
1155268915 18:24120632-24120654 GAAGTTCCAGAGATGGATGCTGG - Intronic
1158044186 18:53135285-53135307 TAAGCTCAAGAGATGGAGGTGGG + Intronic
1158212574 18:55067693-55067715 TAGCATTCAGAGATGGAGGATGG - Intergenic
1158626259 18:59074130-59074152 CAAGGGCCAGGGATGGAGGTAGG - Intergenic
1158725502 18:59968224-59968246 CAAGAGACAGAGATGGAGGCAGG + Intergenic
1159090265 18:63840374-63840396 CCAGATCCAGAAATGTAGCAGGG + Intergenic
1159398480 18:67897290-67897312 CATGACCCAGAGACGAAGGAAGG + Intergenic
1159978513 18:74746646-74746668 CAAGATACAGAGATGGAAGATGG - Intronic
1160023089 18:75195950-75195972 CAAGAGCCAGAGATGGGTGCAGG + Exonic
1160029345 18:75244957-75244979 CAAGAGAGAGAGATGGGGGAAGG - Intronic
1160754604 19:750986-751008 CAAAGTCCAGAGGAGGAGGAGGG - Intergenic
1160983274 19:1826462-1826484 GAAGAGACAGAGATGGGGGAAGG + Intronic
1161329217 19:3678432-3678454 GAGGATGGAGAGATGGAGGATGG + Intronic
1161845016 19:6707378-6707400 CAGGAGCCAGAGAGGGAGGAGGG - Intronic
1162149301 19:8633582-8633604 CAAGAGCCAGAGGTGGGGGAAGG - Intergenic
1162530025 19:11230618-11230640 GAGGATGCAGAGGTGGAGGAGGG + Intronic
1162548462 19:11345300-11345322 CAAGATGCAGAGGTTGATGAAGG + Exonic
1162582853 19:11540919-11540941 CCAGATCCATAGTTGGGGGATGG - Intronic
1162764331 19:12909145-12909167 GAAGATACAAAGATGAAGGATGG - Intronic
1163167445 19:15508026-15508048 CAGGATCCAGAGAGAGGGGAAGG + Intergenic
1163374439 19:16921737-16921759 CCAGCTCCAGAGATGGAGGTTGG - Intronic
1164562741 19:29304049-29304071 GGAAATCCAGAGGTGGAGGAAGG + Intergenic
1164718170 19:30408850-30408872 GAAGATCGATGGATGGAGGATGG - Intronic
1164995250 19:32716533-32716555 CTAGCACCAGAGTTGGAGGAGGG + Intergenic
1165220508 19:34312379-34312401 AAAGTTCTAGAGATGGATGATGG - Intronic
1165434449 19:35788459-35788481 CAAGATCCAGTGAGGGTGAAGGG - Exonic
1165930045 19:39351671-39351693 CAAAGTCAAGAGATGGGGGAGGG - Intronic
1165957714 19:39512123-39512145 AAAGAGCCTGAGATGGAGAATGG - Intergenic
1166681194 19:44768177-44768199 CAGACTCCAAAGATGGAGGAAGG + Intergenic
1167161222 19:47768525-47768547 CAAGACACAGATATTGAGGAGGG + Intergenic
1167163128 19:47780442-47780464 CAAGAGACAGAGAAGGGGGAGGG - Intronic
1167690339 19:50981019-50981041 AGAGATCCAGAGAGAGAGGAGGG + Intronic
1202670541 1_KI270709v1_random:46058-46080 CAAAATAAAGGGATGGAGGAAGG + Intergenic
925118119 2:1397654-1397676 CAAGGACCAGAGATGCAGCAGGG - Intronic
925389151 2:3483698-3483720 GAGCACCCAGAGATGGAGGAAGG + Intronic
925811733 2:7708016-7708038 GAAGATCTAGAGATGGGGGCGGG + Intergenic
925925288 2:8665695-8665717 AAAGTTCCAGAGGTGGATGATGG + Intergenic
926037302 2:9645787-9645809 CATGATGCAGGGAGGGAGGAGGG - Intergenic
926104152 2:10139835-10139857 GAGGATCCAGGGGTGGAGGAAGG - Intergenic
