ID: 1092552274

View in Genome Browser
Species Human (GRCh38)
Location 12:9515699-9515721
Sequence GGACAAGCCATGTGCTTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092552270_1092552274 15 Left 1092552270 12:9515661-9515683 CCTTCTTCATTGCAGACACAGAG No data
Right 1092552274 12:9515699-9515721 GGACAAGCCATGTGCTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092552274 Original CRISPR GGACAAGCCATGTGCTTTTC TGG Intergenic
No off target data available for this crispr