ID: 1092513610

View in Genome Browser
Species Human (GRCh38)
Location 12:9184632-9184654
Sequence TGTCAGCCAAAGCACTTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 4, 2: 7, 3: 37, 4: 192}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092513610_1092513618 21 Left 1092513610 12:9184632-9184654 CCTGCAAAGTGCTTTGGCTGACA 0: 1
1: 4
2: 7
3: 37
4: 192
Right 1092513618 12:9184676-9184698 CCAGTGGTCTGGGAGCACCTTGG 0: 6
1: 11
2: 31
3: 77
4: 405
1092513610_1092513615 10 Left 1092513610 12:9184632-9184654 CCTGCAAAGTGCTTTGGCTGACA 0: 1
1: 4
2: 7
3: 37
4: 192
Right 1092513615 12:9184665-9184687 AAGTGTTGTGACCAGTGGTCTGG 0: 1
1: 3
2: 31
3: 54
4: 180
1092513610_1092513614 5 Left 1092513610 12:9184632-9184654 CCTGCAAAGTGCTTTGGCTGACA 0: 1
1: 4
2: 7
3: 37
4: 192
Right 1092513614 12:9184660-9184682 CATGGAAGTGTTGTGACCAGTGG 0: 1
1: 2
2: 22
3: 97
4: 392
1092513610_1092513616 11 Left 1092513610 12:9184632-9184654 CCTGCAAAGTGCTTTGGCTGACA 0: 1
1: 4
2: 7
3: 37
4: 192
Right 1092513616 12:9184666-9184688 AGTGTTGTGACCAGTGGTCTGGG 0: 6
1: 21
2: 49
3: 107
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092513610 Original CRISPR TGTCAGCCAAAGCACTTTGC AGG (reversed) Intronic
904483131 1:30806530-30806552 TGTCAGCCACAGAACTGGGCAGG - Intergenic
906051428 1:42877525-42877547 TGCCAGCCAAAGTACTTCACAGG + Intergenic
908348651 1:63262267-63262289 TGCCAGCCAAAGCTTCTTGCAGG - Intergenic
911168030 1:94742503-94742525 TCAAAGGCAAAGCACTTTGCAGG + Intergenic
911805500 1:102201566-102201588 TGTCAGCCAAAGCCCTTACTGGG + Intergenic
916150712 1:161786240-161786262 TGTAATCCCAAGCACTTTGGGGG - Intronic
916789656 1:168114299-168114321 TGTGAGCCACAGCACCTGGCTGG - Intronic
917524528 1:175775220-175775242 TGCCAGCCAAAGTATTTTGTGGG - Intergenic
918931932 1:190865170-190865192 TGTAAGCTAAAGCACTTTTGTGG - Intergenic
918962862 1:191303051-191303073 TGTCAGCAAAAGCACTCTGGTGG + Intergenic
922209521 1:223476888-223476910 TGTCATCCCCAGCACTCTGCTGG + Intergenic
922971763 1:229747667-229747689 TGTCTGCCAAAGCACTTTGTTGG + Intergenic
924515016 1:244758650-244758672 TGTAACCCCAAGCACTCTGCAGG - Intergenic
1063050719 10:2444233-2444255 TGTCATCCACAGCTCTTTGGAGG + Intergenic
1063410885 10:5835692-5835714 GGTCAGCCAAAGCCCTCTCCAGG - Intronic
1063494136 10:6491210-6491232 TGTCAGCCAAATGAATGTGCTGG + Intronic
1066502042 10:36003801-36003823 TCCCAGTCAACGCACTTTGCAGG - Intergenic
1066628774 10:37437620-37437642 TGTGAGCCACAGCACCTGGCAGG + Intergenic
1068262052 10:54595171-54595193 TCCCAGCCAAAGCATTTTGTAGG - Intronic
1068378235 10:56212867-56212889 TGCCAGTAAAAGCACTTTGTTGG + Intergenic