927214771 2:20662063-20662085 CCAGACCCAGAGAGGGTGGATGG + Intergenic
927305100 2:21562240-21562262 GAGAAGCCAGAGATGGAGGAAGG + Intergenic
928404294 2:31002802-31002824 CAAGTTCCAGTGAGGAAGGAGGG + Intronic
928807563 2:35178879-35178901 CTGGATTCTGAGATGGAGGAAGG - Intergenic
929111649 2:38409989-38410011 AAAGAGCCAGAGAGGGAGAAGGG + Intergenic
930551625 2:52841796-52841818 AGAGAGGCAGAGATGGAGGAAGG + Intergenic
931122800 2:59239037-59239059 GAAGAATCAGAGGTGGAGGAGGG + Intergenic
931438350 2:62268503-62268525 AAAGTTCTAGAGATGGATGATGG - Intergenic
932016032 2:68027108-68027130 CAGGATCTAGAGATGGGGCAAGG - Intergenic
933033264 2:77359480-77359502 AATGATCAGGAGATGGAGGAGGG - Intronic
933589699 2:84218591-84218613 CATGATACAGATAGGGAGGAAGG + Intergenic
934914547 2:98290362-98290384 CAAGTTCCAGTGTTGGAGGTGGG - Intronic
934998875 2:98991338-98991360 CAAAATAAAGGGATGGAGGAAGG + Intergenic
934999870 2:99002769-99002791 CAAAATAAAGGGATGGAGGAAGG + Intronic
936775124 2:115963873-115963895 CAAAATAAAGGGATGGAGGAAGG - Intergenic
937224065 2:120358052-120358074 AAAGGTGCAGAGGTGGAGGATGG - Intergenic
938928635 2:136066747-136066769 CAAGATTCACAGATGGAGGATGG + Intergenic
941035643 2:160566093-160566115 AGAACTCCAGAGATGGAGGATGG + Intergenic
941595646 2:167473675-167473697 CACAATCAAGAGATGGAAGAAGG + Intergenic
942123092 2:172797976-172797998 CAAGATACAAAGATGGAGAAAGG - Intronic
942411962 2:175718849-175718871 CAAAATAAAGGGATGGAGGAAGG + Intergenic
943810343 2:192179663-192179685 CAGGATCTGGAGATGGAGGTAGG - Exonic
944691097 2:202159191-202159213 CATCATCCAAAGATGGAGCAGGG + Intronic
946820131 2:223620585-223620607 CAAGAGGCAGAGATGGGGAAGGG - Intergenic
946919637 2:224565388-224565410 CAGGCACAAGAGATGGAGGAGGG + Intronic
948282958 2:236762577-236762599 CAGGATCCAGAGAGAGAGGCCGG + Intergenic
948320042 2:237061699-237061721 CAAGATGGGGAGATGGAGGAAGG + Intergenic
1168826785 20:819398-819420 AAAGAGACAGAGAGGGAGGAAGG - Intergenic
1169101352 20:2952649-2952671 AAAGTTCCAGAGATGGATGGCGG - Intronic
1170363679 20:15576397-15576419 GGAGATGCAGAGATAGAGGAAGG - Intronic
1170647291 20:18208907-18208929 AAAGAGACAGGGATGGAGGAAGG + Intergenic
1170758394 20:19225604-19225626 CAGGGTTCAGAGATGGAAGAAGG - Intronic
1171904160 20:30886743-30886765 CAAAATAAAGTGATGGAGGAAGG - Intergenic
1171947022 20:31387791-31387813 CATGACCCAGAAAGGGAGGAGGG + Intronic
1172055640 20:32152521-32152543 GAAGATGCAGAGATGGGGGTGGG - Intronic
1172651591 20:36506750-36506772 CAAGTTCTAGAGATGGACGGTGG - Intronic
1172800871 20:37575173-37575195 TAAGATGGAGAGAGGGAGGAGGG + Intergenic
1173228410 20:41175500-41175522 AAAGATCCAGGGATGGAGATGGG + Exonic
1173374805 20:42473756-42473778 CAAGAGCCAGGCATGGTGGATGG - Intronic
1173749563 20:45466793-45466815 CTAGTTGCAGAGAGGGAGGATGG + Intergenic
