ID: 1092517396

View in Genome Browser
Species Human (GRCh38)
Location 12:9229363-9229385
Sequence ATACTTTACCAGCACTGCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092517396 Original CRISPR ATACTTTACCAGCACTGCAA GGG Intergenic
904310492 1:29626334-29626356 AGAATTTATCAGCACTGCAGGGG - Intergenic
904679510 1:32219232-32219254 ATTCTTTCCCAGCACTCCCAGGG + Intronic
905112844 1:35609947-35609969 AAATTTTGCAAGCACTGCAAAGG + Intronic
906138904 1:43521640-43521662 ATAGTTTTCCATCACTGCGACGG - Intergenic
909861692 1:80613770-80613792 AAATTTTACCAGAAGTGCAAAGG - Intergenic
915078847 1:153337453-153337475 CTAGTTTACCAGCACTCCATTGG - Intronic
919105434 1:193144498-193144520 ATTGTGTACCATCACTGCAAAGG - Intronic
921513050 1:216055436-216055458 AGATTTTATCAGCACTGCAGCGG - Intronic
1064287497 10:14004690-14004712 ATCCTTTACAAGCACTGCAAAGG + Intronic
1070051410 10:72893664-72893686 AGACTTTATCAGCACTGGTAGGG - Exonic
1070923308 10:80202653-80202675 ATGCTTCACCAGCACTGCCAAGG - Intronic
1072185922 10:93038961-93038983 ACACTTTGCTAGCACTTCAAAGG + Intronic
1072695617 10:97600776-97600798 GGACTTTTCCAGCACTGCAGGGG + Intronic
1072978888 10:100082685-100082707 ATACTTTACCTCCACTAGAATGG + Intergenic
1081370818 11:42300674-42300696 ATACTTTATAACCACAGCAACGG - Intergenic
1083424829 11:62578105-62578127 ACACTTTACAAACACTGAAATGG + Intronic
1084424838 11:69079007-69079029 CTACTTTACCAGCAGGACAACGG - Exonic
1086599749 11:88618099-88618121 AAACTTTGATAGCACTGCAAAGG + Intronic
1086845838 11:91748633-91748655 TTACTATACCTGCACCGCAAAGG + Intergenic
1086866859 11:91990338-91990360 TTAGTTTACCAGCTGTGCAACGG + Intergenic
1090280054 11:125448162-125448184 ATACTTTTCAAGCACTTGAAAGG - Intronic
1092517396 12:9229363-9229385 ATACTTTACCAGCACTGCAAGGG + Intergenic
1094064804 12:26351060-26351082 TAACTTTAGCAGCACTGCTAGGG + Intronic
1095760438 12:45827709-45827731 ATAGGTGACCAGCACTGCAGAGG + Intronic
1096045178 12:48556064-48556086 ATTCTCTACCAACACTGGAATGG + Intergenic
1102430889 12:112881982-112882004 ATACTTTACTTGCTCTGCAATGG - Intronic
1103881485 12:124169544-124169566 ATAGTTTCCCAGCTCTACAAAGG - Intronic
1107799932 13:44096424-44096446 ATAAATTACCAGCAATGCAACGG + Intergenic
1108936362 13:55886017-55886039 CTAATTTTCCAGCACTGCAGTGG - Intergenic
1111663270 13:91237092-91237114 ATAGTTTGCCAACACTGCCACGG - Intergenic
1113221223 13:108104790-108104812 ATACTTTTCAACCACTGAAAAGG - Intergenic
1116785439 14:49282570-49282592 ATTTTTTTCCAGCACTCCAAAGG - Intergenic
1117233564 14:53747319-53747341 ATATTTTACCAGTCCTTCAATGG + Intergenic
1117443643 14:55782102-55782124 ATACTTTTCCTGCCCTCCAAGGG - Intergenic
1119950703 14:78741398-78741420 AAACCTCACCAGCATTGCAAGGG + Intronic
1127250484 15:57231452-57231474 ATACTGGACCAGCACTCCAATGG - Intronic
1128450679 15:67804379-67804401 ATACTTTACCCCACCTGCAAGGG - Intronic
1128910403 15:71508526-71508548 TTTCATTACCAGCTCTGCAAAGG + Intronic
1130182193 15:81641603-81641625 ATACTTTCCCAGAACTGCCTCGG - Intergenic
1130635478 15:85615435-85615457 ATACTTTACAATGGCTGCAAAGG - Intronic
1131457312 15:92591967-92591989 ATACTTTAACATCAAAGCAAAGG + Intergenic
1131948453 15:97653175-97653197 GTCCTGTCCCAGCACTGCAAGGG - Intergenic
1139028598 16:62850991-62851013 ATAGTTTACCATCACTGGTATGG + Intergenic
