ID: 1092556225

View in Genome Browser
Species Human (GRCh38)
Location 12:9564991-9565013
Sequence AATTCAGCACAAACAGAGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092556218_1092556225 30 Left 1092556218 12:9564938-9564960 CCACATTTTGAGGTACTTGGTGT No data
Right 1092556225 12:9564991-9565013 AATTCAGCACAAACAGAGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092556225 Original CRISPR AATTCAGCACAAACAGAGGT CGG Intergenic
No off target data available for this crispr