ID: 1092544415

View in Genome Browser
Species Human (GRCh38)
Location 12:9440167-9440189
Sequence CTCAGCTCACTTTCAAATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092544415_1092544418 -10 Left 1092544415 12:9440167-9440189 CCTCCATTTGAAAGTGAGCTGAG No data
Right 1092544418 12:9440180-9440202 GTGAGCTGAGGAAGTTCCTAAGG No data
1092544415_1092544422 25 Left 1092544415 12:9440167-9440189 CCTCCATTTGAAAGTGAGCTGAG No data
Right 1092544422 12:9440215-9440237 TTATCTTTCAAAAACAACCGTGG No data
1092544415_1092544420 -4 Left 1092544415 12:9440167-9440189 CCTCCATTTGAAAGTGAGCTGAG No data
Right 1092544420 12:9440186-9440208 TGAGGAAGTTCCTAAGGGTATGG No data
1092544415_1092544419 -9 Left 1092544415 12:9440167-9440189 CCTCCATTTGAAAGTGAGCTGAG No data
Right 1092544419 12:9440181-9440203 TGAGCTGAGGAAGTTCCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092544415 Original CRISPR CTCAGCTCACTTTCAAATGG AGG (reversed) Intergenic
No off target data available for this crispr