1174301553 20:49585906-49585928 CAGAATCCAGAGAAAGAGGAAGG + Intergenic
1177567496 21:22843894-22843916 CAGGTTCCAGAGATGAAGGAGGG + Intergenic
1179191781 21:39128699-39128721 AAAGTTCCAGAGATGGATAATGG - Intergenic
1179316658 21:40249827-40249849 CAAGCTCCAAAGAAGGATGAAGG + Intronic
1179459401 21:41523568-41523590 CAACATCCATACATTGAGGAAGG - Intronic
1180024921 21:45155653-45155675 CTAGATGGAGAGATGGATGATGG - Intronic
1181681792 22:24500437-24500459 GAAGAGCCAGAGATGCAGGCTGG - Intronic
1182528760 22:30939079-30939101 GAGGATCCAGACATGGAGGTGGG + Intronic
1183323015 22:37176549-37176571 CAGGAGCCAGAGAGGAAGGAGGG - Intergenic
1183445939 22:37854989-37855011 AAAGAGCCAGAGAAGCAGGAGGG + Intronic
1183789850 22:40057739-40057761 CAAGATTCTGATGTGGAGGAAGG + Intronic
1184016462 22:41789572-41789594 AAAGATCTAGAGATGGATGATGG - Intronic
1184471630 22:44699274-44699296 CCAGCTCCAGAGAGGGAGGGAGG - Intronic
949846341 3:8374168-8374190 CAAAATACAGGGATGGAGGAAGG + Intergenic
949883980 3:8680313-8680335 TAAGAGCCAGAGAGGGAAGAGGG - Intronic
949884177 3:8681282-8681304 AAAGATCCAGGGAGGGAAGAGGG - Intronic
950086267 3:10260226-10260248 CAAGGTCCAGAAAAGGAAGAGGG + Exonic
950666406 3:14497933-14497955 GGAAATCCAGAGATGGAGGTGGG + Intronic
950689981 3:14647839-14647861 TCAGATCCAGCGAGGGAGGAAGG + Intergenic
951034660 3:17919998-17920020 CAAGAGGCTGAGGTGGAGGATGG + Intronic
951086502 3:18518228-18518250 CAAAATAAAGGGATGGAGGAAGG + Intergenic
951268666 3:20599839-20599861 CAAAATAAAGAGATGGAGAAAGG - Intergenic
951802776 3:26614832-26614854 CAAGTTCTACAGAAGGAGGAAGG + Intergenic
952692522 3:36226585-36226607 CAAAAACCAGAAATGGAGAAAGG + Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953470831 3:43164407-43164429 CCAGACTGAGAGATGGAGGAGGG - Intergenic
953578691 3:44134209-44134231 GGAAATCAAGAGATGGAGGAAGG - Intergenic
953654743 3:44841128-44841150 CAAGAACAAGAGATAGAAGATGG + Exonic
954138192 3:48591944-48591966 CAAGTTCCAGGAAAGGAGGATGG + Exonic
954621545 3:51998989-51999011 GCAGATTCAGAGATGGACGATGG + Intergenic
955485183 3:59427976-59427998 CTAGAGCCAGAGGTGGAGGTGGG + Intergenic
955505234 3:59626171-59626193 GAAGTTCTAGAGATGGACGATGG - Intergenic
955765339 3:62338553-62338575 AAATATCCAGAGATGGATGGTGG + Intergenic
956042683 3:65162000-65162022 CAACTTCCAGAGATGAAGCAAGG + Intergenic
956741538 3:72279833-72279855 CATGAGCCATAGATGGAGGGAGG + Intergenic
957134731 3:76271700-76271722 AAAGAGCCAGAGAAGCAGGAGGG - Intronic
957243054 3:77683912-77683934 AACGATCAACAGATGGAGGAAGG + Intergenic
958253155 3:91293403-91293425 CAAAATAAAGGGATGGAGGAAGG + Intergenic
959477411 3:106827873-106827895 AAAGGTCAAGAGATGGGGGAAGG - Intergenic
959511950 3:107223676-107223698 AATGTTCCAGAGATGGATGATGG + Intergenic
