ID: 1092535139

View in Genome Browser
Species Human (GRCh38)
Location 12:9379888-9379910
Sequence TACAGCTCATGGCCTGGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092535133_1092535139 6 Left 1092535133 12:9379859-9379881 CCAGGCACTGTGATGAGTTCCTT No data
Right 1092535139 12:9379888-9379910 TACAGCTCATGGCCTGGTACAGG No data
1092535130_1092535139 16 Left 1092535130 12:9379849-9379871 CCTTCCCGGGCCAGGCACTGTGA No data
Right 1092535139 12:9379888-9379910 TACAGCTCATGGCCTGGTACAGG No data
1092535131_1092535139 12 Left 1092535131 12:9379853-9379875 CCCGGGCCAGGCACTGTGATGAG No data
Right 1092535139 12:9379888-9379910 TACAGCTCATGGCCTGGTACAGG No data
1092535132_1092535139 11 Left 1092535132 12:9379854-9379876 CCGGGCCAGGCACTGTGATGAGT No data
Right 1092535139 12:9379888-9379910 TACAGCTCATGGCCTGGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092535139 Original CRISPR TACAGCTCATGGCCTGGTAC AGG Intergenic
No off target data available for this crispr