ID: 1092559529

View in Genome Browser
Species Human (GRCh38)
Location 12:9596403-9596425
Sequence CACTGAGGGCCTTTTGGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 230}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092559529_1092559535 9 Left 1092559529 12:9596403-9596425 CCTTTTCCAAAAGGCCCTCAGTG 0: 1
1: 0
2: 0
3: 17
4: 230
Right 1092559535 12:9596435-9596457 GCCTTCCTTGATGAGACATCTGG 0: 1
1: 0
2: 1
3: 12
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092559529 Original CRISPR CACTGAGGGCCTTTTGGAAA AGG (reversed) Intronic
900562192 1:3312606-3312628 CGGTGAGGGGCTTTCGGAAAGGG + Intronic
900585107 1:3428878-3428900 CACTGACGGCCTCTTAAAAAGGG + Intronic
904495407 1:30883907-30883929 GACTGAGGGCTTTTTGGGGACGG - Intronic
906037325 1:42759529-42759551 AAATGAAGGCCTTTTGTAAATGG + Intronic
907023230 1:51088983-51089005 CACTAAGGGCATTTTTAAAATGG - Intergenic
908597410 1:65703335-65703357 CACTGAGGGCTGTGGGGAAATGG - Intergenic
910068037 1:83177237-83177259 CATTGAAAGCCTTCTGGAAAGGG - Intergenic
910382555 1:86644444-86644466 CAATGAGGGGATTATGGAAAAGG + Intergenic
910609937 1:89129792-89129814 GACTGAGGGCCTTTGCAAAAGGG - Intronic
910912391 1:92251040-92251062 CACTTATGGCATTCTGGAAAAGG - Intronic
911099146 1:94080247-94080269 AACTGAGGCCCACTTGGAAAGGG - Intronic
911574648 1:99560985-99561007 CACTGTAGGCCTTTAGAAAAAGG - Intergenic
912724195 1:112044238-112044260 CACTGAGGGCCTCCAGGGAAGGG + Intergenic
913057512 1:115175997-115176019 AACTGGGGGCCTTTGGGAATAGG + Intergenic
913751453 1:121972330-121972352 CTCTGAAGGCTTCTTGGAAACGG + Intergenic
916437785 1:164792764-164792786 CACCCAGGCCCTTTAGGAAAGGG + Intronic
916558862 1:165915693-165915715 CACTGAGGTCCTTGAGGAGAAGG - Intergenic
920294941 1:204950339-204950361 CAGTGAGTGCCTTATGGAGAAGG - Intronic
922029111 1:221781081-221781103 GACACAGGCCCTTTTGGAAAAGG - Intergenic
923227290 1:231949811-231949833 CACTGAGGGAATTTCGCAAAAGG - Intronic
1062828641 10:590054-590076 CACACAGGGCCTGTGGGAAATGG + Intronic
1065410212 10:25417944-25417966 CATTGAGGGCCTGCTAGAAATGG + Intronic
1068007282 10:51406467-51406489 CACTGGGGGCCTGCTGCAAATGG + Intronic
1068734588 10:60398359-60398381 TTCTGAGGGTCTTTGGGAAAGGG + Intronic
1069373959 10:67774936-67774958 AACTGATGGCCTTTGGGAAGGGG - Intergenic
1070451793 10:76566404-76566426 CTCTGAAGGCATTTTTGAAAAGG + Intergenic
1071083711 10:81843035-81843057 CACTCAGTCCCTTTTGTAAATGG - Intergenic
1071130698 10:82390203-82390225 CAGAGATGGCCTTTTGAAAATGG - Intronic
1073743818 10:106442648-106442670 CACTGAAGGATTTGTGGAAAAGG - Intergenic