959827050 3:110810415-110810437 AAAGAATCAGAGATGGAGTAGGG + Intergenic
960319921 3:116222033-116222055 CAATATCAAGTGATGGAGAATGG - Intronic
960566020 3:119132335-119132357 CAAAATAAAGGGATGGAGGAAGG + Intronic
960996112 3:123341536-123341558 AAAGTTCCAGAGATGGACGGTGG + Intronic
961081472 3:124032744-124032766 GAAGATCCAGAGAAGGCGGGCGG + Intergenic
961442788 3:126962699-126962721 CATGAGCCAGACATGGAGGTGGG - Intergenic
961791864 3:129382086-129382108 CTAGAACCTCAGATGGAGGAAGG + Intergenic
961805887 3:129489045-129489067 CTAGAACCTCAGATGGAGGAAGG + Intronic
961918344 3:130400142-130400164 AAAGAACCAGAGATGGAAGATGG - Intronic
963514486 3:146291752-146291774 CAAAATAAAGAGATGGAGGAAGG - Intergenic
964041418 3:152266897-152266919 CAAGGGCCAGAGATGGAGTCTGG - Intronic
964307893 3:155360653-155360675 CTAGATCCAGATAAGGGGGAGGG - Intergenic
965751060 3:171975461-171975483 GAGCAGCCAGAGATGGAGGAGGG + Intergenic
967594583 3:191314702-191314724 CAACCTCCAGAGATGGGGAAGGG + Intronic
968263045 3:197340347-197340369 GAAGCTCCAGGGAAGGAGGAGGG - Intergenic
972842565 4:42948791-42948813 TCAGAATCAGAGATGGAGGAAGG + Intronic
973083255 4:46022172-46022194 CATTTTCCAGAGATGGAAGAAGG - Intergenic
973251033 4:48060031-48060053 CAAAATAAAGGGATGGAGGAAGG + Intergenic
973712962 4:53647702-53647724 CAAGATCTAGAGATGGATGGTGG - Intronic
974086402 4:57265360-57265382 CAGGAGCCAGAGAGGGAGGGAGG + Intergenic
974151188 4:58011275-58011297 CAAAATAAAGGGATGGAGGAAGG + Intergenic
974547890 4:63335860-63335882 CAAAATACAGGGATGGAAGAAGG + Intergenic
974612878 4:64239517-64239539 CAAAATAAAGGGATGGAGGAAGG - Intergenic
974979669 4:68939430-68939452 CAAAATCAAGAAATGGAGAAAGG + Intronic
975503418 4:75112133-75112155 CAAAATAAAGGGATGGAGGAAGG + Intergenic
977113709 4:92994152-92994174 ATAGATGCAGAAATGGAGGAAGG + Intronic
981600196 4:146479677-146479699 AAAGTTACAGAGATGGATGATGG + Intronic
981620513 4:146692740-146692762 CAACATCCTGAGATAGGGGAGGG - Intergenic
982806375 4:159769974-159769996 CAAGATCCATAGAAGGAAAATGG + Intergenic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
983709147 4:170693123-170693145 CAGGCTCCAGAGATGGAAGAGGG - Intergenic
984050845 4:174863604-174863626 CAAGATCAAGAGGTTCAGGAAGG - Intronic
984712231 4:182895506-182895528 CAGGTTCGAGAGAGGGAGGAAGG - Intronic
984833644 4:183999444-183999466 CCACATCCAGAAAAGGAGGAAGG - Intronic
987080717 5:14423078-14423100 CAAGATGCTGAGACGGAGGAAGG - Intronic
987828880 5:23070129-23070151 CAAGTTCAAGAGATAGAGAATGG - Intergenic
988057405 5:26116504-26116526 CAGGATCCAGAGGTTGAGGGAGG + Intergenic
990516416 5:56534878-56534900 CATTCTCCAGAGATGGAGGGTGG - Intronic
991042319 5:62188655-62188677 CCAGAAGCAGAGATGGAGGCTGG - Intergenic
