ID: 1092528424

View in Genome Browser
Species Human (GRCh38)
Location 12:9324992-9325014
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 3, 1: 3, 2: 5, 3: 9, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092528420_1092528424 28 Left 1092528420 12:9324941-9324963 CCATGTCTTCTTTTTGATGTCAT No data
Right 1092528424 12:9324992-9325014 GGAGCCAAACAGCTTCAAGCAGG 0: 3
1: 3
2: 5
3: 9
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092528424 Original CRISPR GGAGCCAAACAGCTTCAAGC AGG Intergenic
900311793 1:2036984-2037006 GCAGCCAAACAGACTCAGGCAGG - Intergenic
906632276 1:47381729-47381751 GGAGCCAAGCAGCTATAAGAAGG - Intergenic
911795937 1:102076423-102076445 GGCTCCAAACAGCTTCATGTAGG + Intergenic
912737369 1:112161799-112161821 GGATCTAAACAGATTCATGCAGG + Intergenic
913347350 1:117821485-117821507 GGAAGCACACAGCTTCAAGAAGG - Intergenic
913522564 1:119659672-119659694 TGTGCCAAAGAGCTTCAAACTGG - Intergenic
918216911 1:182399778-182399800 GGGCCCAGTCAGCTTCAAGCTGG + Exonic
919007400 1:191915426-191915448 GGAGTTCAACAGCTGCAAGCTGG + Intergenic
919847599 1:201651362-201651384 GGAGCCAAACAGGTCTGAGCTGG + Intronic
921840858 1:219827005-219827027 GGAGTCAGGCAGCTTCAAGCTGG - Intronic
922175953 1:223197833-223197855 TGAGGCCATCAGCTTCAAGCAGG + Intergenic
923092014 1:230747935-230747957 GGAGTCAGACAGCTTGGAGCCGG - Intronic
923604066 1:235427511-235427533 TGAGCCAATCAGGTTCAAGATGG + Intronic
1065626583 10:27635479-27635501 TGACCCAAACAGCTTCTACCAGG - Intergenic
1066681596 10:37940672-37940694 GAAGCCAAACAGCTTCAAGCAGG - Intergenic
1066802154 10:39204429-39204451 GAAGCCAAACAACTTCAAGCAGG + Intergenic
1067354899 10:45515022-45515044 GGAAACAAACTGCTTCAAGGAGG + Intronic
1068135732 10:52950109-52950131 GGAGCCAAACAGCTTCAAGCAGG + Intergenic
1068224379 10:54087799-54087821 TGAGCCAATCACCTTCCAGCAGG - Intronic
1069921706 10:71819524-71819546 GGAGAAAAACAGCACCAAGCAGG - Exonic
1075283162 10:121158758-121158780 GAATCCACACAGCTTCAAGAGGG - Intergenic
1076041948 10:127257657-127257679 GGAGAAAAACAGCCTGAAGCTGG + Intronic
1080271955 11:30459927-30459949 GGAGGCAAACAGCAGCAAGGAGG + Intronic
1081069308 11:38590242-38590264 GGAGCCAAATATTTTCAAGATGG + Intergenic
1083228022 11:61296696-61296718 GGGGCCACACAGCTTCAGGTAGG - Intergenic
1084912305 11:72400631-72400653 AGAGGGAAACAGCTACAAGCTGG + Intronic
1086337909 11:85817588-85817610 GTACCCAGTCAGCTTCAAGCAGG - Intergenic
1086950068 11:92882791-92882813 GGAGCCGAACACGTTCACGCAGG - Exonic
1087008228 11:93489518-93489540 GAGGCCACACAGCTTGAAGCAGG + Intronic
1089444928 11:118544283-118544305 GGAGCCAGACAGCCTCAGGAAGG + Intronic
1089841920 11:121426007-121426029 GGATCCAAACACCTCCCAGCAGG + Intergenic
1091224258 11:133948280-133948302 GGAGCCAATCAGCTTCTGGAAGG - Intronic
1092528424 12:9324992-9325014 GGAGCCAAACAGCTTCAAGCAGG + Intergenic