1074019797 10:109570689-109570711 TACTGAGGGCCTATTGGTAATGG - Intergenic
1076441240 10:130482695-130482717 TACCCAGGGCCTTTTCGAAACGG - Intergenic
1077965770 11:7131483-7131505 ACCTGAGGGACTTTTGGACATGG - Intergenic
1081527539 11:43936895-43936917 CACTGAGGGCCTCTTAGAAGAGG - Intronic
1081586367 11:44386772-44386794 CACTGAAGGCCTTTTTGAGGAGG - Intergenic
1081899492 11:46615895-46615917 CACTGAAGCACTTGTGGAAAGGG - Exonic
1081977284 11:47243755-47243777 CACTGGGGGCCATTTTGAGAAGG - Intronic
1083014244 11:59436437-59436459 TCCTGAGGGTCTTTTTGAAAGGG - Intergenic
1083986678 11:66220250-66220272 CACTGAGAGGCCTGTGGAAACGG - Intronic
1084111470 11:67016754-67016776 AGCTGAGGGCCTCTTGGGAATGG - Intronic
1084427980 11:69095975-69095997 TCCTGAGGGCCTTTGGGAAAAGG + Intergenic
1085549495 11:77355327-77355349 GACTGAGGACCTAGTGGAAAAGG - Intronic
1085620786 11:78036644-78036666 CACGGAAGGCCTCTTGGGAAAGG - Intronic
1089339891 11:117750198-117750220 CACTGAGGGCCTTGTGCCCAGGG + Intronic
1090959924 11:131547014-131547036 CACAGAGGGCTTCTTGGAAGAGG - Intronic
1092559529 12:9596403-9596425 CACTGAGGGCCTTTTGGAAAAGG - Intronic
1094436039 12:30422018-30422040 CACAGAAAGCCTATTGGAAAGGG + Intergenic
1095362138 12:41355123-41355145 CGCTGAGGGCCCTTGGGGAAAGG + Intronic
1095862199 12:46930017-46930039 TACTGAGGGGCTTCTGGAAGAGG - Intergenic
1096183214 12:49562413-49562435 CAGTGAGGCCCTTGGGGAAAGGG + Intronic
1096639222 12:52980928-52980950 CACTGATGGCCTTTTTGACTTGG + Intergenic
1100001635 12:89843879-89843901 ATCTGAGGGCCTCTTTGAAAGGG + Intergenic
1101937258 12:109068386-109068408 CATCGAGAGACTTTTGGAAAGGG + Intronic
1102150967 12:110689011-110689033 CACTGGGGGTCTTGTAGAAAGGG + Intronic
1102538937 12:113604220-113604242 CACTCAAGGCCTTTAGCAAAGGG - Intergenic
1103351551 12:120287250-120287272 CACTGAGGGCCCCTTGGGCATGG + Intergenic
1104515513 12:129421563-129421585 CACTGTGGACCTTTTGAAATAGG - Intronic
1104861751 12:131927738-131927760 CACTGAGTGCCCCTTGGGAAGGG + Intergenic
1105291852 13:19058426-19058448 CTCGGAGGGCCTCGTGGAAATGG + Intergenic
1108317698 13:49253877-49253899 CAGTGAGGGCCTTTAGCATAAGG - Intronic
1113221719 13:108112000-108112022 CATTTATGGCATTTTGGAAAAGG + Intergenic
1113822987 13:113228587-113228609 CGCTGAGGGTCTGTTGGGAAGGG + Intronic
1116726007 14:48562236-48562258 CACTAAAGGCCTTTTGGCACAGG + Intergenic
1118047583 14:61988143-61988165 CACAGATGCCCTTTTGGAAAAGG + Intergenic
1118872470 14:69754743-69754765 CAGTCAGGGCCATTTTGAAATGG + Intronic
1120867166 14:89305174-89305196 CACTGAGGGCCACTAGGAGATGG + Intronic