991292311 5:65044834-65044856 CAAGATTCAGTGATGGTGGTGGG - Intergenic
991661540 5:68955707-68955729 TGAGAGCCAGAGATGGTGGAAGG + Intergenic
991966697 5:72098798-72098820 CAACAGGCAGAGATGGAGAAAGG - Intergenic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
992938841 5:81741388-81741410 AAAGTTCTAGAGATGGAGAACGG + Intronic
994052762 5:95381200-95381222 CAACATTCAGAGGTAGAGGAGGG + Intergenic
994188504 5:96841479-96841501 CAAGCTGCTGAGATGGAGCAGGG + Intronic
994636783 5:102353582-102353604 CAAAATAAAGGGATGGAGGAAGG + Intergenic
995061645 5:107817184-107817206 GGAGCTCCAGAGATGGAGGTGGG + Intergenic
996186967 5:120489510-120489532 CAAAATAAAGGGATGGAGGAAGG - Intronic
996232614 5:121085009-121085031 CAAAATAAAGGGATGGAGGATGG - Intergenic
996236397 5:121135910-121135932 CTAGATTCTGAGATGGAGCAGGG - Intergenic
996848931 5:127931492-127931514 CAATATGCACAGCTGGAGGAGGG - Intergenic
996891546 5:128427130-128427152 TAAGCTCCTGAGATGGAGGTGGG + Intronic
997230492 5:132238903-132238925 GAAGAGCCAGAGAAGCAGGATGG + Intronic
998578286 5:143341899-143341921 GAAAATACAGAGAGGGAGGAGGG + Intronic
998675215 5:144400319-144400341 CCAGAGCCTGAGAGGGAGGAAGG + Intronic
1000075349 5:157779391-157779413 GAAGTTCTAGAGATGGAGGGTGG + Intergenic
1000308157 5:160015156-160015178 CAAAATCCAGGAAAGGAGGAGGG + Intronic
1001837069 5:174841552-174841574 AGAGATCCAGAGCTGGAAGAAGG + Intergenic
1003756646 6:9128462-9128484 CAGGATCAAGAGAGAGAGGAGGG - Intergenic
1003955175 6:11156556-11156578 GGAAATCCAGAGATGTAGGAAGG + Intergenic
1004239945 6:13911917-13911939 CAAAATGCATAGATGGTGGAGGG + Intergenic
1004508936 6:16268772-16268794 AAAGTTCCAGAGATGGATAATGG + Intronic
1005089210 6:22038682-22038704 AAAGTTCAAGAGATGGAGTATGG - Intergenic
1005703737 6:28430265-28430287 CAAGATCCTGGGATGGCTGATGG + Intergenic
1005965835 6:30725997-30726019 CAGGATCCAGGGATGGAAAATGG + Intergenic
1006742247 6:36317492-36317514 AAAGACCCAGAGATGGAGGCTGG - Intronic
1007131937 6:39483364-39483386 CACAAGCAAGAGATGGAGGAAGG - Intronic
1007199453 6:40094189-40094211 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1007423808 6:41734744-41734766 CAAGAGACCGAGCTGGAGGAAGG + Intronic
1007691961 6:43708221-43708243 AAAGACCCAGGGATGGAGCAGGG + Intergenic
1008628356 6:53339951-53339973 CAAGATGTGGAGATGGAAGACGG + Intronic
1009976704 6:70678761-70678783 CTAGTTTCAAAGATGGAGGAAGG - Intronic
1010545354 6:77148623-77148645 CATGATCCAGTGACGGAGTATGG - Intergenic
1011599784 6:89049270-89049292 CAAGTTCCAGCCATGGAGGTGGG - Intergenic
1012264070 6:97119953-97119975 CGAAATCCAGAGGTGAAGGAGGG + Intronic
1012643312 6:101649950-101649972 GAAGATCTAGAGATGGAAAAAGG - Intronic
1013475808 6:110506311-110506333 CTGGAAACAGAGATGGAGGAAGG - Intergenic