1068833080 10:61520387-61520409 TGCCAGCCAAAGCACTTCATTGG + Intergenic
1071570240 10:86692692-86692714 TGTCAGCTGGAGCCCTTTGCAGG - Intronic
1072026876 10:91468122-91468144 TGTCAGACAAAACACTTGACTGG - Intronic
1072964290 10:99957552-99957574 TGTAAGCCACAGCACCTAGCTGG - Intronic
1074876565 10:117618148-117618170 TGTCATCCAATCCACTATGCAGG - Intergenic
1078569994 11:12449438-12449460 TGTGAGCCACAGCACCTGGCGGG + Intronic
1078889151 11:15538466-15538488 TGTCTGCCAAAGAATTCTGCTGG + Intergenic
1084688976 11:70713967-70713989 AGTGAGCCAAAGCAGTTTGTTGG - Intronic
1084925771 11:72510354-72510376 TGCCAGCTAAAGAACTTTGTTGG + Intergenic
1085523666 11:77152366-77152388 TGCCAGCCACAGCAATCTGCAGG - Intronic
1086107324 11:83159440-83159462 TGTCACTCAAAGAACCTTGCTGG + Intronic
1090105522 11:123851028-123851050 TGCCAGCCAAAGTACTTCACTGG + Intergenic
1092513610 12:9184632-9184654 TGTCAGCCAAAGCACTTTGCAGG - Intronic
1092680468 12:10974352-10974374 TGCCAGCCTAAGCACTTTGTTGG - Intronic
1096346328 12:50850295-50850317 TGTGAGCCAATGCACTTAGCTGG - Intronic
1098347693 12:69523900-69523922 TGCCAGCCAAAGCACTTCATAGG + Intronic
1099303949 12:80932037-80932059 TGTAAGCAAAAGCAATTTTCTGG + Intronic
1104597592 12:130130680-130130702 TGTTAGCCAAAGCAGTCCGCTGG + Intergenic
1105530877 13:21219148-21219170 TGACAGCCACAGCTCTTGGCTGG + Intergenic
1107389198 13:39945552-39945574 TGCTGGCCAAAGCACTTCGCTGG - Intergenic
1107501551 13:40983396-40983418 TGTCAGCCAAATCACTTAATCGG + Intronic
1107762479 13:43695341-43695363 GGTCAGTTAAAGCACTTTGATGG - Intronic
1108884720 13:55165629-55165651 TGCCAGCCAAAGCACTGTGTTGG - Intergenic
1109509005 13:63344132-63344154 TGTGACCCAAAGCACTGTGCAGG - Intergenic
1110364119 13:74662200-74662222 TGTCAGCCAAGCCCCTCTGCTGG + Intergenic
1113228485 13:108185128-108185150 TGTCTGAAAAAGCATTTTGCTGG + Intergenic
1113637036 13:111926727-111926749 TGTCAGCCACAGCTATTTGATGG - Intergenic
1114598491 14:23934584-23934606 GGTCAGCCAAGGCTATTTGCAGG - Intergenic
1115580210 14:34750443-34750465 TGTGAGCCACTGCACTTGGCTGG - Intergenic
1118416026 14:65537902-65537924 TGCCAGCCAAAGCACTTCATAGG + Intronic
1118580981 14:67297081-67297103 TGTGTGACAAAGCACTTTGGGGG + Intronic
1121286739 14:92741882-92741904 TGTCAGCCGAAAAACCTTGCAGG - Intronic
1121388094 14:93548384-93548406 TTTCACCCTAAGAACTTTGCGGG + Intronic
1122197169 14:100097153-100097175 TGGCAGTCACTGCACTTTGCTGG - Intronic
1122293230 14:100690762-100690784 TGTGAGCCACCGCACTTGGCTGG + Intergenic
1122755022 14:103971583-103971605 TGTGAGCCACTGCACTTGGCCGG + Intronic