1141913223 16:87075329-87075351 AAACTTAAACAGCACTGAAAGGG + Intergenic
1142533999 17:600974-600996 ATTCTTTCCCAGCACCACAAGGG - Intronic
1144031258 17:11325303-11325325 ATACTTTTCTAGGACTGCATCGG + Intronic
1145011241 17:19369480-19369502 CTACTTTACCAGCACATCACTGG + Intronic
1146572933 17:33968459-33968481 CTGCTTTTCCCGCACTGCAAGGG + Intronic
1149508967 17:57221432-57221454 ATACTTAACCTGTACTACAATGG + Intergenic
1150613417 17:66751281-66751303 ATGCTTTACAAACACTGTAAAGG + Intronic
1155543603 18:26890952-26890974 ATACTTTTCCACCACAGCACAGG - Intergenic
1158683108 18:59586628-59586650 AAAGTTGGCCAGCACTGCAAGGG + Intronic
1159246207 18:65808568-65808590 ATTCTTTCCCTGCACTGTAACGG - Intronic
1159491002 18:69134281-69134303 TTACTTTTCCAGCACTAGAAGGG - Intergenic
1165767102 19:38358469-38358491 GTCCTACACCAGCACTGCAATGG + Exonic
1168114040 19:54211030-54211052 ATAGTCTACCAGCTCTGCAGAGG + Intronic
925563267 2:5221446-5221468 ATAATATACCCCCACTGCAAAGG - Intergenic
931323315 2:61193943-61193965 AAACTTTACAAACACTGAAATGG + Intronic
933888816 2:86745922-86745944 CAACATTACCAGCTCTGCAATGG - Intronic
936084799 2:109459968-109459990 ATATTGTCCCAGCCCTGCAAGGG + Intronic
936108760 2:109647969-109647991 ATACTTAAGCAGCTCAGCAAAGG - Intergenic
936922883 2:117707304-117707326 ATGTTTTACCAGCACTGAGAGGG - Intergenic
937614613 2:123907048-123907070 ATACTTTGGCAGCAATGGAAGGG - Intergenic
939560170 2:143722570-143722592 TTACATTAGTAGCACTGCAAAGG - Intronic
939694360 2:145305969-145305991 ATAATTTACCAGCACTTCCTGGG + Intergenic
943377533 2:187098314-187098336 AAACTTCACATGCACTGCAAAGG - Intergenic
943892328 2:193305852-193305874 ATACTATACTAGCACTACAAGGG + Intergenic
947571835 2:231242063-231242085 AAACTTTAGCAGCACTGAAATGG - Intronic
948077087 2:235173339-235173361 AGACTTTAGCAGCAGTCCAAGGG - Intergenic
948122397 2:235540641-235540663 ACTCTCTCCCAGCACTGCAAGGG - Intronic
1170388779 20:15849965-15849987 ATACTTTGCCATCACTCCCATGG - Intronic
1173003679 20:39123668-39123690 ATACTTTACAAACACAGCCAAGG - Intergenic
1174770354 20:53293664-53293686 AAAATTTACCAGCACAGCACTGG - Intronic
1178526590 21:33334896-33334918 ATACTTTCCCACCCCTGCAGTGG + Intronic
1178616287 21:34135915-34135937 ATACTTCTCCTTCACTGCAATGG + Intronic
1184017027 22:41794029-41794051 TTCTTTTAGCAGCACTGCAAGGG + Intronic
954481882 3:50806939-50806961 ATCCCCTACCACCACTGCAAAGG - Intronic
955919124 3:63936558-63936580 ATATATTTCCAGCACTTCAAAGG - Intronic
957269098 3:78005678-78005700 AGACTTGACCTGCACTGCACTGG + Intergenic
957608303 3:82432916-82432938 AAACTTTACCAACTCTGAAAAGG + Intergenic
962307506 3:134301406-134301428 ACACTTTACCGGCACTGCATGGG + Intergenic
963312930 3:143728517-143728539 ATACCTTACCACCACTGGCAAGG - Intronic
964610456 3:158609804-158609826 TTACTATACCAGCATTGCCATGG - Intergenic
964997997 3:162911550-162911572 GTACTATATCAGCCCTGCAATGG + Intergenic
965496885 3:169409707-169409729 TGACTTTAGCAGCACTTCAAAGG + Intronic
966141697 3:176764847-176764869 ATAACTTACCAGTACTCCAAAGG + Intergenic
968042618 3:195600660-195600682 ATCCTCTACCACCACTGCAGGGG + Intergenic
969688704 4:8691416-8691438 ACACTTTACCAGGACAGGAAGGG - Intergenic
971026234 4:22590841-22590863 ATACTTTTCCACCACAGCACAGG - Intergenic
975049830 4:69848571-69848593 ATAATTTTGCATCACTGCAAAGG - Intronic
