ID: 1092567094

View in Genome Browser
Species Human (GRCh38)
Location 12:9678016-9678038
Sequence GGAAATGCACAGATCCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 1, 2: 3, 3: 32, 4: 202}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092567094 Original CRISPR GGAAATGCACAGATCCAGCA GGG (reversed) Intronic
900492309 1:2957073-2957095 GGAAAGTCAAAGATCCAGGAAGG + Intergenic
902189876 1:14754866-14754888 GGAAAGGCAGAGGTTCAGCAAGG - Intronic
904932710 1:34102694-34102716 GCAAATGCAAAGGTCCAGCATGG - Intronic
907982489 1:59497787-59497809 GGAAATCCACACTTCCAGGAAGG - Intronic
909626186 1:77718718-77718740 GAAAATGCAGAGATCCAGCCTGG + Intronic
910544515 1:88398681-88398703 GGAAATGAAAAGCTCCAGCATGG + Intergenic
911176317 1:94821001-94821023 GGAAATGCACAGATACGGCATGG + Exonic
911591599 1:99754167-99754189 AGAAATGGACAGATCCAGGCTGG + Intronic
912226888 1:107744081-107744103 GGAAATGCAAAGCTCAGGCAGGG + Intronic
917027174 1:170657167-170657189 ATAAATGTGCAGATCCAGCAAGG + Intergenic
918213353 1:182371263-182371285 GGAAATGCAAAGCTGCTGCAAGG - Intergenic
919557866 1:199083310-199083332 GGAACTGCACAGCCACAGCATGG - Intergenic
920334220 1:205233495-205233517 GGAAAGGCGGAGAGCCAGCAGGG - Intronic
920647361 1:207813514-207813536 GGAGATGCACACATCCATCCTGG + Intergenic
922173961 1:223180349-223180371 GGAAATTCACATCTCCAGAAGGG - Intergenic
1063062026 10:2565598-2565620 GGAACTCCACACATTCAGCAGGG + Intergenic
1063159587 10:3409427-3409449 GGCAATGCAGCGACCCAGCACGG - Intergenic
1063880531 10:10527153-10527175 GCCACTGCACAGAGCCAGCATGG - Intergenic
1064507115 10:16044237-16044259 GGAAATGGAAAAACCCAGCATGG + Intergenic
1064662940 10:17624380-17624402 GGAAATCCTCTGATCCAGCCAGG + Intergenic
1065812106 10:29451761-29451783 GGAACTGCAAAGATCCAGCAGGG - Intergenic
1065959678 10:30724400-30724422 GGAACTGCAAAGATCCGGCAGGG + Intergenic
1066503923 10:36022425-36022447 GAAAAGGCCCAGATGCAGCAAGG + Intergenic
1067302907 10:45030822-45030844 GGAAATGCAGAAATGCAGGAGGG - Intergenic
1069600735 10:69705182-69705204 GAAAATGTAAAGATCCAGCCTGG - Intergenic
1070357847 10:75657989-75658011 GGAAATGCCCGCATCCAGCAGGG - Intronic
1071022650 10:81076787-81076809 GGAAATGTACATATACACCACGG - Intergenic
1072517506 10:96200074-96200096 GGCATTGCACAGATCAAACAAGG - Exonic
1072733812 10:97865889-97865911 GGAAATGGACTGATCCAGACGGG - Exonic
1073366462 10:102946281-102946303 GGAAAGGCACAGAGGCAGAAAGG + Intronic
1074378159 10:112955806-112955828 AGAACTGCAGCGATCCAGCACGG - Intronic
1075139353 10:119817980-119818002 GGAAATGCGCAGTCCCAGCAGGG + Intronic
1075188079 10:120281375-120281397 GGAAATGCACATATACACCATGG + Intergenic
1075418074 10:122280325-122280347 GGAAACCCAGAGATCCAGCACGG + Intronic
1075698801 10:124455129-124455151 GGAGATGCAGAGACTCAGCAGGG + Intergenic
