ID: 1092559267

View in Genome Browser
Species Human (GRCh38)
Location 12:9593208-9593230
Sequence AAGGCACATTTCCATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 197}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092559267_1092559270 -5 Left 1092559267 12:9593208-9593230 CCTTCCTCATGGAAATGTGCCTT 0: 1
1: 0
2: 0
3: 26
4: 197
Right 1092559270 12:9593226-9593248 GCCTTCATGGTTTGAGATTCAGG 0: 1
1: 0
2: 1
3: 6
4: 119
1092559267_1092559272 -4 Left 1092559267 12:9593208-9593230 CCTTCCTCATGGAAATGTGCCTT 0: 1
1: 0
2: 0
3: 26
4: 197
Right 1092559272 12:9593227-9593249 CCTTCATGGTTTGAGATTCAGGG 0: 1
1: 0
2: 1
3: 8
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092559267 Original CRISPR AAGGCACATTTCCATGAGGA AGG (reversed) Intergenic
901826912 1:11868077-11868099 AAGGCACAGTATCAAGAGGAGGG - Intergenic
905475310 1:38222425-38222447 ATGGCTCATTTTCAGGAGGATGG + Intergenic
908183241 1:61626802-61626824 AAGCCAGATATCCATGAGGAAGG + Intergenic
913090557 1:115473933-115473955 AAGGCAGGCTTCCTTGAGGAGGG + Intergenic
919583875 1:199411091-199411113 AAGGTAAATTCCCTTGAGGAAGG - Intergenic
923513150 1:234670827-234670849 TTTGCACATTTCCATGAGGTAGG - Intergenic
923969968 1:239189389-239189411 GAGGCATATCTCCTTGAGGAAGG - Intergenic
924722973 1:246639938-246639960 AAGACACGTATCCCTGAGGATGG - Intronic
1063116591 10:3076177-3076199 AAAGCACATCTCCATGTGGACGG + Intronic
1063141214 10:3258005-3258027 CAGACACATTTCCAGGTGGAGGG + Intergenic
1063463278 10:6227877-6227899 ACTGCACATTTCCATCAGAACGG - Intronic
1064162227 10:12956485-12956507 TTGGCACAATACCATGAGGAGGG - Intronic
1066013921 10:31218669-31218691 AAGGCACATTTTCAACAGGGAGG + Intergenic
1068822247 10:61390469-61390491 AAGTCACATTTCCATGAACTTGG - Intergenic
1068879083 10:62029674-62029696 AACACAAATGTCCATGAGGATGG - Intronic
1069835271 10:71304188-71304210 AAGGGACAGCTTCATGAGGATGG + Intergenic
1074939433 10:118220007-118220029 AAATCAGATTTCCAGGAGGAAGG + Intergenic
1075277527 10:121107867-121107889 AAGGCCCATTTTCATGAGAAAGG - Intergenic
1075981985 10:126748097-126748119 AATGCAGATTTCTATGGGGAAGG + Intergenic
1076119949 10:127927608-127927630 AAGGCTCCTCTCCATGAGGAGGG - Intronic
1076240320 10:128900277-128900299 CAGGCACATTTCATAGAGGAAGG - Intergenic
1076838419 10:133032736-133032758 TAGCCACATTCCCATGAGGAGGG - Intergenic
1080463592 11:32476721-32476743 AAGGATCAGTTCCATGAAGAAGG + Intergenic
1080746735 11:35115154-35115176 AAGGGGCATGTCCATTAGGACGG - Intergenic
1081057898 11:38432936-38432958 TAGACACATCTCTATGAGGATGG + Intergenic
1085785167 11:79441785-79441807 CAAGCACATTTCCAAGAGAAGGG + Intergenic
1086954070 11:92917407-92917429 AGAGCACATAGCCATGAGGATGG + Intergenic
1090451129 11:126807318-126807340 TGGGCACATTTCCATGTGGTGGG + Intronic