975527217 4:75363761-75363783 ATACAAAACCAGAACTGCAAGGG + Intergenic
976709939 4:88059201-88059223 GTACTTTAACAGGACTGAAAAGG + Intronic
979723963 4:123938010-123938032 ATATTTGAGCAGCACTGTAAGGG + Intergenic
980460421 4:133103951-133103973 ATAATTTTCCAGCACTGGCAAGG + Intergenic
990072788 5:51805907-51805929 ATACTTCTCCAGCACGTCAAAGG + Intergenic
992949027 5:81838534-81838556 ATATTTTAAAACCACTGCAAGGG - Intergenic
996752448 5:126902559-126902581 ATCCTTTACCAGCAGTGGATGGG + Intronic
1001458634 5:171888343-171888365 AGACTGAACCAGCACAGCAAAGG + Intronic
1004830454 6:19472047-19472069 CTTCTGCACCAGCACTGCAAGGG + Intergenic
1006342945 6:33456576-33456598 ATACTTTTCCCTCACTGCCATGG + Exonic
1007790670 6:44306506-44306528 ATGCTTATCCAGAACTGCAAAGG - Exonic
1008203841 6:48628096-48628118 ATACTTTTCCTCCACTGCCATGG - Intergenic
1010734197 6:79424706-79424728 ATAATTTCTCAGCTCTGCAATGG + Intergenic
1011896584 6:92235121-92235143 ATACTGTAGCAGCACAGAAATGG + Intergenic
1013758524 6:113488756-113488778 CTACTTTCCCATCACTGGAATGG - Intergenic
1018478574 6:164167758-164167780 ATACTTCTCCAGCACTGCATGGG + Intergenic
1020601913 7:10286273-10286295 ATCATTTACCAGCACAGCACTGG - Intergenic
1022843384 7:34186574-34186596 ATAATAGTCCAGCACTGCAAAGG - Intergenic
1023136650 7:37059279-37059301 ACTCTTGACAAGCACTGCAAAGG - Intronic
1024786763 7:52916545-52916567 AAACTTTTCCAGCAATGCTAAGG + Intergenic
1026347505 7:69487251-69487273 TTATTGTACCAGCTCTGCAAAGG - Intergenic
1030253115 7:107471723-107471745 ATACTTTATCAGCACACAAAAGG + Exonic
1033041500 7:137923221-137923243 ATACTAATCTAGCACTGCAATGG + Intronic
1033915197 7:146315325-146315347 AACTTTTACCATCACTGCAAGGG - Intronic
1033955761 7:146845836-146845858 ATTTGTTACAAGCACTGCAATGG - Intronic
1037110237 8:15157132-15157154 ATACTTGAACAGCTCTGCTAAGG + Intronic
1038169391 8:25115141-25115163 ATAATTTACAAGCATTGCTAGGG - Intergenic
1043263454 8:78231204-78231226 CACCTTTACCAGCACTTCAAGGG + Intergenic
1046563311 8:115867041-115867063 TTATTTTGCCAGCACTGCAAAGG - Intergenic
1048722385 8:137340736-137340758 CTTCTTTACCAGCACTCAAAAGG + Intergenic
1050266984 9:3901493-3901515 ATACATTACCAGCACACCACTGG + Intronic
1050581238 9:7059546-7059568 ATACTTCACCAAAACTTCAATGG - Intronic
1052343326 9:27384129-27384151 AAACTTTGACAGCCCTGCAAGGG + Intronic
1055758364 9:79579768-79579790 ATATTTTAGCAGCACTCAAATGG - Intronic
1060306560 9:122418165-122418187 TTACTTTACCAAGACTGGAATGG - Intergenic
1061089048 9:128416414-128416436 CTACTTTGCCAGTCCTGCAAAGG + Intronic
1186713719 X:12228060-12228082 ACACTTTGGGAGCACTGCAATGG - Intronic
1190403151 X:50059785-50059807 ATGCTTTATCAGCACTTCCAAGG - Intronic
1190409790 X:50125161-50125183 CTACTTTACAAGCACTTAAAGGG - Intergenic
1190446494 X:50530560-50530582 ATACTTTACCAATACTGCACTGG + Intergenic
1195756558 X:108204602-108204624 ATTTTGTACCAGCACTGCAGAGG + Intronic
1196490658 X:116262026-116262048 ATACTTTATCAGGGGTGCAATGG + Intergenic
1196822089 X:119709711-119709733 ATACTATTGCAGCACTGCAAAGG - Intergenic
1197172888 X:123454106-123454128 ATACTTTAGCATCATTTCAAGGG - Intronic
1198134686 X:133736937-133736959 ATAATTTACCACTAATGCAATGG + Intronic
1198480067 X:137033097-137033119 TTAGTTTATCAGCAGTGCAATGG + Intergenic
1200777056 Y:7178920-7178942 ATACTTTGTCAGGACTCCAAGGG + Intergenic