ID: 1092552270

View in Genome Browser
Species Human (GRCh38)
Location 12:9515661-9515683
Sequence CTCTGTGTCTGCAATGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092552270_1092552274 15 Left 1092552270 12:9515661-9515683 CCTTCTTCATTGCAGACACAGAG No data
Right 1092552274 12:9515699-9515721 GGACAAGCCATGTGCTTTTCTGG No data
1092552270_1092552273 -6 Left 1092552270 12:9515661-9515683 CCTTCTTCATTGCAGACACAGAG No data
Right 1092552273 12:9515678-9515700 ACAGAGGGCTTTCATTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092552270 Original CRISPR CTCTGTGTCTGCAATGAAGA AGG (reversed) Intergenic
No off target data available for this crispr