1090453974 11:126831267-126831289 AAGGTAATGTTCCATGAGGACGG + Intronic
1090462824 11:126907157-126907179 AAGGGACATTTCCAAATGGAAGG - Intronic
1090568589 11:128022592-128022614 AAGGCACATTCACATTATGAAGG - Intergenic
1090702336 11:129308085-129308107 AATGGACTTGTCCATGAGGAAGG + Intergenic
1090753809 11:129771030-129771052 AAGGGATATTTCCATTAGGAAGG - Intergenic
1091105069 11:132910741-132910763 AAAGCTCATTTTCATGATGATGG + Intronic
1091672560 12:2462699-2462721 AAGGCACATGTCCAGGAAGCTGG - Intronic
1092559267 12:9593208-9593230 AAGGCACATTTCCATGAGGAAGG - Intergenic
1103310816 12:120006170-120006192 CAGGCACCATTCCATGATGACGG - Intronic
1103727516 12:123005401-123005423 ATGGCCCAGTTCAATGAGGATGG - Exonic
1104110239 12:125697874-125697896 CAGGCTCATGACCATGAGGAGGG + Intergenic
1104208125 12:126660515-126660537 ACGCCACATTTCCTTGTGGATGG + Intergenic
1104986694 12:132601382-132601404 ATGGCTCACTTCCATGGGGACGG + Intergenic
1107800371 13:44101591-44101613 AAGGAACATTTCCAAGTGGCTGG + Intergenic
1108795416 13:54024208-54024230 CAGGCACTTTTCTATGAGGTGGG - Intergenic
1109451560 13:62521158-62521180 AAGGCCCATTCCCATAGGGAGGG + Intergenic
1110402944 13:75115573-75115595 AGGGGACATCTCCCTGAGGAAGG + Intergenic
1111116222 13:83780741-83780763 AAGTCCCATTTTCATGAAGATGG - Intergenic
1111872258 13:93847656-93847678 AATGCTTATCTCCATGAGGAAGG + Intronic
1112847414 13:103661118-103661140 AAGGCCCAAGTTCATGAGGAAGG - Intergenic
1113578782 13:111413788-111413810 GAGGAACAGTTCCATGGGGAGGG + Intergenic
1114523011 14:23350652-23350674 GGGGCATTTTTCCATGAGGATGG + Intronic
1114568229 14:23647807-23647829 GTGGCCCAATTCCATGAGGAAGG - Intergenic
1114743201 14:25119304-25119326 AAGGAACATTTCCAAGTGAAAGG - Intergenic
1115822177 14:37224416-37224438 AACTCACAGTTCCATGAGGATGG + Intronic
1116050242 14:39794112-39794134 AAGCCACAGTTCCATGTGGCTGG + Intergenic
1116629985 14:47318440-47318462 AAGGAATGTGTCCATGAGGAGGG - Intronic
1117610078 14:57474037-57474059 AGGGAAAGTTTCCATGAGGAAGG - Intronic
1117610796 14:57481059-57481081 AAGGCTCATTTCCTAGAGGGAGG + Intronic
1118053383 14:62053276-62053298 AAGGCTCATGTCCTTGAGAAAGG - Intronic
1118496334 14:66311476-66311498 TAGGCACATTTATATGTGGAGGG + Intergenic
1121426609 14:93856698-93856720 GAGTCTCATTTCCCTGAGGAGGG + Intergenic
1121755800 14:96401072-96401094 AAGGCACATGGCTATGAGAATGG - Intronic
1122653982 14:103244695-103244717 AAGGCTCATTCCCATGGGGGGGG + Intergenic
1124088900 15:26579233-26579255 AGGGCACACCTCCCTGAGGAGGG - Intronic
1124377756 15:29139566-29139588 AAGGCACCATTCCACCAGGAAGG + Intronic
1125175054 15:36811529-36811551 AGGGTACATGTCCATGTGGAGGG - Intergenic
1126232945 15:46348675-46348697 GAGGCACACTTACATGAGTATGG + Intergenic
1128774790 15:70311926-70311948 AAGGCACAAAGCCATAAGGATGG - Intergenic