1076327192 10:129634356-129634378 GCAAATGCACAGATACAAGATGG - Intronic
1078159041 11:8824560-8824582 GAAAATGTACATATACAGCATGG - Intronic
1078560919 11:12371719-12371741 GAAAATGCACATATACACCATGG + Intergenic
1082703845 11:56468049-56468071 GAAAATGCACATATACATCATGG + Intergenic
1082706681 11:56501052-56501074 AGAGAAGCACAGATCCAGGAAGG + Intergenic
1086363515 11:86084518-86084540 AGGAATAAACAGATCCAGCAGGG - Intergenic
1088782800 11:113152309-113152331 AGAAATGCACAGATGCAGTATGG - Intronic
1090538704 11:127676411-127676433 GGAAATGCACTAATACAGTATGG - Intergenic
1091283109 11:134393355-134393377 GGAAGTGCTGAGAGCCAGCAAGG - Intronic
1092151293 12:6250747-6250769 GAAAATTTACAGGTCCAGCAAGG - Intergenic
1092567094 12:9678016-9678038 GGAAATGCACAGATCCAGCAGGG - Intronic
1097107198 12:56632856-56632878 GGAGAAGCACAGCTGCAGCATGG - Intronic
1102359540 12:112272479-112272501 CGAAATACACAGATCCATCCAGG - Intronic
1104128599 12:125871414-125871436 AGAAGTGCACAGAGGCAGCAAGG + Intergenic
1104653088 12:130551676-130551698 GAAAATGCACAGATAGAGCAAGG + Intronic
1104913028 12:132249081-132249103 GGAAAATCACATCTCCAGCAAGG + Intronic
1107521932 13:41192213-41192235 CGAAATGCACAGGATCAGCAGGG - Exonic
1108301598 13:49082881-49082903 CGCAATGCAATGATCCAGCATGG + Intronic
1109667046 13:65553263-65553285 TGAAGGGCACAGAGCCAGCAAGG - Intergenic
1112798327 13:103082251-103082273 TAAAAGGCACAGATCCAGAAAGG + Intergenic
1113710753 13:112463501-112463523 GAAAAGGCACAGATCAAGAAAGG + Intergenic
1113937830 13:114004305-114004327 TGCAAAGCACAGATCCAACAGGG + Intronic
1114416807 14:22550399-22550421 GGATATGCACAGAAGCTGCAAGG + Intergenic
1114557913 14:23572220-23572242 GGAATTACACAGTTCCAGGAGGG - Intronic
1116547362 14:46185274-46185296 GGAAATCAACAGACCCAGCCTGG + Intergenic
1118404757 14:65412532-65412554 GGGACGGCACAGTTCCAGCAGGG - Intronic
1119220563 14:72903329-72903351 GGAAATCCACAGGGCCAGGAAGG + Intergenic
1121679797 14:95783977-95783999 TTAAAAGCACAGATCCAGCCAGG - Intergenic
1125135738 15:36340216-36340238 AGAAATGGACAGGTCTAGCAAGG - Intergenic
1129665572 15:77577699-77577721 GGAAATTCACACAGCCACCAGGG - Intergenic
1131064652 15:89426460-89426482 GGAAATGCAAACCTTCAGCATGG - Intergenic
1132429603 15:101749911-101749933 GAAAATGTATAGACCCAGCATGG + Intergenic
1132768009 16:1544623-1544645 AGAAATGCAGTGATCCAGCTGGG - Intronic
1134233744 16:12449606-12449628 GGAGATGCACAGCTGGAGCACGG - Intronic
1135569694 16:23539338-23539360 GGAAAAGAACAGATCAAGTATGG - Intronic
1136933182 16:34436675-34436697 GCAAATGCACAAAGCCGGCAGGG - Intergenic
1136971390 16:34975139-34975161 GCAAATGCACAAAGCCGGCAGGG + Intergenic
1138061695 16:53898166-53898188 AGGAATGGACAGATCCTGCAGGG - Intronic
1139326502 16:66156467-66156489 GGAAATGCACAGCTGCAGTCTGG + Intergenic
1140548555 16:75837039-75837061 GAAAAAGGACATATCCAGCAAGG - Intergenic
