ID: 1092552272

View in Genome Browser
Species Human (GRCh38)
Location 12:9515663-9515685
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092552269_1092552272 10 Left 1092552269 12:9515630-9515652 CCGCTTCATTTTGCATCATTCTA No data
Right 1092552272 12:9515663-9515685 TTCTTCATTGCAGACACAGAGGG No data
1092552268_1092552272 11 Left 1092552268 12:9515629-9515651 CCCGCTTCATTTTGCATCATTCT No data
Right 1092552272 12:9515663-9515685 TTCTTCATTGCAGACACAGAGGG No data
1092552267_1092552272 24 Left 1092552267 12:9515616-9515638 CCTGTGAAGCTCGCCCGCTTCAT No data
Right 1092552272 12:9515663-9515685 TTCTTCATTGCAGACACAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092552272 Original CRISPR TTCTTCATTGCAGACACAGA GGG Intergenic
No off target data available for this crispr