1122239681 14:100354621-100354643 CACTAATGCACTTTTGGAAATGG + Intronic
1122250629 14:100436997-100437019 CACTGAAGGCCTTTTAGCACTGG + Intronic
1122942869 14:104990285-104990307 CACTGGGGTATTTTTGGAAATGG + Intronic
1123113046 14:105881944-105881966 CACTGAGGGGCTTTTGTATCTGG + Intergenic
1123115394 14:105892094-105892116 CACTGAGGGGCTTTTGGGTCTGG + Intergenic
1123386288 15:19809875-19809897 CACTGAGGCCATGGTGGAAAAGG - Intergenic
1123402998 15:20004829-20004851 CACTGAGGGGCTTTTTGTGAAGG - Intergenic
1123512338 15:21011483-21011505 CACTGAGGGGCTTTTTGTGAAGG - Intergenic
1123977046 15:25563513-25563535 CACTGAGGCTTTTTTGGACATGG + Intergenic
1126079840 15:44949187-44949209 CAATGAGTGCCTTGAGGAAAGGG - Intergenic
1128778500 15:70342136-70342158 CACTGTGGGCTTTCTGGAGAGGG + Intergenic
1129300120 15:74620685-74620707 GACTGGGGGCCTTTGGGAAGGGG - Intronic
1129489451 15:75909258-75909280 TACTGAGGGAGTTTAGGAAAAGG + Intronic
1129544190 15:76377091-76377113 CACTGCTGGCCTGTGGGAAAAGG + Intronic
1135649720 16:24195348-24195370 CACCATGGGCCTTTTGGAAGTGG - Intronic
1137387173 16:48052448-48052470 CACTTAGGGACTCTTAGAAATGG - Intergenic
1137563903 16:49521596-49521618 CAGTGGTGGCCTTTTGGAAGTGG + Intronic
1137692884 16:50441534-50441556 CACTGAGGGCAGTTTGGCACTGG + Intergenic
1137692902 16:50441601-50441623 CACTGAGGGCAGTTTGGCACTGG + Intergenic
1137785438 16:51134332-51134354 CACTGCCTGCCTCTTGGAAATGG + Intergenic
1138517203 16:57542751-57542773 CACTGAGGGGCCTGTGGATAAGG - Exonic
1138696064 16:58814636-58814658 CTCTGAGGGCCTTTTGATTATGG + Intergenic
1138827942 16:60343389-60343411 CACTGAAGGCATATTAGAAATGG + Intergenic
1138847821 16:60588229-60588251 CACAGAGGGCCCATTGGAGAAGG + Intergenic
1138894385 16:61185337-61185359 TGCTGAGGGACTTTTGTAAAAGG - Intergenic
1138908945 16:61373328-61373350 CACTGAAAGCCCTTTTGAAATGG - Intergenic
1139821419 16:69724358-69724380 CTCTGAGGGCCTTTCCGAATGGG - Intronic
1140535474 16:75705452-75705474 CACTGAGGGCCTCTGTGAAAAGG - Intronic
1141288951 16:82699566-82699588 CACTAAGAACCTTTTAGAAATGG + Intronic
1141813203 16:86390382-86390404 CACTGAGCCCCATTTGGAGATGG + Intergenic
1145823241 17:27856779-27856801 AACAGAGGGGCCTTTGGAAAGGG + Intronic
1146072469 17:29695883-29695905 CAATGAGGGCACTTTGAAAATGG + Intronic
1147111081 17:38262104-38262126 CAATGAGGACTTTCTGGAAAAGG - Intergenic
1148418429 17:47526337-47526359 CAATGAGGACTTTCTGGAAAAGG + Intronic
1149891116 17:60391680-60391702 GAATTAGGGCCGTTTGGAAAGGG - Intronic
1151693626 17:75702695-75702717 CACTGAGTGCCTGCTGGACATGG + Intronic
