ID: 1092514295

View in Genome Browser
Species Human (GRCh38)
Location 12:9192499-9192521
Sequence GCCTCATTCTTACCAGGTAA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 163}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092514290_1092514295 17 Left 1092514290 12:9192459-9192481 CCACTTTTGTCCTACTGATAAGC 0: 1
1: 0
2: 2
3: 5
4: 132
Right 1092514295 12:9192499-9192521 GCCTCATTCTTACCAGGTAATGG 0: 1
1: 0
2: 0
3: 14
4: 163
1092514291_1092514295 7 Left 1092514291 12:9192469-9192491 CCTACTGATAAGCTGCAATTGTA 0: 1
1: 0
2: 0
3: 10
4: 144
Right 1092514295 12:9192499-9192521 GCCTCATTCTTACCAGGTAATGG 0: 1
1: 0
2: 0
3: 14
4: 163
1092514289_1092514295 25 Left 1092514289 12:9192451-9192473 CCTATTGACCACTTTTGTCCTAC 0: 1
1: 0
2: 0
3: 13
4: 73
Right 1092514295 12:9192499-9192521 GCCTCATTCTTACCAGGTAATGG 0: 1
1: 0
2: 0
3: 14
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092514295 Original CRISPR GCCTCATTCTTACCAGGTAA TGG Exonic
901195021 1:7435651-7435673 GCCTCCTTCTGACCAGGCAAGGG + Intronic
902031057 1:13422551-13422573 GCCTCCCTGTTACCAGGAAATGG - Intergenic
904946835 1:34205650-34205672 GCCTCAATCTTCCAAGGAAATGG + Intronic
907096829 1:51789650-51789672 GCTTCAATCTTACAAGGGAAGGG + Exonic
907694801 1:56713254-56713276 GCCTGATTCTTATCAGGCTATGG - Exonic
912463648 1:109854366-109854388 GCCTCATTGTTTACAGGTAGTGG - Intergenic
915346190 1:155198214-155198236 GCCTCACTCTGCCCAGGCAATGG - Exonic
915652464 1:157326148-157326170 GCCAGTTTCTTACCAGGTGATGG - Intergenic
915948100 1:160168915-160168937 ACCTAATTCTTTCCAGTTAAAGG - Intronic
916770290 1:167901239-167901261 ACCTCATTCTTATGAGGTAGGGG + Intronic
917757775 1:178119990-178120012 GCATCATTCTTAGTAGCTAACGG - Intronic
918869933 1:189957415-189957437 GCATCATTATTCCCAGGTGAGGG + Intergenic
920455937 1:206101182-206101204 GCCTCCTGCCTGCCAGGTAATGG + Exonic
924038914 1:239964109-239964131 GCTTCATTCTTAGCAGCTCAGGG + Intergenic
1063628331 10:7711928-7711950 ACCTAATCCTTACCAAGTAATGG - Intronic
1066175897 10:32905509-32905531 ACCTCTTCCTAACCAGGTAACGG + Intronic
1066309966 10:34186609-34186631 CCCTCATTCTTCCCTGGGAATGG - Intronic
1066573279 10:36796989-36797011 GCCTCATTCCATCCAAGTAAAGG - Intergenic
1066604645 10:37150376-37150398 TCCTCATCTTTACAAGGTAAAGG - Intronic
1066605465 10:37163377-37163399 TCCTCATCTTTACAAGGTAAAGG - Intronic
1066606176 10:37174439-37174461 TCCTCATCTTTACAAGGTAAAGG - Intronic
1066606960 10:37186240-37186262 TCCTCATCTTTACAAGGTAAAGG - Intronic
1067660707 10:48234641-48234663 GCCTCCTGTTTCCCAGGTAAGGG + Intronic
1071802535 10:89079692-89079714 GCCACATTCTTTCCAAGAAATGG + Intergenic
1074816406 10:117144407-117144429 GCCACATGCCTAACAGGTAAGGG - Intergenic