1094058125 12:26286722-26286744 GGAGCCCCACACCTTCCAGCAGG + Intronic
1095940275 12:47722319-47722341 GGCGCCAAACTGCTTGAGGCTGG + Intronic
1096850463 12:54432416-54432438 GGGGCCAAAGAGCTGGAAGCTGG + Intergenic
1098530510 12:71536569-71536591 GAAGCAAAACAGCCTCAAGTTGG + Intronic
1101332178 12:103766065-103766087 TGGGCCACCCAGCTTCAAGCAGG + Intronic
1104241909 12:126998236-126998258 GAAGCAAAACAGCTTTAATCAGG - Intergenic
1104385953 12:128351773-128351795 GGATCCAAACACCTCCTAGCAGG + Intronic
1106292693 13:28379730-28379752 TGAGCCAAAGGGCATCAAGCAGG - Intronic
1108461247 13:50669699-50669721 GGAGCCAAACACCTTCCATTAGG - Intronic
1109282133 13:60369016-60369038 AAAGCCAAACAACTTGAAGCTGG - Intergenic
1111415592 13:87939716-87939738 GGAGCCAAACACCTCCCACCAGG - Intergenic
1114229751 14:20769827-20769849 GGAGCCAATCACCCTCCAGCTGG - Intronic
1115806272 14:37055525-37055547 GGAGCCTTACAGCTTCAACCTGG + Intronic
1118823784 14:69362386-69362408 GGAGCCCCACAGCTTCCACCAGG + Intergenic
1123153036 14:106200845-106200867 GGAGCCACACAGCTTCAAGCAGG + Intergenic
1130030343 15:80308246-80308268 GTAGCCAGGCTGCTTCAAGCGGG - Intergenic
1130034638 15:80346606-80346628 GAAGCTTAACAGCTCCAAGCAGG - Intronic
1135056582 16:19237172-19237194 GGAACCAAGCAGCTTTAAGTTGG - Intronic
1135683801 16:24481326-24481348 AGAGCCAATGAGCTTCAAGGGGG + Intergenic
1135715290 16:24759594-24759616 GGAGCCACAGGGCTTCATGCTGG + Intronic
1136555077 16:31002849-31002871 GGATCCAAACAGCATCCACCTGG + Intronic
1144328017 17:14200193-14200215 GGAGACAAAAATCCTCAAGCTGG - Intronic
1146276040 17:31516327-31516349 GAAGCCAAACGGCTTCTAGAAGG - Intronic
1146744257 17:35313993-35314015 GGAGCCAAAAAGCTTGTTGCTGG + Intergenic
1151536479 17:74741751-74741773 GGGGCTCTACAGCTTCAAGCAGG + Intronic
1154412829 18:14150582-14150604 AGAGCCAGACAGCTCCCAGCAGG + Intergenic
1157777328 18:50405978-50406000 GTAGGCAAACAGCTTCAAGCAGG - Intergenic
1158154548 18:54410679-54410701 GAAGCCATACAGCTGAAAGCAGG - Intergenic
1162118456 19:8445943-8445965 GGAGTCAAAGAGCCCCAAGCAGG - Intronic
1162329900 19:10021386-10021408 GGAGCAAAACAGCTTCCTGGAGG - Exonic
1163928656 19:20368125-20368147 GGAGCCATACGGCTTCAAGCAGG - Intergenic
1164063049 19:21691910-21691932 GAAGCCAAACAGCTTCAAGCAGG + Intergenic
925307548 2:2861072-2861094 TGAGCCAGGCAGCCTCAAGCAGG + Intergenic
929557185 2:42932825-42932847 GGAGCCAAAGAGCTGAAAGGAGG - Intergenic
929888316 2:45898363-45898385 GAAGACAGACAGCTTCCAGCAGG - Intronic
931067130 2:58599588-58599610 GGAGCCATACATCTCCCAGCAGG - Intergenic
931793569 2:65688264-65688286 GGTGTGAAACAGCCTCAAGCAGG + Intergenic
932601106 2:73126485-73126507 GGAGCCAACCAGAAACAAGCTGG + Intronic
933700433 2:85251553-85251575 AGAGGTAAACAGCCTCAAGCGGG - Intronic
934608326 2:95714643-95714665 TGAGCCAAACCCCTTCAAGTAGG - Intergenic