1152408127 17:80108842-80108864 CACTGTGGGTCTTTGGGAAGGGG + Intergenic
1153706881 18:7754903-7754925 CACTGTGAGGCTTTTGCAAAGGG + Intronic
1157407602 18:47436211-47436233 CTCTGAGGAGCTTTTGGGAAAGG - Intergenic
1158035284 18:53021092-53021114 CACTGACGGCCTGAGGGAAAGGG + Intronic
1159456524 18:68666444-68666466 CACTGAGGAGCTTCAGGAAAGGG - Intergenic
1160131709 18:76231148-76231170 CACGGAAAACCTTTTGGAAAGGG + Intergenic
1161028480 19:2047385-2047407 CCCTGGGGGCCTCTGGGAAAGGG + Intronic
1163612058 19:18306743-18306765 CACTGATGTCCTTTTACAAAAGG - Exonic
1164649968 19:29884544-29884566 CCTTGAGGGCTTTTGGGAAAAGG + Intergenic
1164664138 19:30012459-30012481 CAGTGAGAGCATTTTGGAAGAGG + Exonic
1166551613 19:43669272-43669294 CCCTTTGGGCCTTTTGTAAAAGG + Intronic
1167569222 19:50276538-50276560 GAGGAAGGGCCTTTTGGAAAAGG + Intronic
1167855891 19:52239581-52239603 TCCTGAGGGCCTTGGGGAAAGGG + Intergenic
1168470865 19:56639497-56639519 CAGGGAAGGCCTTTTAGAAAAGG - Intergenic
925346488 2:3175506-3175528 CACACAAGGGCTTTTGGAAATGG + Intergenic
926978978 2:18546498-18546520 CACTGAGGCCTTTTTGGAGAAGG - Intergenic
928813201 2:35254418-35254440 CAGAGAGGAGCTTTTGGAAATGG + Intergenic
931286857 2:60839694-60839716 CACAGGGGGCCTTGTGAAAATGG + Intergenic
932886017 2:75549803-75549825 CACAGAGGGCCTTTATGGAAAGG - Intronic
934071471 2:88388103-88388125 CACTGTTGGCCTTTTGCAACTGG - Intergenic
937225429 2:120366184-120366206 CACTGAGGGGACTTTGGCAAGGG + Intergenic
939484028 2:142786659-142786681 CACTGATGTCCAGTTGGAAAAGG + Intergenic
940488131 2:154322812-154322834 CACTGAGGGACTTTAGTCAATGG - Intronic
943015110 2:182500725-182500747 TACTTTTGGCCTTTTGGAAATGG - Intronic
943150924 2:184111645-184111667 GAATGAGGCACTTTTGGAAAAGG + Intergenic
944337012 2:198545992-198546014 CACAGAGCACCTATTGGAAAAGG + Intronic
944426986 2:199594203-199594225 CACCTAGGGCCATTTGGGAAAGG - Intergenic
944633087 2:201647553-201647575 TATTGAGGGCCTTTTGGAGAGGG + Intronic
947660234 2:231861069-231861091 TACTGGGGGCCTCATGGAAAAGG + Intergenic
948255602 2:236566281-236566303 CCCTGAGTGCTTATTGGAAAGGG - Intergenic
948942960 2:241205109-241205131 CACAGAGGGCCTTGTGGACATGG + Intronic
1168970845 20:1929825-1929847 CACTGAAGGTTTTTTGGCAAAGG - Intronic
1170541832 20:17396881-17396903 CAGTGAAGGCCTCTAGGAAATGG + Intronic
1170553442 20:17496240-17496262 CTCAGAGGGCTTTGTGGAAATGG - Intronic
1171009843 20:21503252-21503274 CACTGGGGGCCTGTGGGAAATGG + Intergenic
1172786380 20:37471578-37471600 CAGGGAAGGCCTCTTGGAAAAGG - Intergenic
1172801088 20:37576758-37576780 CAGGGAGGGCTTCTTGGAAAAGG - Intergenic