1075313070 10:121430908-121430930 TCCTCATTTTCAGCAGGTAACGG + Intergenic
1083771855 11:64872018-64872040 GCCTCTTTCCTACCAGGGAAAGG + Intronic
1086441707 11:86835289-86835311 GCCTCATTGTTTACAGGTAGTGG - Intronic
1088131043 11:106491578-106491600 GCCTCATTACTACCAGTTAGGGG + Intergenic
1088565363 11:111166787-111166809 ACCTCATTCTTACAAGATACTGG - Intergenic
1090070242 11:123538035-123538057 GCCACATCCTTGCCAGGAAAAGG + Intronic
1090960955 11:131556218-131556240 GCCTAATTCTTGCCAGGGGAAGG - Intronic
1092514295 12:9192499-9192521 GCCTCATTCTTACCAGGTAATGG + Exonic
1096808611 12:54155701-54155723 GCCTCAGTATTCCCAGGGAAGGG + Intergenic
1098662027 12:73106646-73106668 TGCTCATTCTTACCAGGATAGGG + Intergenic
1099206073 12:79727855-79727877 ACCTCATTATTACCAGGTAGGGG - Intergenic
1099413867 12:82363026-82363048 ACCACATCCTTACCAGGTCAAGG + Intronic
1099705660 12:86150261-86150283 GCCTCATTCCTAACAGGCCAGGG + Intronic
1100774043 12:97955154-97955176 GCCTCACTCTCACCAGCTGAAGG - Intergenic
1101262432 12:103046552-103046574 GCCTGATTCCTAACAGGTCATGG - Intergenic
1105917072 13:24926605-24926627 GCCCCACTGTTACTAGGTAAAGG + Intergenic
1109271464 13:60260537-60260559 GCCTTATTATTACTAGTTAATGG + Intergenic
1111310389 13:86476690-86476712 GCCTGCTTCTTACCAGGCCATGG - Intergenic
1112465688 13:99642665-99642687 GCCTCATTCTTCCCAAGTGCTGG + Intronic
1115496877 14:34013621-34013643 GCCACATTCTTAACAGATGAAGG + Intronic
1116427828 14:44811610-44811632 GCATCGTGTTTACCAGGTAATGG + Intergenic
1119640970 14:76314664-76314686 GGCTCACTGTTCCCAGGTAAAGG + Intronic
1119978734 14:79055445-79055467 GCCTCATTGTGACCAGCTAAGGG + Intronic
1125279035 15:38025073-38025095 GCCTCATTATAACCTGGCAAGGG + Intergenic
1126027567 15:44462621-44462643 GCCTCATTCCTAACAGGCCATGG + Intronic
1126747675 15:51842983-51843005 GCCTCACTCTTACATGGTGAAGG - Intronic
1129520450 15:76182781-76182803 GCCTCAGTCTTTCCATGTGAAGG - Intronic
1132257217 15:100386066-100386088 GCCTCATTAGTACCTGGTGAAGG - Intergenic
1134045676 16:11099129-11099151 GCCCCATTCCTTCCAGGTCAGGG + Intronic
1134099388 16:11440932-11440954 GGCCCATTCCTACCAGGTATGGG - Exonic
1134747212 16:16597592-16597614 GCCTCATTCTTCCCAAGTGCTGG + Intergenic
1135328730 16:21544159-21544181 GCAGCATTCTCACCATGTAATGG - Intergenic
1135344192 16:21674276-21674298 TCCTCATTCTTTCTAGTTAATGG + Intergenic
1136078687 16:27837417-27837439 TCCTGGTTCTTACCAGGTGAGGG + Intronic
1136339080 16:29630132-29630154 GCAGCATTCTCACCATGTAATGG - Intergenic
1136995960 16:35188159-35188181 GCCTCATTCAGCCCAGGTAGGGG + Intergenic
1142041755 16:87898696-87898718 GCAGCATTCTCACCATGTAATGG - Intronic
1145060991 17:19733580-19733602 TCCTCATGCATCCCAGGTAAGGG - Intergenic