1123894026 15:24810087-24810109 TGCCAGCCAAAGCGCTTTTAGGG - Intergenic
1126087933 15:45026366-45026388 TGTCAGCAAATGCATTTTGGGGG + Intronic
1126213844 15:46132008-46132030 TGCCAGCCAAAGTGCTTTGGTGG + Intergenic
1127003167 15:54534137-54534159 TGCTGGCCAAAGCACTTTGCTGG - Intronic
1128663105 15:69517274-69517296 TGTGTGTCAAAGCACTTGGCTGG - Intergenic
1129559769 15:76553544-76553566 TGCCAGCCAAAGTGCTTTGTAGG - Intronic
1129857979 15:78838408-78838430 TCACAGGCAAAGCACTGTGCCGG - Intronic
1129931268 15:79412783-79412805 TGCCAGCCAAAGCATTTTGTAGG - Intronic
1131493873 15:92886379-92886401 TGTCAGGCAAAGAAATTTGATGG - Intronic
1133578297 16:7116344-7116366 TGTCATTCAAAGCACTTTTGAGG + Intronic
1134084682 16:11348350-11348372 TTGCAGGCAAAGCACCTTGCAGG + Intronic
1136421803 16:30139061-30139083 TGTCAGCCACTGCACCTGGCCGG + Intergenic
1136463483 16:30426454-30426476 TGTGAGCCACAGCACCTGGCCGG + Intronic
1137256537 16:46779556-46779578 TGTGAGCCAACGCACCTGGCTGG - Intronic
1137287235 16:47026525-47026547 TGTCAGCCACAGCTCCTTGCAGG - Intergenic
1137857593 16:51810946-51810968 TGTGAGCCACAGCACCTGGCTGG - Intergenic
1143700828 17:8658861-8658883 TGTCTTCCCAGGCACTTTGCAGG - Intergenic
1144137716 17:12314421-12314443 TACCAGCCAAAGCACTTTGTTGG + Intergenic
1146933343 17:36793553-36793575 TGTCACCCAAAGGCCTCTGCTGG + Intergenic
1148811812 17:50297752-50297774 TGTAATCCCAAGCACTTTGGGGG + Intergenic
1149273512 17:55009420-55009442 TGTCAGGTAAAGCAGTTAGCTGG - Intronic
1149685038 17:58530482-58530504 AGTCAGCCTAAGAACTTGGCTGG + Intronic
1153399493 18:4667360-4667382 TGCCAGCCAAAGTGCTTTGTAGG - Intergenic
1155006411 18:21733547-21733569 TGTGAGCCACAGCACCTGGCTGG + Intronic
1155844960 18:30694863-30694885 TGTGAGCCAAAGCACTTTGTAGG + Intergenic
1157007991 18:43609507-43609529 TGTCAGCCAAATCAGCCTGCAGG - Intergenic
1157421120 18:47548378-47548400 CATCATCCAAAGCACTTTACAGG + Intergenic
1159058800 18:63493204-63493226 TCTCAGGAAAGGCACTTTGCCGG - Intronic
1165009877 19:32837212-32837234 TGTGAGCCACAGCACCTGGCAGG - Intronic
925386423 2:3464928-3464950 TTTCTGCCAAAGGCCTTTGCTGG - Intronic
925965564 2:9062285-9062307 TGTTAGCCTAAGAACGTTGCTGG + Intergenic
927006976 2:18861235-18861257 TGTCTGCAAAAGCACTCTGATGG + Intergenic
928354142 2:30593620-30593642 TATTACCCAAAGCAATTTGCAGG - Intronic
928801616 2:35100663-35100685 TTTCAGCAAATGCAATTTGCTGG + Intergenic
928865872 2:35917200-35917222 TGTTAGCCAATGCACTCTTCTGG - Intergenic
929409209 2:41677712-41677734 TGTGAGCCACAGCACCTAGCCGG + Intergenic
932565105 2:72901245-72901267 TGTGAGCAAAAGCACTGAGCGGG + Intergenic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