936434133 2:112488459-112488481 GCAGAGAAACAGCTGCAAGCCGG + Intronic
936541656 2:113356529-113356551 TGAGCCAAACCCCTTCAAGTAGG - Intergenic
936905842 2:117534757-117534779 TGAGCCAAACACCTTCCACCAGG - Intergenic
938707080 2:133941505-133941527 GGAGCCATACAGTGTCAAGAAGG + Intergenic
944944269 2:204665301-204665323 GGAGCCAAACAGCTTGAGGGTGG - Intronic
1172624791 20:36340792-36340814 GGAGCCAAAGAGCTTGATGCAGG + Intronic
1176860179 21:14007673-14007695 AGAGCCAGACAGCTCCCAGCAGG - Intergenic
1177223547 21:18223978-18224000 GGAGGGAAATAGCTTCAATCAGG + Intronic
1177258722 21:18700557-18700579 TGAGCCAATCACCTTCAACCAGG - Intergenic
1180712933 22:17852088-17852110 GCAGCCACACAGCCTCAGGCAGG + Intronic
1182457374 22:30460502-30460524 GGAGGCAAACAGTGTCCAGCAGG - Intronic
1182799860 22:33023176-33023198 GGAGCCAAACCGTATCAGGCAGG - Intronic
1183119335 22:35718194-35718216 GCTGCCACACTGCTTCAAGCAGG - Intronic
1183412712 22:37664867-37664889 GGAGACAAAAAGCTGCAGGCTGG - Intronic
1183829727 22:40411378-40411400 TGAGCCAGAGAGCTACAAGCAGG + Exonic
950467043 3:13161827-13161849 CGAGCCACACAGCTCCCAGCAGG - Intergenic
951516453 3:23565291-23565313 GGAGGCAACCAGATGCAAGCCGG + Intronic
952251819 3:31663385-31663407 GGAGCCACACGTCTTAAAGCAGG - Intronic
953050202 3:39334761-39334783 GGTGCCAAACAACCACAAGCTGG + Intergenic
956592784 3:70932945-70932967 GGAGCCAACCATCTCCCAGCAGG - Intergenic
959063860 3:101638289-101638311 GGAGCCAAATGGCTTCAAGCAGG - Intergenic
959186420 3:103052675-103052697 GGAGCCCAACTGCTTCAAGGAGG + Intergenic
964022114 3:152025060-152025082 TGAGCCAAACACCTTCCACCAGG - Intergenic
966308725 3:178569275-178569297 GGGGCCAATCAGATTTAAGCAGG - Intronic
969240100 4:5892083-5892105 GCGGCCACACAGCTTAAAGCTGG - Intronic
973538231 4:51906267-51906289 GCAGCCACACAGGTTCAAGCTGG + Intronic
976516211 4:85970227-85970249 GGAGAAAAACAGCCTCAAGTGGG - Intronic
976847834 4:89510589-89510611 TGAGCCAAACATCTTCAACCAGG - Intergenic
984934984 4:184882066-184882088 GGAGCCAAACACCTCCCACCAGG - Intergenic
986337822 5:6768121-6768143 TGAGCCAAACACCTCCCAGCAGG - Intergenic
987212680 5:15699391-15699413 GGAGCAATGCAGCTGCAAGCTGG - Intronic
990053078 5:51532228-51532250 GGAGCTAAACAGTTTTAAACTGG + Intergenic
992880086 5:81099429-81099451 GGTGCTAAACATCTTCATGCGGG + Intronic
995422027 5:111978435-111978457 GGAGTCATAGAGCTTCAAACTGG + Intronic
996873549 5:128217205-128217227 GGAGCCAAGCAGCTTGACTCAGG + Intergenic
997911546 5:137878935-137878957 GGAGCCAAAGAGATTAAACCAGG + Intronic
1002424244 5:179166281-179166303 GGAGCCAAACAGGCTGAACCCGG - Intronic
1002515548 5:179755856-179755878 GGAGGAAAACTGCTTCAACCTGG - Intronic
1002795039 6:465345-465367 GGATCCCATCAGCTTCCAGCTGG - Intergenic
1004081066 6:12393855-12393877 GTGGCCAAAAAGCTTCAAGAGGG + Intergenic
1005738416 6:28769952-28769974 GGAGCCATACGGCTTCAAGCAGG + Intergenic
