ID: 1092552268

View in Genome Browser
Species Human (GRCh38)
Location 12:9515629-9515651
Sequence AGAATGATGCAAAATGAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092552268_1092552271 10 Left 1092552268 12:9515629-9515651 CCCGCTTCATTTTGCATCATTCT No data
Right 1092552271 12:9515662-9515684 CTTCTTCATTGCAGACACAGAGG No data
1092552268_1092552273 26 Left 1092552268 12:9515629-9515651 CCCGCTTCATTTTGCATCATTCT No data
Right 1092552273 12:9515678-9515700 ACAGAGGGCTTTCATTTTCTTGG No data
1092552268_1092552272 11 Left 1092552268 12:9515629-9515651 CCCGCTTCATTTTGCATCATTCT No data
Right 1092552272 12:9515663-9515685 TTCTTCATTGCAGACACAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092552268 Original CRISPR AGAATGATGCAAAATGAAGC GGG (reversed) Intergenic
No off target data available for this crispr