1149410255 17:56397686-56397708 ACCTCATCCTTCCCAGGTCATGG - Intronic
1151026711 17:70685606-70685628 GCCTGGTTCTTAACAGGTCATGG - Intergenic
1153401826 18:4690310-4690332 GCCTCATTGTTTACAGGTAGTGG + Intergenic
1154477986 18:14785070-14785092 TCCTCATCTTTACAAGGTAAAGG - Intronic
1156842076 18:41620649-41620671 GACTCATTCTGAACATGTAAAGG - Intergenic
1157298429 18:46462381-46462403 GCCTCATCCCCACCAGGTAAAGG - Exonic
1158432921 18:57406834-57406856 GCCTCATTATTGGCAGGTGATGG - Intergenic
1159719260 18:71865928-71865950 GCCTGATTCTTACCTGGTTGGGG - Intergenic
1161847816 19:6722011-6722033 GCCTCATTCTTACAGGTTACAGG + Intronic
1164293265 19:23886483-23886505 GCCCCACTGTTACCAGGTAAAGG - Intergenic
1165104531 19:33461325-33461347 CCCTCATGCCTTCCAGGTAATGG - Intronic
925831080 2:7896225-7896247 GCTTCAGTCTTATCAGGTAATGG - Intergenic
926196002 2:10763880-10763902 GGCTCATTCTAACCAGGTGTGGG - Intronic
926588566 2:14715978-14716000 GCCACCTTCTTACCTGGAAAAGG + Intergenic
928207308 2:29295194-29295216 GCCTCCTTCTTCCCTGTTAAAGG - Intronic
928675221 2:33644423-33644445 GCCTGATTCTTAACAGGCCATGG - Intergenic
929434984 2:41921898-41921920 GCCTCCTTCTCACCTGGAAACGG - Intergenic
930689458 2:54345400-54345422 GCATCATTCTTACCAAGCACAGG - Intronic
932892416 2:75608765-75608787 GCGCTATTCTTACCAGGAAAGGG - Intergenic
935607661 2:104986551-104986573 GCCTATTGCTTACCAGATAATGG + Intergenic
940439294 2:153695297-153695319 GACTCACTCTTATCAGGGAATGG + Intergenic
940969564 2:159880920-159880942 GCCCAATTCTTAACAGGTAATGG + Intronic
942700869 2:178708483-178708505 GCCTTATTCTTTCTAGGTACAGG - Intronic
943426945 2:187749550-187749572 ACCTCATTCTTCCCAGGCACAGG - Intergenic
943757543 2:191572287-191572309 TCCCCACTCTTACCAGGTATGGG + Intergenic
943759321 2:191591349-191591371 GCTTCACTCTTACCAGTAAAAGG - Intergenic
948337184 2:237218494-237218516 GCCTCATTCCTGCCAGGTGGGGG - Intergenic
948580248 2:238982385-238982407 GCCTCATTGTTTACAGGTAGTGG - Intergenic
1169240170 20:3970293-3970315 GCTTCATTAATGCCAGGTAAAGG - Intronic
1172575530 20:36005441-36005463 GCCTCATTCCTAACAGGCCACGG + Intronic
1175001190 20:55632471-55632493 GCCTCATTGTTAGGAGTTAAGGG - Intergenic
1177262653 21:18750410-18750432 GCCTCATTCTTCCTAGGCACAGG + Intergenic
1179956218 21:44740631-44740653 GCCTAATTTTTTCCTGGTAATGG + Intergenic
1180067194 21:45418379-45418401 GGCTCATTCTTCCCACGTCAAGG + Intronic
1184523374 22:45008375-45008397 GGCTCTTTCTTTCCAGGAAAGGG + Intronic
1184631172 22:45781194-45781216 GCCTCATTATAACCAGGGGAAGG - Intronic
953482046 3:43260155-43260177 ACCTCACTCACACCAGGTAAGGG - Intergenic
953512294 3:43554617-43554639 GCCTTATTACTACCAGGTAGAGG + Intronic