933941815 2:87251498-87251520 TGTGAGCCAAATTACTTGGCAGG + Intergenic
934906779 2:98211959-98211981 TATCAGCAAAAGCAGTTTTCAGG - Exonic
934996554 2:98967070-98967092 TGCCAGCCAAAGTACTTCACAGG + Intergenic
935535361 2:104286994-104287016 TGACAGCCACAGCTCTCTGCAGG - Intergenic
936338408 2:111610071-111610093 TGTGAGCCAAATTACTTGGCAGG - Intergenic
936463322 2:112726885-112726907 TGTCAGCCAGCGCCCTCTGCTGG + Intronic
940139227 2:150475058-150475080 TGACAGTCAAAGGACTTAGCCGG - Intronic
940185430 2:150979677-150979699 TGTTAACCAAAGCACTTTTGGGG - Intergenic
940308673 2:152253694-152253716 TGTGGGCCACAGCACTTGGCAGG + Intergenic
940456863 2:153912834-153912856 TGCCAGCCAAAGCTCTTTGTAGG + Intronic
941080037 2:161050028-161050050 TGTCAGTGAAAACACTTTGAAGG - Intergenic
941113556 2:161445345-161445367 TGTAAGCCCAAGCACTTGGGGGG - Intronic
942774921 2:179570092-179570114 TGTCAGCCAGAAAACTTTACTGG + Intronic
946167876 2:217876401-217876423 TGTTAGCCAGAGCACTGAGCCGG + Intronic
948944287 2:241211584-241211606 TGTCAGGGAAAGACCTTTGCAGG + Intronic
1168871920 20:1136326-1136348 TCACAGCCAGAGCACTGTGCAGG - Intronic
1169279752 20:4256904-4256926 TGGCAGCCAGAGCACTTGTCAGG - Intergenic
1170008091 20:11690776-11690798 TGTCAGCCAAGGGACATAGCTGG - Intergenic
1171560717 20:26122748-26122770 TGTGAGCCACTGCACTTGGCTGG - Intergenic
1174483848 20:50849254-50849276 TGTCAGCCAAAGAGCTTCCCTGG - Intronic
1174527928 20:51188688-51188710 TGTGAGCCACGGCACCTTGCTGG - Intergenic
1177524239 21:22271487-22271509 TGTCAGCCACTGCACCTGGCTGG + Intergenic
1181144295 22:20833312-20833334 TGCCAGCCAAAGCACTCTGTCGG + Intronic
949959644 3:9301456-9301478 TGTCAGTCAAAGCACTTTGCAGG + Intronic
951131050 3:19045284-19045306 TGTGAGCCACTGCACTTGGCCGG + Intergenic
955672561 3:61417344-61417366 TGACAGCCTAAGGCCTTTGCTGG + Intergenic
956163822 3:66381550-66381572 AGGCAGCCAAAGCTCTGTGCTGG - Exonic
957218652 3:77353790-77353812 TGTGAGCCACAGCACCTGGCCGG + Intronic
958590648 3:96154529-96154551 TGTCAGCCAAAGAACATTGGTGG - Intergenic
958645395 3:96865398-96865420 TGTGAGCCAAGGCACCTGGCTGG - Intronic
960258035 3:115532748-115532770 TGCCAGCCAAAGCATTTTGTAGG + Intergenic
962165880 3:133047358-133047380 TGTCAGAAATAGCACTTGGCTGG + Intronic
963936459 3:151058975-151058997 TGTCAGTCAAAGCACTTACCAGG + Intergenic
964296436 3:155239432-155239454 TGCCATCCAAAGCACTTTTTTGG + Intergenic
965097393 3:164249886-164249908 AGGCAGCCAAAACACTTAGCTGG + Intergenic
965411539 3:168337825-168337847 TTTCTGCCAAATCACTTTGATGG - Intergenic