1129908221 15:79204879-79204901 AAGGCACATTTCTTTGAAGTTGG - Intergenic
1133045925 16:3088271-3088293 AAAGGACATTTCAAGGAGGAGGG - Intergenic
1133367628 16:5223540-5223562 ACCGCACAATTCCATTAGGAAGG + Intergenic
1136547101 16:30961343-30961365 ACGGCACATATCCTTCAGGAAGG - Exonic
1141477442 16:84283354-84283376 AGGGAACATTTCCAGGAGAAAGG + Intergenic
1143935350 17:10478474-10478496 AAGGCACAATCCCAAGTGGAAGG + Intergenic
1144321071 17:14120467-14120489 AGGGCATATTTCAAGGAGGAAGG + Intronic
1144735376 17:17552652-17552674 CAAGCACATTTCCATGAGAGGGG - Intronic
1146513078 17:33467421-33467443 AATGCCCTTTTCCAAGAGGAGGG - Intronic
1148619535 17:49023900-49023922 AAGGTAGTTTTCCCTGAGGAAGG - Intronic
1150825320 17:68469451-68469473 AAAACAAAGTTCCATGAGGATGG + Intergenic
1151205733 17:72505412-72505434 GAGGCACAATTCCATGTGGCTGG + Intergenic
1151271650 17:73001078-73001100 AACTCAAATGTCCATGAGGAGGG - Intronic
1151563101 17:74881280-74881302 AAGGCTCAGATCCATCAGGAGGG + Intronic
1153064075 18:1025194-1025216 AAGGCACATTTCTATTAGGTAGG - Intergenic
1156507331 18:37606281-37606303 AAGGCACATCTGGATGAGAAGGG - Intergenic
1157437268 18:47681398-47681420 AAGGCACATTACAAAGAGGTTGG + Intergenic
1158332818 18:56381365-56381387 AAGGCACTATTGCATGAGAAAGG + Intergenic
1159011408 18:63062179-63062201 CAAGAACATTTGCATGAGGAAGG + Intergenic
1159108979 18:64034509-64034531 AAGGACAATTTCCATGTGGATGG - Intergenic
1160376810 18:78420014-78420036 AGGGGACAGTTGCATGAGGAGGG - Intergenic
1165223110 19:34333791-34333813 GAGGCACGTTACCATGTGGATGG - Exonic
1166246433 19:41530403-41530425 AAGGCACATTTCCTGATGGAAGG - Intergenic
925716797 2:6791564-6791586 AAGGCAAGCTTCCAGGAGGATGG + Intergenic
925921183 2:8639053-8639075 AGGGCCCAGTTCCAGGAGGAAGG + Intergenic
926780425 2:16466154-16466176 AAGGCACATTCTGCTGAGGAAGG - Intergenic
927314420 2:21665420-21665442 AATGCAGATTTACATGGGGACGG - Intergenic
928290685 2:30034572-30034594 ACGGCAAAGTGCCATGAGGATGG - Intergenic
928465179 2:31516678-31516700 AAGGAACATTTGCATAAAGATGG - Intergenic
930604138 2:53475124-53475146 GATGCCCATTTCCAGGAGGAGGG + Intergenic
933340023 2:81012361-81012383 AAGTGAGATTTCCATGAAGAAGG - Intergenic
933876342 2:86624287-86624309 AAGCCACATTCTCATGAAGAGGG - Intronic
935722365 2:105990689-105990711 GAGGCAGATTCACATGAGGAAGG + Intergenic
937695599 2:124805118-124805140 AAGGGACATTACCCTGAAGAAGG + Intronic
938775847 2:134540523-134540545 AAGATGCATTTCCAGGAGGAAGG + Intronic
939096521 2:137839000-137839022 GGAGCACAGTTCCATGAGGAGGG - Intergenic
940089034 2:149895622-149895644 GAGGCACAGTTCAAAGAGGACGG - Intergenic
941052345 2:160749088-160749110 TAGGCATATTTGAATGAGGATGG - Intergenic
945249606 2:207753151-207753173 AAAGCACATTTTAATGAGGCAGG - Intronic