953533389 3:43758083-43758105 GCCTCTTCCTTGCCAGTTAATGG + Intergenic
953832433 3:46312108-46312130 GCCTCATTACTGCCAGGTAGGGG + Intergenic
956999997 3:74874551-74874573 GCCTCATTGTTTACAGGTAGGGG - Intergenic
958015960 3:87940952-87940974 GCCTCATTGTTTACAGGTAGTGG - Intergenic
959355514 3:105322993-105323015 CCCTCATTCTTACAAGGGCAAGG + Intergenic
960236000 3:115282853-115282875 GGCTTATTCTTTCCAAGTAATGG - Intergenic
960336029 3:116418802-116418824 CCTTCATATTTACCAGGTAAAGG + Intronic
960437407 3:117644664-117644686 GCCTCATTACTGCCAGGTAAGGG + Intergenic
965472958 3:169117803-169117825 GAGTGATTCTTACCTGGTAAAGG - Intronic
965946027 3:174242271-174242293 GCCTGATTCTTAACAGGCCATGG - Intronic
966353788 3:179058101-179058123 GCCTCATTGTTTACAGGTAGTGG + Intronic
966565910 3:181381043-181381065 GCCTCATGTTTACCATGGAATGG + Intergenic
970610302 4:17719185-17719207 GCCTTATTCTTACCTCATAATGG - Intronic
972296158 4:37741077-37741099 GACTCTTTCTTACCAAGTAATGG + Intergenic
976549788 4:86381159-86381181 GCCACATTCCAACCTGGTAATGG + Intronic
976968134 4:91070513-91070535 GCCTGGTTCTTAACAGGTCATGG - Intronic
977902664 4:102440136-102440158 GCTTCTTTCTTACCAGATAAAGG - Intergenic
980332446 4:131427118-131427140 GACTCATTCTTACCACTTACTGG + Intergenic
982210376 4:153029861-153029883 GCCTCATTGCTTCCAGGTCAGGG - Intergenic
984724018 4:183002663-183002685 GCCTCATTCTTTACGGGTAGTGG + Intergenic
986252612 5:6074452-6074474 GCCACATTGTTGCCAGGAAAGGG + Intergenic
990850237 5:60194908-60194930 GACTCCTACTTACCATGTAAAGG - Intronic
990892567 5:60664287-60664309 GCCTCATTGTTTACAGGTAGTGG + Intronic
991663460 5:68973387-68973409 GCCTCATTCTTAATATGAAATGG + Intergenic
992382733 5:76254909-76254931 GTCTCATTTGTACCAGGAAAAGG - Intronic
995321223 5:110836528-110836550 ACCTCATTCTGTCCAGGAAAAGG - Intergenic
995993626 5:118272357-118272379 ACCTCATTCTTGTCAGGTGAGGG - Intergenic
996628802 5:125603052-125603074 GCCTCATTCCTAACAGGCCAAGG - Intergenic
1000007144 5:157197071-157197093 GCCCCATTCTTACTAGATCAAGG - Intronic
1000625233 5:163530645-163530667 GCATCATTTTTTCCAGGTGAAGG - Intergenic
1001436420 5:171702965-171702987 GCCTCATGACCACCAGGTAAAGG + Intergenic
1004190862 6:13462295-13462317 GCTTCATTCTAATCAGGGAATGG + Intronic
1005107266 6:22237107-22237129 GGGTCATTATCACCAGGTAATGG - Intergenic
1008360672 6:50613675-50613697 ACCTCATTACTGCCAGGTAAGGG - Intergenic
1015406346 6:132841209-132841231 GCCTCATTTTTAAAAGATAAAGG - Intergenic
1016444426 6:144118046-144118068 GCCTCATTGTTTACAGGTAGTGG - Intergenic
1018179298 6:161206500-161206522 ACCTTATTATTGCCAGGTAAGGG - Intronic
1020614059 7:10436869-10436891 GACTCCATCTTACTAGGTAAAGG + Intergenic
1020959687 7:14787144-14787166 ACCTCATTCTTCCCAGATACGGG + Intronic