966993087 3:185254059-185254081 CGTCAGGCAAACCACTTTTCCGG + Exonic
967659609 3:192090767-192090789 TGCTGGCCAAAGCACTTTGTTGG - Intergenic
971381614 4:26103794-26103816 TTTCTGCCAAAGCACCTTTCAGG - Intergenic
971513883 4:27462859-27462881 TGTTAGTCAAAGCAATTTACAGG + Intergenic
972083441 4:35182770-35182792 TGCCAGCCAAAGCCCTTTTTAGG - Intergenic
972576489 4:40356716-40356738 TGTGAGCCAAAGCACCTGGCCGG + Intergenic
973617333 4:52691889-52691911 TGCCAGCCACAGAACTTTGTAGG - Intergenic
973696557 4:53496311-53496333 AGTCAGCCACAGCACCTGGCAGG + Exonic
974621452 4:64361184-64361206 TGTCTGCAAAAGCACTCTGGTGG - Intronic
975899156 4:79129572-79129594 TGCCAGCCAAAGCACTTCATAGG + Intergenic
976039281 4:80862665-80862687 TGTTGGCCAAAGCAGGTTGCAGG - Intronic
976644501 4:87373426-87373448 TGTGAGCCACTGCACTTGGCCGG - Intronic
976845792 4:89487602-89487624 AAGCAGCCAAAGCATTTTGCGGG + Intergenic
977696588 4:99972302-99972324 TGCCAGCCAAAACACTTCACAGG - Intergenic
977811448 4:101360209-101360231 TGTCTGCCAAAGAACTTCACTGG - Intergenic
978596264 4:110380171-110380193 TGCCAGCCAAAGCTCTTTATAGG - Intronic
978710160 4:111770522-111770544 TGCCAGTCAAAGCACTTTGTTGG + Intergenic
979076342 4:116275385-116275407 TGCCAGCCAAAGCACTTCCTGGG - Intergenic
979239557 4:118436225-118436247 TCTAACCCAAAGCACTCTGCAGG - Intergenic
979922161 4:126511911-126511933 TGTGAGCCACTGCACTTGGCCGG - Intergenic
980583899 4:134788660-134788682 TGCCAGCCAAAGCACTTCATAGG + Intergenic
980670904 4:136005769-136005791 TGTAAACCAAAGGACTGTGCTGG - Intergenic
981511971 4:145567095-145567117 TGCCAGCCAAAGCACTTTGTAGG - Intergenic
984622936 4:181974284-181974306 TGTCAGCCACTGCACCTGGCCGG - Intergenic
986903783 5:12468551-12468573 TGCCAGCCAAAACACTTTGTAGG - Intergenic
986920158 5:12670828-12670850 TGTCACCCAAAGCACTGGGTTGG - Intergenic
988130070 5:27092509-27092531 TTACAGCCAAAGCACTTGCCTGG - Intronic
988991197 5:36672499-36672521 TGGCAGCCCAATCACTCTGCAGG - Intronic
989086721 5:37684728-37684750 TGTCAGCAAAAGCATTTTGTAGG + Intronic
990168063 5:53017511-53017533 TGCCAGCCAAAGCTCTTTGTTGG + Intronic
991498665 5:67253459-67253481 TGTGGGCCAAGGCACTCTGCTGG - Intergenic
993953099 5:94199812-94199834 TGTCTGCAAAAGCACTCTGATGG + Intronic
994613821 5:102078485-102078507 TGCCAGCCAAAGTGCTTTGTTGG - Intergenic
994643005 5:102433685-102433707 TGGCAGCCAAAGCACTTTGTAGG + Intronic
997188069 5:131901560-131901582 TGCCAGCCAAAGCTCTTCACAGG - Intronic
999074326 5:148780419-148780441 TGTCAGCCAGAGAACATGGCAGG - Intergenic
1000521454 5:162299831-162299853 TGCCAGCCAAAGCACTTCAGTGG + Intergenic
1001256740 5:170189209-170189231 TGTCAGCCAAAACCCTCTGGGGG + Intergenic