1173231262 20:41200686-41200708 CACTGTGGGCTTTGTGGAACTGG + Intronic
1173945778 20:46949851-46949873 CACTGTGTGACTTTTGGCAAGGG + Intronic
1174113471 20:48211897-48211919 CAGGGAGGGCCTCTTGGAAGAGG - Intergenic
1174352242 20:49976718-49976740 CACAGAGGGCTTATTGGATAAGG + Intergenic
1175383362 20:58578640-58578662 CAGGGAGGGCTTCTTGGAAAAGG - Intergenic
1175610059 20:60343272-60343294 CAATGAGGTCCTTTGGGAAGAGG - Intergenic
1178237160 21:30856100-30856122 CATGGAGGGCTTTTTGGAAGTGG + Intergenic
1178662601 21:34520199-34520221 CACCGAGGGCTTATTGGAGAAGG - Intronic
1182029217 22:27144366-27144388 GACTGGGGTCCTTTTAGAAAGGG + Intergenic
1182710338 22:32318744-32318766 CACTGAGGGTTTTGAGGAAAGGG - Intergenic
1184021685 22:41825715-41825737 CTCTCAGGGCCTTCTGGAAAGGG - Exonic
1185130076 22:49033897-49033919 CACTGAGGGCCCTAGGGCAAGGG - Intergenic
950202583 3:11055560-11055582 CTCTGAGGGCCTCTGAGAAATGG - Intergenic
950908907 3:16566989-16567011 CTCTGAGGGCCTTTGCGACATGG + Intergenic
951144423 3:19209998-19210020 CACTCAGTGACTTTTGGCAAAGG - Intronic
951264492 3:20550395-20550417 ATCTGACGGCCTTTTGGCAATGG + Intergenic
952102439 3:30030292-30030314 CACTGAAGGCCATGGGGAAAAGG + Intergenic
954900852 3:54018353-54018375 CACTGAGGGCCTTCGGGAGTGGG + Intergenic
956046290 3:65199502-65199524 CACTGGGAGGCTTTTGGTAATGG - Intergenic
956558292 3:70544897-70544919 CTCAGAGGACCTTGTGGAAAAGG - Intergenic
956636750 3:71372356-71372378 CAGGGAAGGCCTCTTGGAAAAGG - Intronic
956686274 3:71831056-71831078 CCCGGAGGCCCTTTTGGGAAGGG + Intergenic
956793703 3:72699950-72699972 CCATGAGGGCCTTTGGGAGACGG + Intergenic
957409365 3:79817483-79817505 AACTTGGGGTCTTTTGGAAAGGG - Intergenic
957700950 3:83711063-83711085 AACTGAGGTCCTAGTGGAAAAGG + Intergenic
957996589 3:87697880-87697902 AACAGAAGGACTTTTGGAAAGGG + Intergenic
959539076 3:107520477-107520499 CACTGTGCTCCTTTTTGAAAAGG - Intergenic
961643261 3:128378538-128378560 CACTGAGGGTCTTTGGGCAGAGG + Intronic
961792710 3:129387776-129387798 CAGTGGGTGCCTTTTGGATAGGG + Intergenic
963531230 3:146475717-146475739 CAAAAAGGACCTTTTGGAAAAGG - Intronic
963595915 3:147324564-147324586 CCCTGTGGCCCTTTTGGAGATGG + Intergenic
968425277 4:519114-519136 CAATGAGGGATTTTTGGTAATGG - Intronic
970002271 4:11375812-11375834 CACTGAGTGACTTCTGGAAGGGG - Intergenic
971479190 4:27099174-27099196 CAGAGAGGGGCTTCTGGAAATGG - Intergenic
971562834 4:28103149-28103171 CACAGAGGGGCTTTGGGAAAAGG + Intergenic
977962105 4:103098052-103098074 CACTGAAGGATTTATGGAAAGGG + Intronic
979993125 4:127399563-127399585 CTCTGAGGTCATTTTGGAAGCGG - Intergenic