1141371219 16:83487761-83487783 GGAAATGCACAGAGCCCCCGAGG - Intronic
1147335632 17:39725532-39725554 GGAAGTGCACAGACCCTGCAAGG - Intronic
1147648401 17:42048150-42048172 GGAAATACACAAACCCAGCCTGG + Intronic
1149720631 17:58840576-58840598 GAAAATGTACAGAACCAGCCTGG + Intronic
1149770555 17:59317545-59317567 GGAATTGAACAAATCCAGCTAGG - Intergenic
1151349873 17:73525360-73525382 GGCAATGGACAAAGCCAGCAAGG + Intronic
1151433515 17:74080542-74080564 GGAGAAGCACAGAGCAAGCATGG + Intergenic
1154257725 18:12798616-12798638 GAAAATGTACATATACAGCATGG - Intronic
1156569257 18:38234105-38234127 AGAAATGAACACTTCCAGCAAGG - Intergenic
1157689435 18:49668927-49668949 GGAGATGAACAAAGCCAGCATGG - Intergenic
1162245511 19:9396659-9396681 ACAAATGGACAGATCCAGCAGGG + Intergenic
1164759310 19:30716939-30716961 GGAAATGGAACGATCTAGCAGGG - Intergenic
1167936757 19:52915144-52915166 GAAAATGCAAAGATCCACAAGGG + Intergenic
925120075 2:1411545-1411567 GGAAATTCACACAGCCAGAAAGG - Intronic
925299559 2:2800877-2800899 GAAAATGCACACATGCACCATGG - Intergenic
926153366 2:10436586-10436608 GCAAACCCCCAGATCCAGCATGG + Intergenic
927333488 2:21893122-21893144 GGAAATGTACACATACACCATGG - Intergenic
927391759 2:22604190-22604212 GGAAATGAAGACTTCCAGCATGG + Intergenic
928072858 2:28234955-28234977 GCAACTGCACAGAATCAGCAAGG - Intronic
929053980 2:37860251-37860273 GTAAATGTACACTTCCAGCAAGG - Intergenic
929294037 2:40226250-40226272 GAAGTTGCACAAATCCAGCAAGG - Intronic
930024808 2:47023590-47023612 GGAACTGCACACAGCAAGCAGGG + Intronic
931904411 2:66826807-66826829 GATAATGCACAGAAACAGCATGG + Intergenic
932471174 2:71959856-71959878 AGAAATGCACAGATCCAGCAGGG - Intergenic
934791590 2:97066984-97067006 GGACAGGCACAGATAGAGCAAGG + Intergenic
936461191 2:112714722-112714744 GGAATTTCACATAGCCAGCAAGG - Intergenic
936772400 2:115930054-115930076 AGAAATGAACAGATCCAGCAAGG - Intergenic
937003669 2:118491371-118491393 GAAAATGCAGAGGTACAGCATGG + Intergenic
937906928 2:127056969-127056991 TGGAATGCCCAGATACAGCAGGG - Intronic
938883181 2:135613519-135613541 ACAAATGCATAAATCCAGCAGGG + Intronic
939839143 2:147165619-147165641 GGATAGGCTCAGAACCAGCAGGG - Intergenic
941052133 2:160746901-160746923 GCAAATGCAGAGACCCAGCAGGG - Intergenic
942530044 2:176900237-176900259 AGAAATGCTCAGCTCAAGCAGGG + Intergenic
942859511 2:180592164-180592186 GGAAAGGCACAGATTCAGTCAGG + Intergenic
942958800 2:181804978-181805000 AGAAATGCAGAGTTTCAGCAAGG - Intergenic
943622939 2:190169600-190169622 GGAAATGCAAATATCCAACTTGG - Intronic
945322706 2:208444087-208444109 GCAAAGGCACAGATCCAGACAGG - Intronic
946553939 2:220833683-220833705 GGAAATGCAAATATACCGCATGG + Intergenic
946713670 2:222531817-222531839 GGGCATGCACATATCTAGCATGG - Intronic
947853505 2:233307412-233307434 GGAGAGGGACAGATCCAGCTTGG + Intergenic