1021596278 7:22320422-22320444 ACCTCATTTTTAGCAGGTACTGG + Intronic
1024742442 7:52369266-52369288 GCCTCATTTTTACCTTATAATGG + Intergenic
1025091635 7:56069009-56069031 GCCTCATTCTTAATATCTAAAGG + Intronic
1025903805 7:65768646-65768668 GCCTAATTCTTAACATTTAAAGG + Intergenic
1025959196 7:66205507-66205529 TCCTCACTCATCCCAGGTAAGGG + Exonic
1026079568 7:67205619-67205641 GCCTCATTATAACCAGGTGAAGG + Intronic
1026697278 7:72606363-72606385 GCCTCGTTATAACCAGGTGAAGG - Intronic
1026892045 7:73988015-73988037 GCCTCTTTCTTGCAAGGTTATGG - Intergenic
1029326933 7:99817892-99817914 GCCTCATCCTTACCAGCTCCTGG + Intergenic
1030133193 7:106220465-106220487 GCTCCATGCTTTCCAGGTAAAGG - Intergenic
1030337587 7:108342735-108342757 GCCTCATTGTTTACAGGTAGTGG + Intronic
1030843216 7:114380809-114380831 GCCTCATTGTTTACAGGTACTGG - Intronic
1032479585 7:132235711-132235733 GTCTCAGTCTCAGCAGGTAATGG - Intronic
1034014220 7:147564958-147564980 TCCACATTCTTTCCAGGAAAAGG - Intronic
1036453100 8:8885822-8885844 GCCTCATTCTTCCCAGGAGCTGG + Intronic
1038202744 8:25430293-25430315 GCCTGATTCTTAACAGGCCATGG - Intronic
1039594988 8:38784001-38784023 ACCTCAGTCTAACCAGGCAAGGG - Intronic
1039595005 8:38784119-38784141 GCTTCGTTCTTACCTGGTACAGG - Intronic
1039770083 8:40677156-40677178 GCCTCACTCCTACCAGGATATGG - Intronic
1041768675 8:61449083-61449105 GCCTCATCATTACCAAGTAGAGG + Intronic
1042012789 8:64266988-64267010 TCCTCATTCCTACCAGGCTATGG + Intergenic
1043490254 8:80741446-80741468 GCCTCATTGTTTACAGGTAGTGG + Intronic
1046118643 8:109816900-109816922 TCCTCAATCTTACCATTTAATGG - Intergenic
1046534439 8:115491126-115491148 GTCTAATTATTACAAGGTAAAGG - Intronic
1049474415 8:142790156-142790178 CCCACCTGCTTACCAGGTAATGG - Intergenic
1049676043 8:143889688-143889710 TCCTCTTTCTTGGCAGGTAAGGG + Intergenic
1052439185 9:28471565-28471587 GCACCATTCTTACCAGTTATAGG + Intronic
1052708003 9:32016313-32016335 ACCTCATTCTTCCCAGGCACAGG - Intergenic
1052974352 9:34400537-34400559 GCCTCAGCCTAACCAGGAAAGGG - Exonic
1057345466 9:94246886-94246908 GCTTCATTCTTGCTAGGTAATGG - Intergenic
1060801020 9:126545976-126545998 GCCTCACTCTCAGCAGGTGAGGG + Intergenic
1061542946 9:131288155-131288177 GCCTCATCCCTGCCAGGAAAGGG + Intergenic
1187684642 X:21804199-21804221 GCTGCATTCTCACCAGGGAAAGG - Intergenic
1188346102 X:29067496-29067518 GCCTATTTCATACCAGTTAAGGG + Intronic
1189379822 X:40494649-40494671 GCCTCATTCCTACCAGGGCACGG - Intergenic
1191190376 X:57660168-57660190 TTGTCATTCTTTCCAGGTAAAGG + Intergenic
1196279241 X:113803679-113803701 GACCCATTCTGACCAGTTAAAGG + Intergenic
1196527060 X:116739679-116739701 GCCTCATTCTTTACGGGTAGTGG - Intergenic