945321423 2:208428407-208428429 AATCCACATTTCCATGTGGAGGG + Intronic
945767192 2:213995728-213995750 AAGGCACATTACCATGAAGCTGG - Intronic
948409729 2:237749756-237749778 AAGGCACATTACAAAGAGAAAGG - Intronic
948534755 2:238637587-238637609 CAGGCACATCTCCTGGAGGATGG - Intergenic
1173049778 20:39548191-39548213 CAGGCACATTTCCAGGCTGATGG + Intergenic
1173179655 20:40795905-40795927 AAGGTACAGTTCCCTGTGGAAGG + Intergenic
1174731644 20:52923776-52923798 AAGGCACATTTCCTAGACAACGG + Intergenic
1176218610 20:63959615-63959637 CAGACACATTCCCATGAGGAGGG + Exonic
1176692639 21:9934496-9934518 AAGAGAAATTTCCAGGAGGAGGG - Intergenic
1178145711 21:29737276-29737298 TAGGCTCATTTCCCAGAGGATGG + Intronic
1180873502 22:19162059-19162081 AAGTCTCCTTCCCATGAGGAAGG - Intergenic
1181977604 22:26742034-26742056 CAGGCAAATTGCCATGAGGAGGG - Intergenic
949416250 3:3817528-3817550 AAGGAACATTTTAATGTGGAAGG + Intronic
951366797 3:21792956-21792978 TAGGCACATTTTCCTGAGGAGGG - Intronic
951911108 3:27751634-27751656 CAGGCCCATGTCCATGAGGCAGG + Intergenic
952802861 3:37313296-37313318 AAGGCAAATTGCCAAGAGAAGGG - Intronic
955143576 3:56293535-56293557 AAGGATCATTCCCATGAGAAGGG - Intronic
955930243 3:64048961-64048983 TATGCACAGTTCCAAGAGGAGGG - Intergenic
956910514 3:73811598-73811620 TAGGTACATTTCCAAGAGGTAGG - Intergenic
959540196 3:107527947-107527969 CAAACACATTTCCATGGGGAAGG - Intronic
960994729 3:123333379-123333401 AAGACAGACTTCCATGAGGGAGG + Intronic
962167877 3:133069144-133069166 ACTTCACATTTTCATGAGGATGG + Intronic
963230196 3:142901641-142901663 AAAGCTCATTTCCAAGAGGAAGG - Intergenic
963556427 3:146794577-146794599 ATGGTACACTTTCATGAGGATGG + Intergenic
964296441 3:155239471-155239493 ATGGCACATTAGAATGAGGATGG - Intergenic
965462607 3:168986161-168986183 AAGGTACCTTTCCATTTGGATGG + Intergenic
966430051 3:179821842-179821864 AAGGCACATTTCTATTAACATGG - Intronic
967961881 3:194932070-194932092 AAGGCATATTTCCCCAAGGAAGG + Intergenic
968135343 3:196216427-196216449 AAGGCACCTGTCCAAGAGGTGGG + Intronic
970364520 4:15344836-15344858 AAGGCAGATAGCCAGGAGGATGG - Intronic
970876016 4:20870900-20870922 AAGGCTCATTTCAGTGGGGAAGG + Intronic
971424359 4:26501529-26501551 AAGACAGATTTCCCTGAGGAAGG - Intergenic
977369318 4:96115153-96115175 AAGTCACAGTTCCATGTGGCTGG + Intergenic
978284748 4:107062927-107062949 AAGAAACTATTCCATGAGGAAGG - Intronic
980365222 4:131794706-131794728 AAGAGAAATTTCCATGAGGAGGG - Intergenic
980529418 4:134032184-134032206 AAGGCACAATTCCTACAGGAGGG + Intergenic
982079350 4:151772580-151772602 AAGGAACATTTCTTTCAGGAGGG - Intergenic
982113965 4:152081791-152081813 GAGGCACAGTTCCATGTGGCTGG - Intergenic
982777800 4:159459762-159459784 AAGGCACATTTCTATTAGGTTGG - Intergenic