1007387864 6:41531613-41531635 AGAGCCAGACAGCTTGAGGCTGG - Intergenic
1007660271 6:43480381-43480403 GTAGCCTCACAGCTTCAAACAGG - Intronic
1007838913 6:44699513-44699535 GGAGCCAAACAGCACTAAACAGG - Intergenic
1009319539 6:62270144-62270166 GGATCCAAACACCTCCCAGCAGG - Intronic
1011356568 6:86477908-86477930 GGAGCCACATGGCTTCAAGCAGG - Intergenic
1012809277 6:103937448-103937470 GGACCCAAACAGCTCCCACCAGG + Intergenic
1013556235 6:111259693-111259715 GGAGGCACACAGCATCAAGGTGG - Exonic
1017536109 6:155349472-155349494 GTAGCCAGACTGCTTTAAGCAGG - Intergenic
1017545595 6:155448190-155448212 GGAGCCACACAGCTGGAAGGGGG - Intronic
1018526939 6:164722954-164722976 GCAGCCAAACAGCCTCATGATGG - Intergenic
1021981852 7:26063090-26063112 GAAGCTAAACTGCCTCAAGCTGG - Intergenic
1022399918 7:30027250-30027272 GGGGCCAAACAACCTTAAGCAGG - Intergenic
1022565224 7:31392697-31392719 GAAGCCACACAGCCTCAAGGGGG - Intergenic
1023909344 7:44542308-44542330 GGAGCCACCCAGCCTCATGCAGG + Intergenic
1024074089 7:45809993-45810015 GGAGCAAAACTGCCTCAAGTCGG + Intergenic
1026304346 7:69127072-69127094 GGAGCCAAACTCCATCCAGCAGG - Intergenic
1026646624 7:72176423-72176445 TGACCCAAACACCTCCAAGCAGG - Intronic
1031308726 7:120166690-120166712 TGAGCCAAACACCTTCCATCAGG + Intergenic
1032721518 7:134554135-134554157 GGAGCCAAACAGCTTCAAGCAGG - Intronic
1034412542 7:150948800-150948822 GCAGCCACACAGCTGGAAGCAGG + Intronic
1035528236 8:331621-331643 GGAGCCAAACAGCGCTGAGCAGG - Intergenic
1035913287 8:3593089-3593111 GTAGCCAGACCGCTTTAAGCAGG - Intronic
1036020553 8:4840270-4840292 GTAGCAAAACATCTTAAAGCAGG - Intronic
1036731857 8:11272652-11272674 GGATCTAATCATCTTCAAGCTGG + Intergenic
1036996966 8:13668984-13669006 GGAGCCAAATCATTTCAAGCAGG - Intergenic
1037644761 8:20783275-20783297 GGAGACACACAGCACCAAGCAGG - Intergenic
1046528607 8:115414535-115414557 GCAGCCAATCAGCTTCACTCTGG + Exonic
1046832458 8:118761527-118761549 GGAGCCACCCAGCTGAAAGCTGG - Intergenic
1046986917 8:120398141-120398163 GCAGCCAGACTGCTTTAAGCAGG + Intronic
1048063073 8:130940440-130940462 GGATCCAAAGAGTTTCAAGGAGG - Intronic
1051743117 9:20270194-20270216 TGACCCAAACAGCTTCCACCAGG + Intergenic
1053272902 9:36762525-36762547 GCAGGTAAACAGCTTGAAGCTGG + Intergenic
1055320673 9:75080683-75080705 TGAGCCAAACACCTGCCAGCAGG - Intronic
1058930834 9:109717204-109717226 GGAGTCCAAGAGCTTTAAGCTGG - Intronic
1186593297 X:10953598-10953620 GCAGCCAGACTGCTTCAAGTGGG + Intergenic
1188762615 X:34051092-34051114 GGAGCCAAAAATCTTCAAACAGG - Intergenic
1192397083 X:70793398-70793420 TGATCCAAACATCTTCCAGCAGG - Intronic
1200057259 X:153468212-153468234 GGAGCCAACCTGCATCCAGCCGG - Intronic
1200846613 Y:7837205-7837227 GGAACCACATGGCTTCAAGCAGG - Intergenic
1202337898 Y:23829816-23829838 GGAGCCATAGGGCTCCAAGCAGG - Intergenic
1202532868 Y:25840255-25840277 GGAGCCATAGGGCTCCAAGCAGG + Intergenic