1014145146 6:117988836-117988858 AAAGCTCCAGAGTTGGATGATGG + Intronic
1014707317 6:124763435-124763457 CAGGAGCAAGAGATGGAGGGAGG + Intronic
1015659503 6:135559388-135559410 AAAGTTCTAGAGATGGAAGATGG + Intergenic
1016101802 6:140111365-140111387 CAATACCAAGAGATGGTGGATGG - Intergenic
1016542989 6:145187714-145187736 CAAGAGCAAGATAGGGAGGAAGG + Intergenic
1016926646 6:149356763-149356785 CAAGATCTACAGATGAAGGCTGG - Intronic
1017307171 6:152932204-152932226 CACCATCCAGAAAGGGAGGAGGG - Intergenic
1017887549 6:158611437-158611459 CAAGGTCCAGAAAAGGAAGACGG - Intronic
1018719585 6:166562779-166562801 CAAGATGCTGAGCTGGTGGATGG + Intronic
1020352022 7:7230981-7231003 AAAAATTCAGAGATGTAGGAAGG - Intronic
1021818474 7:24473246-24473268 CTAGATGAGGAGATGGAGGAAGG + Intergenic
1022288834 7:28981154-28981176 CAAGAAACAGAGTTGGGGGATGG - Intergenic
1023082249 7:36536543-36536565 CAAGATCCAAAGATGGGGTTTGG + Intronic
1023658547 7:42450445-42450467 CAAGAGCCAAAGATGAAGGGAGG + Intergenic
1023706184 7:42943960-42943982 CAAGAGCAAGAGAGCGAGGAGGG - Intronic
1023814339 7:43938166-43938188 CAAGGTACAGAGCTGGAAGAGGG - Intronic
1025479361 7:60962735-60962757 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1025552623 7:62269589-62269611 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1028696405 7:93717825-93717847 AAAGATGGAGAGAGGGAGGAAGG + Intronic
1029034920 7:97509354-97509376 CTAGATCCAGCCATGGAGAAGGG - Intergenic
1029830052 7:103246864-103246886 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1029957775 7:104657729-104657751 GAAGCTCCAGAGATGGAAGATGG - Intronic
1030966004 7:115994087-115994109 CAAAAACCAGAAATGGGGGAAGG + Intronic
1031240768 7:119236546-119236568 CTTTTTCCAGAGATGGAGGAAGG - Intergenic
1031894610 7:127334817-127334839 GAAGATGCAGAGAAAGAGGAAGG + Intergenic
1032510257 7:132466607-132466629 CAAGATGCAAGGATGGAGGTGGG + Intronic
1033191305 7:139283191-139283213 CAAGATCCAGTGAAGGTGAATGG - Exonic
1034255820 7:149724145-149724167 CGAGATCAAGAAATAGAGGATGG + Intronic
1034305107 7:150040832-150040854 CAAGAGCCAGAGGGGGAAGAGGG + Intergenic
1034305739 7:150043356-150043378 CAAGAGCCAGAGGGGGAAGAGGG + Intergenic
1034470655 7:151252658-151252680 CCAGCTCCAGAGAGGGAGGAGGG + Intronic
1034503695 7:151468510-151468532 CCAGATCCAGGGATGCAGGCGGG - Intronic
1034583576 7:152068082-152068104 CATGATCCAGTGCTGGAGGTGGG - Intronic
1034801104 7:154057294-154057316 CAAGAGCCAGAGGGGGAAGAGGG - Intronic
1035099737 7:156386571-156386593 CAAGATCCAGAGAGGCAGGGTGG - Intergenic
1035239331 7:157519791-157519813 CAGGATCCTGAGGTGGGGGACGG + Intergenic
1035324473 7:158056031-158056053 CAAGAACCAGACAGAGAGGAAGG - Intronic
1035389196 7:158494477-158494499 CAGGAACCAAAGAGGGAGGAGGG + Intronic