983434093 4:167689661-167689683 AAGTGACAAATCCATGAGGAAGG + Intergenic
983985326 4:174052867-174052889 AAGGAACACTTACATGTGGATGG + Intergenic
983996481 4:174188741-174188763 AAGGCACCTGACAATGAGGATGG + Intergenic
984741790 4:183171875-183171897 GAGGCACATGTGCATGAGGAAGG - Intronic
985670507 5:1204293-1204315 AAGGGACACTTTCCTGAGGAAGG + Intronic
987595070 5:19987742-19987764 AAGGCACATTGCAATAATGATGG - Intronic
989275139 5:39580154-39580176 AAAGCAGATTACCATGAGAAAGG + Intergenic
990652193 5:57913878-57913900 AAGGAAGATATCCCTGAGGAAGG + Intergenic
992011729 5:72534340-72534362 AATGCACATTCCCATGTTGAAGG - Intergenic
993050853 5:82924149-82924171 AACACATATTTCCATTAGGAAGG + Intergenic
993964443 5:94343952-94343974 AAAGCACATTTGCACTAGGAAGG + Intronic
996395336 5:123007892-123007914 CAGGGACATTTCCATTAGAATGG + Exonic
1000335370 5:160237979-160238001 AAGCAGCATTTCCATGAGAAGGG - Intronic
1002323590 5:178390349-178390371 GAGGCACATGGCCATGAGGCAGG + Intronic
1004685876 6:17943130-17943152 AAAGTACATTTCCTTGAGAATGG + Intronic
1008506120 6:52231725-52231747 TAAGCACTTTTCCATGAGCATGG + Intergenic
1009676418 6:66828530-66828552 AAAGCAAAATTCCATGAGAATGG + Intergenic
1010323370 6:74539005-74539027 GAGGCAGGTCTCCATGAGGAAGG + Intergenic
1010782917 6:79965913-79965935 AAGACACTTTTACATGAGGTAGG - Intergenic
1011784578 6:90829560-90829582 AAGCCACATTTACATGAGTGTGG - Intergenic
1015828960 6:137346597-137346619 AAAGCAAATTTCCATGAAAAAGG + Intergenic
1016653076 6:146485176-146485198 AAGGCACATTTCAAAAAGGTAGG - Intergenic
1017317108 6:153044111-153044133 AAGGCTCATTTCACTAAGGAAGG + Intronic
1017507456 6:155081653-155081675 AAGCCACAGTTCCATAGGGATGG + Intronic
1017677605 6:156829806-156829828 AAAGGTCTTTTCCATGAGGATGG + Intronic
1020855547 7:13416907-13416929 TAGGCATCTTTCCATGATGATGG + Intergenic
1022606536 7:31821038-31821060 AGGGCACATTTCAATTAGCAGGG - Intronic
1022888049 7:34666916-34666938 AAGGCCCTTTTCTTTGAGGAGGG - Intronic
1022982680 7:35619259-35619281 AAGACAGACTTCCAGGAGGAGGG - Intergenic
1023888814 7:44378389-44378411 CAGGCACATTTCCCAGAGGCAGG - Intergenic
1025155352 7:56600548-56600570 AAGGCACATCTCCATGTGGCTGG + Intergenic
1026467729 7:70668869-70668891 AAGGCACGCTTCCCTGGGGAGGG + Intronic
1027007985 7:74712442-74712464 AAAGCACATCACCATCAGGAAGG - Intronic
1030797017 7:113801722-113801744 AAGCAACATTTCCATGAACAAGG + Intergenic
1031366804 7:120910852-120910874 AAGGAAAATATCCATCAGGAGGG + Intergenic
1032305387 7:130729251-130729273 AAGGCACATCTCAATGTGGTGGG + Intergenic
1032799045 7:135303419-135303441 AAGTCACTTTTCCAAGAGGGAGG + Intergenic
1032808281 7:135380717-135380739 AAAGCACATTTACATGGTGAGGG + Intronic
1033025526 7:137768578-137768600 AGGGCACATTTCCAGGGGAAAGG + Intronic
1034626426 7:152496682-152496704 AAAGCACTATTCCATCAGGAAGG - Intergenic
