ID: 1092550019

View in Genome Browser
Species Human (GRCh38)
Location 12:9487882-9487904
Sequence CAATATCTGGAAAAATTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092550019_1092550029 28 Left 1092550019 12:9487882-9487904 CCTTCCAATTTTTCCAGATATTG No data
Right 1092550029 12:9487933-9487955 GGGAAGTGTTGCTACCCATTAGG No data
1092550019_1092550027 7 Left 1092550019 12:9487882-9487904 CCTTCCAATTTTTCCAGATATTG No data
Right 1092550027 12:9487912-9487934 TTTACACAGGGATGGTAAAGGGG No data
1092550019_1092550023 -5 Left 1092550019 12:9487882-9487904 CCTTCCAATTTTTCCAGATATTG No data
Right 1092550023 12:9487900-9487922 TATTGTTCTTTATTTACACAGGG No data
1092550019_1092550030 29 Left 1092550019 12:9487882-9487904 CCTTCCAATTTTTCCAGATATTG No data
Right 1092550030 12:9487934-9487956 GGAAGTGTTGCTACCCATTAGGG No data
1092550019_1092550025 5 Left 1092550019 12:9487882-9487904 CCTTCCAATTTTTCCAGATATTG No data
Right 1092550025 12:9487910-9487932 TATTTACACAGGGATGGTAAAGG No data
1092550019_1092550028 8 Left 1092550019 12:9487882-9487904 CCTTCCAATTTTTCCAGATATTG No data
Right 1092550028 12:9487913-9487935 TTACACAGGGATGGTAAAGGGGG No data
1092550019_1092550022 -6 Left 1092550019 12:9487882-9487904 CCTTCCAATTTTTCCAGATATTG No data
Right 1092550022 12:9487899-9487921 ATATTGTTCTTTATTTACACAGG No data
1092550019_1092550024 -1 Left 1092550019 12:9487882-9487904 CCTTCCAATTTTTCCAGATATTG No data
Right 1092550024 12:9487904-9487926 GTTCTTTATTTACACAGGGATGG No data
1092550019_1092550026 6 Left 1092550019 12:9487882-9487904 CCTTCCAATTTTTCCAGATATTG No data
Right 1092550026 12:9487911-9487933 ATTTACACAGGGATGGTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092550019 Original CRISPR CAATATCTGGAAAAATTGGA AGG (reversed) Intergenic
No off target data available for this crispr