1005601448 6:27430395-27430417 TGTCAAAAAAAGGACTTTGCAGG + Intergenic
1007314775 6:40978666-40978688 TGCCAGCCAAAGCACTTCACAGG + Intergenic
1007666212 6:43514569-43514591 TGTGAGCCAAAGCAGGTTGGTGG - Intronic
1008081999 6:47204545-47204567 TGTAAGCCAAAGGATTCTGCAGG - Intergenic
1008237689 6:49069988-49070010 TGTGAGCCACAGCACCTGGCTGG + Intergenic
1009621548 6:66084588-66084610 TGCCAGCCAAAGTGCTTTGCTGG + Intergenic
1010177954 6:73051435-73051457 TGCCAGCCAAACCACTTTGTTGG - Intronic
1010190682 6:73193299-73193321 CGTGAGCCATAGCACTCTGCAGG + Intronic
1012668927 6:102015715-102015737 TGCCAGCCAAAGCACTTTGCAGG - Intronic
1014135980 6:117890526-117890548 TTTCTGACAAAGCACTTTGGTGG + Intergenic
1014254576 6:119148188-119148210 TGTCAGCAGAAGCACTTTCCTGG + Intronic
1016577237 6:145583594-145583616 TGCCAGCCAAAGCACTTTGTAGG + Intronic
1018250863 6:161868826-161868848 TGTCATCAAAAGCACTTGTCAGG + Intronic
1019438160 7:1032347-1032369 TGTCTGCCAAATCACTTTCGTGG + Intronic
1021425709 7:20496666-20496688 TGCCAGTCAAAGCACTTTATAGG - Intergenic
1028347213 7:89798036-89798058 TGGCAGCCAAAGCACTTCATTGG + Intergenic
1028353364 7:89877298-89877320 TGCTGGCCAAAGCACTTTGATGG + Intergenic
1028639925 7:93030261-93030283 TGTCAGCTAAAGCACTTTGTAGG - Intergenic
1028928099 7:96382369-96382391 TGTGAGCCACAGCACCTGGCTGG + Intergenic
1033539448 7:142343192-142343214 TTTCAGCCCAAGCACATGGCAGG - Intergenic
1034366358 7:150551864-150551886 TGCCAGCCAAAGCACTTTTTAGG - Intergenic
1034928443 7:155141634-155141656 TGTTAGCAATAGCACTTTGAAGG + Intergenic
1035997117 8:4560557-4560579 TGTGAGCTAAAACACTGTGCTGG + Intronic
1037177204 8:15961671-15961693 TGTCTGCCAAAGCTCTCTGATGG + Intergenic
1037353924 8:17997742-17997764 TGTGAGCCATAGCACCTGGCCGG - Intronic
1038589864 8:28826919-28826941 TGTCAGCAAAAGGACTTTGTGGG - Intronic
1038972592 8:32653448-32653470 TGTCAGTTAAAGGACATTGCTGG - Intronic
1039824555 8:41161909-41161931 TTTCTGCCAAAGCTCTTGGCTGG - Intergenic
1040942341 8:52845867-52845889 TCTCACCCAAAGCACTGAGCTGG - Intergenic
1041436186 8:57844696-57844718 TGGCAGCCAGAGCACTCTGTTGG + Intergenic
1042976634 8:74477713-74477735 TGCCAGCCAAAGCACTTCAAAGG + Intronic
1046041573 8:108912168-108912190 CTTCAGCCAAAGCACTTAGCAGG - Intergenic
1046679424 8:117152131-117152153 AGTCAGCAAAAGCCCTTTGCTGG + Intronic
1048233541 8:132667805-132667827 TATCAGCAAAATGACTTTGCAGG + Intronic
1049335106 8:142080091-142080113 TGTCAGTCAATGCCCTTGGCTGG + Intergenic
1050424943 9:5502812-5502834 TGCCAGCCAAAGTGCTTTGTAGG - Intergenic
1050675905 9:8053032-8053054 TGCCAGCCAAAGCACTTCACAGG + Intergenic