981061792 4:140432521-140432543 CTTTGAGGGACTATTGGAAAGGG + Intergenic
982248624 4:153381353-153381375 CACTGAGGGGTGTTTGGGAATGG - Intronic
983829239 4:172303820-172303842 GAGTGAGGGCAGTTTGGAAATGG - Intronic
985590441 5:761724-761746 CACTCAGGGCCTCTCAGAAAAGG + Intronic
985673029 5:1216104-1216126 CACAGGGTGCCTTTAGGAAATGG + Intronic
986443126 5:7798500-7798522 CAGTGTGGGCCTTTTGCAAGTGG - Intronic
987076681 5:14389121-14389143 AACTGAGGGCCTTTTTTAGAAGG + Intronic
987100560 5:14587971-14587993 CATGGAGGCCCTTGTGGAAAAGG + Intronic
987394192 5:17406335-17406357 CACTTAGGGGCTTCTAGAAAAGG + Intergenic
989432293 5:41369939-41369961 CACAGACTGCCCTTTGGAAATGG - Intronic
990143050 5:52727853-52727875 CACTGAAGGGCTGTGGGAAAGGG + Intergenic
990316090 5:54584583-54584605 CACTGAAGGCCTATGGGAGATGG + Intergenic
991299708 5:65118438-65118460 CACTGAGGGCCTTTGGGGTGAGG + Intergenic
993329815 5:86584707-86584729 CACAGAGTGCCTTTGTGAAATGG - Intergenic
995603606 5:113826430-113826452 CACTAAGGGCCTTTAAAAAATGG - Intergenic
996795484 5:127342267-127342289 CACTGAAGGCCTCTGGGAAATGG - Intronic
997568272 5:134905707-134905729 AACTGACGGCCCCTTGGAAAAGG - Intronic
1000348261 5:160332433-160332455 CACTGAGGGGTTTTGGGCAAAGG - Intronic
1001601023 5:172928456-172928478 CAGTGAGGGCTTCTTGGAGACGG - Intronic
1002018403 5:176345010-176345032 AACAAAGGGCCTTTTGGAAGTGG + Intronic
1002452779 5:179328898-179328920 TGCTGAGGGCCTTCTGCAAAGGG + Intronic
1003338294 6:5195676-5195698 CACTGAGGTCCTTGTGAGAAGGG - Intronic
1005039122 6:21586100-21586122 CACTGAGTTGCTTTGGGAAATGG - Intergenic
1005157379 6:22822151-22822173 CAGTGAGGGCCTGTAGGAATTGG - Intergenic
1005963906 6:30712981-30713003 AGCTGAGGTCCATTTGGAAAGGG - Exonic
1010430138 6:75769258-75769280 CTTTGAGGGACTTTTGGGAAGGG - Intronic
1010630094 6:78189069-78189091 GACTGGGGGACTGTTGGAAAGGG - Intergenic
1012355340 6:98307563-98307585 CACTGGGGGCCTATTGGAGGGGG - Intergenic
1012953518 6:105543728-105543750 CTCTCAGGGCATTTTTGAAAAGG + Intergenic
1014743322 6:125170913-125170935 CTCTCAGGGCTGTTTGGAAAGGG - Intronic
1015056777 6:128911786-128911808 CAGTGAGGGCCTTCTGGGAAAGG - Intronic
1015235215 6:130962907-130962929 CACTGGTGGGCTTCTGGAAAAGG + Intronic
1015851699 6:137580813-137580835 AGCTGAGGGCATTTTGGAAATGG + Intergenic
1018436374 6:163762797-163762819 CTCTTAGGGCATTGTGGAAAGGG + Intergenic
1018899944 6:168045956-168045978 CACTGCGGGCCCGGTGGAAATGG - Intergenic
1019062702 6:169267701-169267723 CCATGATGGCCTTTTGCAAAAGG - Intergenic
1019133052 6:169891294-169891316 CACTGTGAGCCTTGTGGACAGGG + Intergenic
