ID: 1092531936

View in Genome Browser
Species Human (GRCh38)
Location 12:9352142-9352164
Sequence CTGTAGAAGGAGAGGCTGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092531936_1092531943 -10 Left 1092531936 12:9352142-9352164 CCCGGCAGCCTCTCCTTCTACAG No data
Right 1092531943 12:9352155-9352177 CCTTCTACAGCTGTGGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092531936 Original CRISPR CTGTAGAAGGAGAGGCTGCC GGG (reversed) Intergenic
No off target data available for this crispr