1171370797 20:24660966-24660988 GGACATGCATGGAGCCAGCAGGG + Intronic
1173145248 20:40519328-40519350 GGAAAGACAGAGATCCAGCAAGG + Intergenic
1173448778 20:43143784-43143806 GGAAGTGCCCACATCAAGCAAGG - Intronic
1174509652 20:51041403-51041425 GGAGAAGCACAGAACCAGTACGG - Intergenic
1175797640 20:61782439-61782461 GGAAATCCACACCTCCAGGAAGG + Intronic
1176515597 21:7781107-7781129 GGAAATGGAAAGTTCCAGAACGG - Intergenic
1177252281 21:18609755-18609777 GGAAATGTAGAGATGCATCAAGG + Intergenic
1178649625 21:34411119-34411141 GGAAATGGAAAGTTCCAGAACGG - Intergenic
1178725559 21:35048390-35048412 GCACATGCACAGAGCCAGCCAGG - Intronic
1180221030 21:46358036-46358058 TGAAATCCACTGCTCCAGCATGG - Intronic
1180987673 22:19914952-19914974 GGAAGGGGACAGATCCAGCGGGG + Intronic
1181171027 22:21010174-21010196 GGAAATCGACAGGCCCAGCAAGG - Intronic
1181377676 22:22473029-22473051 GCAAATGCAGAAATCCAGAAGGG - Intergenic
1182489940 22:30664843-30664865 GGACAAGCACAGAGACAGCAGGG + Intronic
1184313414 22:43663972-43663994 GGAAAAGCAGAAACCCAGCAAGG - Intronic
1184737964 22:46410216-46410238 GGAGATGCACATCTCCAGCCTGG + Intronic
1184757032 22:46522701-46522723 GGAAAAGCAGAGATCCAGCCTGG - Intronic
1185187565 22:49411397-49411419 GGAAATGCAAAGACCAAGAAGGG - Intergenic
949536221 3:4998061-4998083 GGAAACGCGGAGATGCAGCAGGG - Intergenic
952691731 3:36215006-36215028 GAAAAGGCACAGATACAGAAGGG - Intergenic
953267366 3:41404722-41404744 GCACATGCACATATGCAGCAGGG - Intronic
954984868 3:54781181-54781203 GGGAATGCAGAGACACAGCAAGG + Intronic
956177202 3:66484171-66484193 GGAAATACACAGATGAAGCCTGG + Intronic
956396942 3:68836035-68836057 TGAAATCCACAGATCTAGCTGGG - Intronic
956712584 3:72051412-72051434 GGAAATGCAATGAGCCAGGAGGG - Intergenic
957560381 3:81813661-81813683 CAAAATGCAAAGATCCAGCTTGG + Intergenic
958953093 3:100437440-100437462 GGAAATGAACAGACCCTGCTTGG - Intronic
961378217 3:126481160-126481182 TAAAATGGACAGATCCAGCGGGG - Intergenic
963496796 3:146074302-146074324 GCAAATACAGAGAGCCAGCAGGG + Intronic
966175081 3:177129847-177129869 AAAAATGCACATATCCAGCAGGG + Intronic
967665531 3:192167497-192167519 GGAAAAGCACAGTACCAGCTAGG + Intronic
967941977 3:194773136-194773158 AGAAATGCCCAGATTCAGAATGG - Intergenic
969442613 4:7226354-7226376 GGACACGCAGAGGTCCAGCAAGG - Intronic
971244802 4:24917867-24917889 GGAAACGCAGAGAGGCAGCAGGG + Intronic
971707210 4:30060539-30060561 GAAAATGCACAGCGACAGCAGGG + Intergenic
971876754 4:32318356-32318378 GGAACTGCACAGCCCCAGAAAGG + Intergenic
972244647 4:37232863-37232885 GGAAATGCAAAAATCTAGAATGG - Intergenic
978867135 4:113526854-113526876 CAAAATGCCCAGATCCTGCATGG - Intronic
978977870 4:114901210-114901232 AGAAATGGACAGATTCATCAGGG - Intronic
979547187 4:121951642-121951664 GGAAGTGCAAAGAACAAGCAAGG - Exonic
981171771 4:141633524-141633546 GGAAATTGACTGACCCAGCAAGG - Intergenic
