ID: 1092558921

View in Genome Browser
Species Human (GRCh38)
Location 12:9588871-9588893
Sequence ATCCCAGGCTGTTCACATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092558921_1092558926 5 Left 1092558921 12:9588871-9588893 CCACCATGTGAACAGCCTGGGAT No data
Right 1092558926 12:9588899-9588921 GATGGAGAATTAGAAACACATGG No data
1092558921_1092558927 22 Left 1092558921 12:9588871-9588893 CCACCATGTGAACAGCCTGGGAT No data
Right 1092558927 12:9588916-9588938 ACATGGATCTAGCAGCCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092558921 Original CRISPR ATCCCAGGCTGTTCACATGG TGG (reversed) Intergenic
No off target data available for this crispr