ID: 1092522873

View in Genome Browser
Species Human (GRCh38)
Location 12:9291730-9291752
Sequence CTCAGCTCACTTTCAAATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092522868_1092522873 -4 Left 1092522868 12:9291711-9291733 CCATACCCTTAGGAACTTCCTCA No data
Right 1092522873 12:9291730-9291752 CTCAGCTCACTTTCAAATGGAGG No data
1092522869_1092522873 -9 Left 1092522869 12:9291716-9291738 CCCTTAGGAACTTCCTCAGCTCA No data
Right 1092522873 12:9291730-9291752 CTCAGCTCACTTTCAAATGGAGG No data
1092522866_1092522873 25 Left 1092522866 12:9291682-9291704 CCACGGTTGTTTTTGAAAGATAA No data
Right 1092522873 12:9291730-9291752 CTCAGCTCACTTTCAAATGGAGG No data
1092522870_1092522873 -10 Left 1092522870 12:9291717-9291739 CCTTAGGAACTTCCTCAGCTCAC No data
Right 1092522873 12:9291730-9291752 CTCAGCTCACTTTCAAATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092522873 Original CRISPR CTCAGCTCACTTTCAAATGG AGG Intergenic
No off target data available for this crispr