981924394 4:150122386-150122408 GCAAATGCACATATACACCATGG + Intronic
983848260 4:172545668-172545690 GGACCTGCTCAGATCCAGCATGG + Intronic
984018104 4:174450086-174450108 GGAAATGTCCATTTCCAGCAGGG + Intergenic
985140699 4:186837653-186837675 GAAAATGCACATATACACCATGG - Intergenic
985298906 4:188466205-188466227 GGAAATGCAGAAATCCAGGCAGG - Intergenic
986411627 5:7487174-7487196 TGAATTCCAGAGATCCAGCATGG - Intronic
991229398 5:64313514-64313536 GGAAATGTACACATACACCATGG - Intronic
991416448 5:66397645-66397667 AGGAATTCACAGTTCCAGCAAGG + Intergenic
991958161 5:72016216-72016238 GGAAATGCAGAGATCCACAGAGG - Intergenic
996642580 5:125774801-125774823 GGAAATGCAGAGATAAGGCAAGG - Intergenic
998992548 5:147833873-147833895 GGAAATGACCAGATTGAGCAAGG - Intergenic
999378957 5:151106603-151106625 GGAAATGCATCTATCCAGGAAGG - Intronic
999565017 5:152849572-152849594 AGAAATGGACAGATCTAGCAGGG - Intergenic
1000134926 5:158338030-158338052 AGTAATTGACAGATCCAGCAGGG - Intergenic
1000960351 5:167593801-167593823 AGAAATGCAAAGATCCACAATGG - Intronic
1001398802 5:171434630-171434652 GGACATGCATACAACCAGCAGGG + Intronic
1001677216 5:173528601-173528623 GGATGTGCACACATCCAGCTAGG - Intergenic
1003748411 6:9027896-9027918 ACCAATGCACAGATCCAGGAAGG + Intergenic
1003978717 6:11369129-11369151 GGAAATGGACAGATTCAAGAAGG - Intronic
1004727325 6:18323816-18323838 TAAAATGCACAGAACCACCAAGG - Intergenic
1005228312 6:23669725-23669747 TGAAACATACAGATCCAGCAGGG - Intergenic
1005505481 6:26465625-26465647 GGAAATGCACAGCAGCAGCAAGG + Intronic
1006350071 6:33514417-33514439 GGGAAGTGACAGATCCAGCATGG - Intergenic
1006453324 6:34117848-34117870 GGAAATACATAGATGCAGCCAGG + Intronic
1007247434 6:40472591-40472613 GGAAGTGCACAAATCCAGCTCGG - Intronic
1011090113 6:83588536-83588558 GTATATGGACAGGTCCAGCAGGG - Intronic
1012733054 6:102905773-102905795 GGAAAGTGACAGTTCCAGCAAGG - Intergenic
1014239436 6:118998733-118998755 AGAACTGCAAGGATCCAGCATGG + Intronic
1015842437 6:137489332-137489354 GGACAGGCCCAGATCCTGCACGG + Intergenic
1017596423 6:156033974-156033996 AAAAATCCACAGATCCAGGAAGG - Intergenic
1023141054 7:37102767-37102789 AGAAATAAACAGACCCAGCATGG + Intronic
1023880804 7:44320256-44320278 GGAAAAGCACAAATACATCATGG + Intronic
1024298227 7:47863270-47863292 GAAACTGCACAGACCCAGCATGG - Intronic
1025847932 7:65217253-65217275 GGCAATGCACAGATCCGGGGGGG - Intergenic
1027544351 7:79507687-79507709 GGAAATGCACAGTTACACCTTGG + Intergenic
1027595099 7:80163372-80163394 GGACATGTAGAGATCAAGCAAGG - Intronic
1029087506 7:98022817-98022839 GGAATTGCACTTTTCCAGCAGGG + Intergenic
1032186201 7:129728727-129728749 GGAAATGCAAAGAGCCATCGTGG + Intronic
1032429900 7:131852240-131852262 GGACATGCACAACTCCAGTAAGG - Intergenic
1032850550 7:135791546-135791568 GGAAATGCACAGATTCATCTAGG - Intergenic