1035496412 7:159331171-159331193 CTAGATGCAGACATGGAGGACGG - Intergenic
1035659047 8:1333198-1333220 CACATTACAGAGATGGAGGAAGG + Intergenic
1035923022 8:3699022-3699044 CTAGATCCAGAGCTTGAGGTGGG - Intronic
1036490627 8:9221913-9221935 TGAGATCCAGAGCTGGAGTAAGG - Intergenic
1036503252 8:9332728-9332750 CAAGAGCCAGTGATGGCAGAAGG - Intergenic
1037611943 8:20483274-20483296 CAAGGTCTAGAGATTGAGGTAGG + Intergenic
1037884443 8:22589048-22589070 CAGGGTCCAGAGAGGGAGGGAGG - Intronic
1038192268 8:25333991-25334013 AAAGATCCAGAGAGGAAAGAAGG + Intronic
1039436874 8:37565471-37565493 CAAGATCCAGAGAGACGGGAAGG - Intergenic
1039637690 8:39183664-39183686 CAACATCCAGAGAGGTAGGAAGG - Intronic
1039856467 8:41419265-41419287 CAAGAGGCTGAGATGGAGGTGGG - Intergenic
1039932387 8:42005615-42005637 CCAGATCCAGAGAGGGAGTGAGG + Intronic
1040835664 8:51728482-51728504 CAAGATACGGAGGTGGAAGATGG + Intronic
1041141788 8:54828011-54828033 CAAGATACAGAGGTGAAAGATGG - Intergenic
1041206174 8:55500021-55500043 CAAGCTCTAGAGAAGGAAGATGG - Intronic
1042547183 8:69961237-69961259 AAAGTTCCAGAGATGGATGGTGG - Intergenic
1043239538 8:77915674-77915696 GATGATCCCGAGATGGATGATGG - Intergenic
1045882975 8:107063133-107063155 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1046047739 8:108984455-108984477 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1047539531 8:125751224-125751246 CAAAATCCAGTAATGGAGTAGGG - Intergenic
1048369880 8:133768028-133768050 CAGGAGGAAGAGATGGAGGAAGG - Intergenic
1048835097 8:138511920-138511942 GAAGCTCCAGAGGTGGAAGACGG + Intergenic
1048859236 8:138711663-138711685 CCAGCCCCAGAGAAGGAGGATGG + Intronic
1049166596 8:141129432-141129454 GAGGGTGCAGAGATGGAGGAAGG - Intronic
1049350690 8:142162961-142162983 AGAGAGACAGAGATGGAGGATGG + Intergenic
1049918738 9:343979-344001 AATGATCCAGAAATGTAGGAGGG + Intronic
1051610835 9:18960030-18960052 CAAGAGCCAGAGCTGAGGGATGG + Intronic
1051931310 9:22389565-22389587 CAAGATGCAAATATGGAGAAAGG + Intergenic
1052052947 9:23868833-23868855 CAAGATCAAGAGGTGGAAGAGGG - Intergenic
1052104217 9:24492409-24492431 CAAAATCCAAAGATGGAGCGAGG + Intergenic
1052451086 9:28632029-28632051 CAACATCCAGTGTTGCAGGAGGG + Intronic
1053737151 9:41108763-41108785 CAAGAGCCAGGGAGGGAAGAGGG - Intergenic
1054691197 9:68322554-68322576 CAAGAGCCAGGGAGGGAAGAGGG + Intergenic
1056207782 9:84336794-84336816 CATGAGCCTGGGATGGAGGAAGG - Intronic
1056303859 9:85270092-85270114 CAAGAAGGAGAGATGTAGGAAGG + Intergenic
1056752657 9:89363435-89363457 GATGATGCAGAGCTGGAGGAAGG - Intronic
1058832685 9:108833031-108833053 CAAGGTCCAGAGAGGATGGAAGG - Intergenic
1059658104 9:116374763-116374785 CAAAATCCAGAGATGTTGGAGGG - Intronic
1059714416 9:116900332-116900354 CAAGATTCAGAGAGTGTGGAAGG + Intronic
