ID: 1092552273

View in Genome Browser
Species Human (GRCh38)
Location 12:9515678-9515700
Sequence ACAGAGGGCTTTCATTTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092552270_1092552273 -6 Left 1092552270 12:9515661-9515683 CCTTCTTCATTGCAGACACAGAG No data
Right 1092552273 12:9515678-9515700 ACAGAGGGCTTTCATTTTCTTGG No data
1092552269_1092552273 25 Left 1092552269 12:9515630-9515652 CCGCTTCATTTTGCATCATTCTA No data
Right 1092552273 12:9515678-9515700 ACAGAGGGCTTTCATTTTCTTGG No data
1092552268_1092552273 26 Left 1092552268 12:9515629-9515651 CCCGCTTCATTTTGCATCATTCT No data
Right 1092552273 12:9515678-9515700 ACAGAGGGCTTTCATTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092552273 Original CRISPR ACAGAGGGCTTTCATTTTCT TGG Intergenic
No off target data available for this crispr