1034838526 7:154374470-154374492 GGGAATGCACAGTTCCTGCGGGG - Intronic
1035280461 7:157775349-157775371 GGGACTGCCCAGACCCAGCAGGG - Intronic
1036550894 8:9814415-9814437 GGAGAAGCACAGATTCAACATGG - Intergenic
1036903486 8:12689101-12689123 GGAATTCCACAAACCCAGCAAGG + Intergenic
1036926072 8:12907400-12907422 GGGAGTGCTCAGATCCTGCAAGG - Intergenic
1038345393 8:26727481-26727503 GAAAATGAGCAGATCCATCAAGG - Intergenic
1038991547 8:32873748-32873770 GCATTTGCACAGATGCAGCAGGG + Intergenic
1043412825 8:80016877-80016899 AGAAAAGGACAGATCCAGCAGGG + Intronic
1044538159 8:93381288-93381310 GCAAATCCAAAAATCCAGCAAGG + Intergenic
1048171540 8:132111368-132111390 GACAATGCACTGATTCAGCATGG + Intergenic
1050726122 9:8651218-8651240 GAAAATGCAGAGATCCATCGTGG - Intronic
1051016783 9:12486780-12486802 AGAAATGGACAGTTTCAGCAAGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1054735064 9:68742740-68742762 GAAACAGCAAAGATCCAGCATGG - Intronic
1054997098 9:71404605-71404627 GGAAAAGACCAGAGCCAGCAAGG - Intronic
1055526375 9:77137971-77137993 GGAAATGAATAGTTCCTGCAGGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056881264 9:90396005-90396027 GGAGAAGCACAGGTCCAGGAAGG - Intergenic
1057212570 9:93208213-93208235 GGAAACGTCCAGTTCCAGCACGG - Intronic
1057478088 9:95421670-95421692 GGAAAGCCACAGTTACAGCATGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058145625 9:101407891-101407913 GGAAATACAAAGATCAACCAAGG - Intronic
1058814913 9:108674214-108674236 GCAAATGCACAGAGCAAGAAGGG + Intergenic
1185841179 X:3392735-3392757 GAAAATGCACATATACACCATGG + Intergenic
1188901699 X:35740569-35740591 GGAAATGCACAGAGATAACATGG - Intergenic
1190335509 X:49259383-49259405 GATCATGCACGGATCCAGCATGG + Intronic
1190790153 X:53691658-53691680 GAAAATGCACAGCTCTGGCAAGG - Intergenic
1192742552 X:73907268-73907290 GAAAATGCACATATACACCATGG - Intergenic
1193154656 X:78159243-78159265 AGAAACCCACAGAACCAGCAAGG + Intergenic
1194423305 X:93704115-93704137 GGAAATACATAGCTCCAGCAAGG - Intronic
1194491269 X:94552547-94552569 GGAAAATCACAGAAGCAGCAAGG - Intergenic
1194864209 X:99046191-99046213 AAAAATGGACAGATCCAGCAAGG - Intergenic
1195268585 X:103209162-103209184 AGTAATAGACAGATCCAGCAGGG - Intergenic
1196198000 X:112855363-112855385 GGAAGTGCTGAGATCGAGCAAGG + Intergenic
1197175326 X:123479627-123479649 GGAAAAGGACAGACCCAGAAGGG - Intronic
1198551634 X:137751534-137751556 GGAAAGGCAAAGATGGAGCAGGG - Intergenic
1199673775 X:150167321-150167343 GCAATTGCACAGATGCATCATGG - Intergenic
1199708662 X:150452373-150452395 GGAAATGCATAGACCTAACATGG + Intronic
1201355579 Y:13093918-13093940 GAAAATGCACAAATAAAGCAAGG + Intergenic
1201771807 Y:17623041-17623063 CCAAATGAACAGATCCAGCATGG + Intergenic
1201829748 Y:18282945-18282967 CCAAATGAACAGATCCAGCATGG - Intergenic