1060541463 9:124433350-124433372 AAAGAGAGAGAGATGGAGGAAGG + Intergenic
1060803980 9:126563523-126563545 CAGGATGCAGAAGTGGAGGACGG + Intergenic
1061036808 9:128118768-128118790 AGGGATGCAGAGATGGAGGATGG + Intergenic
1061601136 9:131670975-131670997 CAAGATCCAGGGAAGGGGGATGG - Intronic
1061898924 9:133663035-133663057 CAAGGGCCAGACAAGGAGGAGGG + Intergenic
1061911797 9:133728956-133728978 ATAGATGGAGAGATGGAGGACGG + Intronic
1203585776 Un_KI270747v1:2136-2158 ACAGATGCAGAGAGGGAGGATGG + Intergenic
1185840319 X:3383505-3383527 GAAGAGCCTGAGATGGAGCAAGG + Intergenic
1186122791 X:6381798-6381820 CAGAATCCAGAGATGTAGAAGGG - Intergenic
1188352649 X:29151075-29151097 CAACATCCAGATGTGGTGGAAGG - Intronic
1189620052 X:42826246-42826268 CTAGCTCTAAAGATGGAGGAAGG - Intergenic
1189905354 X:45753719-45753741 CAAAGTCAAGAGATGAAGGAAGG + Intergenic
1190311939 X:49122892-49122914 GGAGATCCAGACATGGAGTAGGG - Intronic
1190333887 X:49251308-49251330 CAAGATCAAGGAAAGGAGGATGG - Exonic
1190940034 X:55031136-55031158 GAAGAGCCAGAGCTGGGGGAGGG - Intergenic
1191770185 X:64747165-64747187 TAACATCCAGAGTTGGAGGTGGG - Intergenic
1191799013 X:65056944-65056966 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1192062035 X:67838017-67838039 CAATATCTAGGGATGGGGGAGGG - Intergenic
1193018036 X:76757841-76757863 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1193542671 X:82790584-82790606 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1194400195 X:93432240-93432262 GAGGATCCAGACAAGGAGGAAGG + Intergenic
1195322020 X:103728153-103728175 CAGGGTCCAGAGAAGAAGGAAGG + Exonic
1195500863 X:105597537-105597559 CAAGAGCCAGAGAGCGAGGAGGG + Intronic
1195681050 X:107546974-107546996 CCTCATGCAGAGATGGAGGAGGG - Intronic
1195702453 X:107715661-107715683 CAAAGACCTGAGATGGAGGAGGG + Intronic
1196112819 X:111965108-111965130 CAAAATAAAGGGATGGAGGAAGG + Intronic
1196675564 X:118417121-118417143 AAAGATACAGAGATGCAGAATGG - Intronic
1197231051 X:124004078-124004100 AAAGTTCCAGAGATGGATGGTGG - Intronic
1197345199 X:125321134-125321156 AAAGATCCAGTGATGCAAGAGGG + Intergenic
1197563511 X:128052371-128052393 TAAGATTCAGAGGTTGAGGATGG - Exonic
1197569207 X:128128378-128128400 CAAGACTCAGGGATTGAGGATGG - Intergenic
1198474283 X:136980980-136981002 CAACATAAAGGGATGGAGGAAGG - Intergenic
1198556625 X:137800018-137800040 CAATGTCTGGAGATGGAGGAGGG - Intergenic
1199149991 X:144420337-144420359 CAAGAACCAGAGAAGCAGGAAGG - Intergenic
1200135797 X:153874001-153874023 GAAGGTCCAGGGAGGGAGGAGGG + Intronic
1201190992 Y:11441452-11441474 GAAGATCCAGAGAAGGAGCAGGG - Intergenic
1201235660 Y:11908415-11908437 GAAGAGCCTGAGATGGAGTAAGG - Intergenic
1201906782 Y:19093557-19093579 CAGGAGCTGGAGATGGAGGAGGG - Intergenic