1019133188 6:169892164-169892186 CACTGTGAGCCTTGTGGACAGGG + Intergenic
1019133268 6:169892710-169892732 CACTGTGAGCCTTGTGGAGAAGG + Intergenic
1019133277 6:169892770-169892792 CACTGTGAGCCTTGTGGACAGGG + Intergenic
1019133281 6:169892800-169892822 CACTGTGAGCCTTGTGGAGAAGG + Intergenic
1019133291 6:169892860-169892882 CACTGTGAGCCTTGTGGACAGGG + Intergenic
1019133313 6:169893010-169893032 CACTGTGAGCCTTGTGGAGAAGG + Intergenic
1019904192 7:4048367-4048389 AACTGAAGGCCTTCCGGAAAGGG - Intronic
1021170345 7:17391785-17391807 CATTTGGGGCCCTTTGGAAATGG - Intergenic
1021755967 7:23853061-23853083 CACAGAGTGCCTGGTGGAAAAGG - Intergenic
1022336700 7:29428511-29428533 AAAGGAGGGCCTTGTGGAAATGG - Intronic
1024600400 7:50975494-50975516 CATTGAGGAGCTTTTGGAAAGGG - Intergenic
1027276060 7:76557523-76557545 CATTGAAAGCCTTCTGGAAAGGG + Intergenic
1030576301 7:111290291-111290313 CAGTGAGGGATTTTTGTAAAGGG - Intronic
1035217637 7:157380696-157380718 CACTGGTGACTTTTTGGAAAAGG - Intronic
1038426117 8:27465016-27465038 CAGTCAAGGCCTTTTGCAAACGG - Intronic
1038721065 8:30035699-30035721 CCCTCAGAGTCTTTTGGAAAGGG + Intergenic
1044667422 8:94644157-94644179 TACTGAGGGGCTGTGGGAAAAGG + Intronic
1044793255 8:95869970-95869992 CAGAGAAGGCCTTATGGAAAAGG + Intergenic
1046283349 8:112062332-112062354 CATTCAGGGCATCTTGGAAATGG + Intergenic
1046870429 8:119199597-119199619 AACAGAGGGCCTTTTGAAAGAGG + Intronic
1047895274 8:129359743-129359765 CAGTGAAGGCCTTGTGGAGAAGG + Intergenic
1048758735 8:137767776-137767798 CTTTGAGGGACTTTTGGGAAGGG + Intergenic
1049997194 9:1044771-1044793 CCCTGAGGACCATTTGGAATGGG + Intergenic
1052465263 9:28821761-28821783 CACTGAGGGCATCGTGGAACAGG - Intergenic
1055568741 9:77594916-77594938 CACTGTGGGCCCTTGGGAACAGG + Intronic
1055996536 9:82166371-82166393 GACTGATGGCCTTATGAAAAGGG + Intergenic
1056078417 9:83063905-83063927 GACTGAGGGTCTCCTGGAAAAGG - Intergenic
1058230606 9:102419721-102419743 CAATGAGAGCCCTTTAGAAAAGG - Intergenic
1062480555 9:136748968-136748990 CCCTGAAAGCCTTTTGAAAAAGG + Intergenic
1186935494 X:14446214-14446236 CACTGTGGCCCCTTGGGAAATGG + Intergenic
1188225901 X:27597053-27597075 CACTGAAGGCCATTTGGATTTGG + Intronic
1188837307 X:34974321-34974343 GACTTAGGGCCATTTGAAAAGGG + Intergenic
1192618442 X:72652257-72652279 CACTGAGGGAAGTTTTGAAAGGG + Intronic
1192756769 X:74054896-74054918 CTCAGAGGGCCATTGGGAAATGG - Intergenic
1197214630 X:123856598-123856620 CACTGTAGGCCTTTTGGAGAAGG + Intergenic
1200117593 X:153776176-153776198 CACTGAGGGCCTCTGGGAGAAGG - Exonic