1035075506 7:156174901-156174923 AGAGCACATTTCCCTGAGGTGGG + Intergenic
1035209703 7:157318715-157318737 CAGGCAGATTTCCAGCAGGAAGG - Intergenic
1035426719 7:158783026-158783048 GAGGCACGTGTCCATGGGGAAGG - Intronic
1035714081 8:1740463-1740485 TAGGCTCATTTGCATGAGGTAGG - Intergenic
1035757709 8:2046483-2046505 AAGTCATATTTCCCTGGGGACGG + Intronic
1036968800 8:13330849-13330871 AAGGCTCATTTTCATGAGCGTGG + Intronic
1039794748 8:40903333-40903355 CACGCACATTTGCATAAGGAAGG - Intergenic
1040869385 8:52084553-52084575 CAGGACTATTTCCATGAGGAAGG - Intergenic
1040880389 8:52198853-52198875 AAGGCACAGGTACATGTGGAAGG - Intronic
1042096813 8:65225100-65225122 AAAGTACATCTCCCTGAGGAAGG + Intergenic
1045141183 8:99285191-99285213 AGGGTACATTTCAATGTGGAAGG - Intronic
1046094456 8:109540261-109540283 CACGCAAATTTCCCTGAGGAAGG - Exonic
1047518339 8:125574919-125574941 AAGGCCAGTTTCCATGAGAAGGG + Intergenic
1047884274 8:129231274-129231296 ATGGCACATTTCCTTGGGGTAGG + Intergenic
1050056795 9:1664022-1664044 AAGCCACATGTCCATGGGGAAGG - Intergenic
1051525891 9:18043966-18043988 AAGGCACGCATCCATGAAGAGGG - Intergenic
1052895310 9:33742057-33742079 AAGGGATATTTCCATAAGGAAGG - Intergenic
1053300171 9:36943211-36943233 CAGGCACATTGCCTTGAGGTGGG + Intronic
1053629581 9:39920561-39920583 AAGAGAAATTTCCATGAGGAGGG - Intergenic
1053776185 9:41542986-41543008 AAGAGAAATTTCCATGAGGAGGG + Intergenic
1054214306 9:62330141-62330163 AAGAGAAATTTCCATGAGGAGGG + Intergenic
1054365547 9:64335504-64335526 AAGAGAAATTTCCATGAGGAGGG - Intergenic
1054673178 9:67825217-67825239 AAGAGAAATTTCCATGAGGAGGG - Intergenic
1056860522 9:90176773-90176795 AAGAATCATTACCATGAGGATGG + Intergenic
1058957579 9:109963476-109963498 CAGCCACATTTCCAGGAGGTGGG + Intronic
1058973372 9:110103089-110103111 AGGGGAGGTTTCCATGAGGAAGG - Intronic
1060041934 9:120307676-120307698 AGGGAAGATTTCCAGGAGGAAGG - Intergenic
1060059849 9:120449283-120449305 AAGTCCCATTTTCCTGAGGAAGG - Intronic
1060989404 9:127839476-127839498 AAGGCCCAGCTCCATGAGGCTGG + Intronic
1061957433 9:133970950-133970972 AAGGTTCATTTGCATGAGAAGGG + Intronic
1062299987 9:135860865-135860887 CAGGGACATTTCCATGAGCCAGG - Intronic
1185745566 X:2569999-2570021 CTCGCACATTACCATGAGGATGG + Intergenic
1188202992 X:27316228-27316250 AAGGCAAATTTGTATGCGGAAGG + Intergenic
1194813084 X:98410162-98410184 CAAGCACATTTCCATAAAGAAGG - Intergenic
1196751000 X:119117231-119117253 CAGGAACACTTCCTTGAGGAAGG + Intronic
1197611852 X:128648331-128648353 AAAGAACTTTTCCATGAGCATGG - Intergenic
1198389582 X:136160815-136160837 AAAGCAGATTTTGATGAGGAAGG + Intronic
1198518932 X:137433316-137433338 GAGGGACAGTGCCATGAGGAAGG + Intergenic
1201688161 Y:16730904-16730926 GAGACACATCTTCATGAGGAAGG + Intergenic