1051110333 9:13627874-13627896 TGCCAGCCAAAATACTTTGTAGG - Intergenic
1054820196 9:69514625-69514647 TGTGAGCCACAGCACCTGGCCGG - Intronic
1055862434 9:80768845-80768867 TCTCACCCAAAGCATTTGGCTGG + Intergenic
1056039587 9:82649176-82649198 GGTCAGACAAGGCAATTTGCAGG - Intergenic
1057638480 9:96794848-96794870 TCCCAGCCAAAGCACTTTGTAGG + Intergenic
1058553967 9:106146590-106146612 TGTCAGCCATTGAACTATGCAGG - Intergenic
1188707901 X:33357870-33357892 TGCCAGCCAAAGCACTTCATTGG - Intergenic
1188768442 X:34125505-34125527 TGCCAGCCAAAGCACTTTACAGG + Intergenic
1188771251 X:34157470-34157492 TGCCACCCAAAGCACTTAGTAGG + Intergenic
1188797101 X:34480950-34480972 TGCCACCCAAAGCACTTAGCAGG + Intergenic
1188833927 X:34933298-34933320 TGCCAGTCAAAGCACTTTGTAGG - Intergenic
1188835466 X:34948771-34948793 TGCCAGCCAAATCACTTCACAGG - Intergenic
1188994232 X:36862671-36862693 TGTTACACGAAGCACTTTGCAGG + Intergenic
1190094564 X:47468311-47468333 CCTCAGCCAGAGCACTTTGAAGG - Intronic
1191225749 X:58040975-58040997 TGTCAGCCAAAGCATTTAATAGG - Intergenic
1191586965 X:62838105-62838127 TGCCAGCAAATGCACTTTGTTGG + Intergenic
1192766736 X:74147196-74147218 TACCAGCCAAAGCATTTTGCAGG - Intergenic
1192872062 X:75194385-75194407 TGTCAGCCAGAGTGCTTTGTAGG + Intergenic
1192934739 X:75848117-75848139 TGCCAGCCAAAGTGCTTTGTAGG + Intergenic
1192996690 X:76520126-76520148 TGCCAGCCAAAGCACTTCGTGGG + Intergenic
1193518274 X:82497254-82497276 TGTCAAGAAAAGCAGTTTGCAGG - Intergenic
1194344795 X:92750598-92750620 TGTCAGACAAAGCACTTCATAGG + Intergenic
1195029965 X:100917358-100917380 TGTAATCCCAAGCACTTTGCGGG + Intronic
1195270255 X:103221427-103221449 TGCCAGCCAAAGCACTTCCTAGG - Intergenic
1195533229 X:105981923-105981945 CGCCAGCCAAAGCATTTTGTAGG + Intergenic
1195544466 X:106099946-106099968 TGCCAGCCAAAACACTTTGTAGG + Intergenic
1197094014 X:122572284-122572306 TGTCAGCCAAAGTGCTTTCTTGG - Intergenic
1197141566 X:123122523-123122545 TGTCAGCCAAAGCACTTTGTAGG - Intergenic
1198579687 X:138049542-138049564 TGCCAGTCAAAGCTCTTTGTTGG - Intergenic
1198779840 X:140222390-140222412 TGCCAACCAAAGCACTTCGTAGG - Intergenic
1198975015 X:142326986-142327008 GGCCAGCCAAAGCACTTTGTAGG + Intergenic
1199137136 X:144266466-144266488 TGTCAGCCAAGTCACTTCACAGG - Intergenic
1199269999 X:145872420-145872442 TGCCAGCCAAAGCATTTGGTAGG + Intergenic
1200653141 Y:5867239-5867261 TGTCAGACAAAGCACTTCACAGG + Intergenic
1201239690 Y:11946774-11946796 TGTAAGCCAAAACAGTTTGGAGG + Intergenic
1201395196 Y:13539978-13540000 TGTCAGCCAAAGCACTTTTCAGG - Intergenic