ID: 1092517256

View in Genome Browser
Species Human (GRCh38)
Location 12:9227504-9227526
Sequence TGAGAACACCACCAAGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092517252_1092517256 1 Left 1092517252 12:9227480-9227502 CCAGAACTTGCTAGAACTCTATC No data
Right 1092517256 12:9227504-9227526 TGAGAACACCACCAAGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092517256 Original CRISPR TGAGAACACCACCAAGGGGA TGG Intergenic
No off target data available for this crispr