ID: 1092567305

View in Genome Browser
Species Human (GRCh38)
Location 12:9681369-9681391
Sequence TTGCTATTTTTCATGAAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 693
Summary {0: 1, 1: 0, 2: 5, 3: 36, 4: 651}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092567305_1092567308 30 Left 1092567305 12:9681369-9681391 CCTTGTTTCATGAAAAATAGCAA 0: 1
1: 0
2: 5
3: 36
4: 651
Right 1092567308 12:9681422-9681444 AAGTGGCTGTATAACATCACAGG 0: 1
1: 0
2: 4
3: 51
4: 164
1092567305_1092567307 13 Left 1092567305 12:9681369-9681391 CCTTGTTTCATGAAAAATAGCAA 0: 1
1: 0
2: 5
3: 36
4: 651
Right 1092567307 12:9681405-9681427 AAGTACACAAAACTACTAAGTGG 0: 1
1: 0
2: 1
3: 49
4: 558

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092567305 Original CRISPR TTGCTATTTTTCATGAAACA AGG (reversed) Intronic
900157632 1:1209660-1209682 TTTCTATTTTTCATAGAAAAGGG + Intergenic
901456471 1:9365919-9365941 TTGCTCTCTTTCCTGAAACCAGG - Intronic
901939351 1:12650364-12650386 TTGCTCTTTTTCATTGAACACGG + Intronic
902092998 1:13918836-13918858 TTTTTATTTTTTTTGAAACAGGG + Intergenic
903422448 1:23227690-23227712 TTGCTTTTTTTTTTAAAACAAGG - Intergenic
903688944 1:25156068-25156090 TTGTTTTTTTTTTTGAAACAGGG - Intergenic
904521657 1:31100593-31100615 TTCCTTTTTTTTCTGAAACATGG - Intergenic
904658173 1:32064964-32064986 TAGCTATTTTTATTAAAACATGG - Intergenic
905373297 1:37499142-37499164 TTTTTTTTTTTCTTGAAACAAGG - Intronic
905444805 1:38020108-38020130 TTTTTATTTTTCTTGAGACAGGG + Intronic
906348712 1:45038611-45038633 TTTTTTTTTTTAATGAAACAGGG + Intronic
906388630 1:45394145-45394167 TTGCTTTTTTTTTTGAGACAAGG + Intronic
907218908 1:52890611-52890633 TTACTTTTTTTTTTGAAACAGGG + Intronic
907424958 1:54373758-54373780 TTTTTTTTTTTCTTGAAACAGGG - Intronic
908018362 1:59871821-59871843 TAGTTATTCTTCCTGAAACATGG + Intronic
908078699 1:60549627-60549649 TTGTTATTTTTCAAGAAATTGGG + Intergenic
908281261 1:62538314-62538336 TTTCTACTTCTCATAAAACAGGG + Intronic
908374191 1:63516701-63516723 TTTTTTTTTTTCATGAAACAAGG - Intronic
908849641 1:68362855-68362877 TTGTTGTGTTTCAGGAAACAGGG + Intergenic
909626867 1:77726637-77726659 TTTTTTTTTTTCCTGAAACAGGG - Intronic
909646714 1:77924664-77924686 TTTCTTTTTTTCTTGAAACAGGG + Intronic
909727613 1:78854384-78854406 TAGCTCATTTTCATGAATCAGGG + Intergenic
909981423 1:82106034-82106056 TAGCTACTTTTCATGAAATATGG + Intergenic
910040271 1:82842858-82842880 TTGCTTTATTTTATAAAACAGGG - Intergenic
910527159 1:88193330-88193352 AAGCTATTTTTCAGGAAAGAGGG + Intergenic
910535829 1:88296326-88296348 TTGTTATTCTTCATTATACATGG - Intergenic
910857435 1:91709766-91709788 TTTTTATTTTTCTTGAGACAGGG + Intronic
910882468 1:91934566-91934588 TTGTTTTTTTTTTTGAAACAGGG + Intergenic
911588523 1:99719012-99719034 TTGCTAATTTTCATTAAAAATGG - Intronic
912370155 1:109167613-109167635 TTTCTTTTTTTTAAGAAACAAGG + Intronic
912538254 1:110392398-110392420 TTTCTTTTTTTCTTGAGACAGGG + Intergenic
914696343 1:150084501-150084523 TTGTCATTTCTCAGGAAACATGG - Intronic
915395967 1:155584350-155584372 TTTTTATTTTTCTTGAGACAGGG - Intergenic
915406936 1:155667177-155667199 TTTGTATTTTTCTTGAGACAAGG - Intronic
915411611 1:155705277-155705299 TTGTTATTTTTCTTGAGACAGGG - Intronic
916231122 1:162542336-162542358 TTTTTATTTCTCATGAAAAAAGG + Intergenic
916966522 1:169950177-169950199 TTGCTAATTTGTATGACACAAGG - Intronic
917284293 1:173408173-173408195 TGGCTCTTTTTCATGGAAAATGG - Intergenic
917361311 1:174179080-174179102 TTTTTATTTTTCAAGAGACAGGG + Intronic
917776951 1:178348292-178348314 TTTCTTTTTTTCTTGAGACAAGG + Intronic
918103070 1:181393462-181393484 TTTCTTTTTTTTCTGAAACAGGG + Intergenic
918556829 1:185811587-185811609 TTTTTATTTTTCAAGAGACAGGG - Intronic
919017193 1:192053959-192053981 TTGCTTTTTATAATGAAAAATGG - Intergenic
919252889 1:195082164-195082186 TTACTAATTTTCATCAAACAAGG - Intergenic
919689059 1:200512343-200512365 TAGCTTTATTTCATGAAACATGG - Intergenic
919856582 1:201710291-201710313 TTGTTTTTTTTTTTGAAACAGGG + Intronic
920235700 1:204502698-204502720 TTTGTATTTTTAATGAGACAGGG - Intergenic
920439760 1:205972009-205972031 ATGCTATCTTTCCTGTAACAGGG - Intergenic
920899765 1:210096582-210096604 TTCCTATTTATGATGTAACAAGG + Intronic
922018826 1:221683081-221683103 TTACATTTTTTCATGATACATGG - Intergenic
923041230 1:230321348-230321370 TTGTTTTTTTTCTTGATACAGGG + Intergenic
923328389 1:232900239-232900261 TTGCTATTATTCATGCCACAGGG + Intergenic
923589692 1:235308413-235308435 TTTCTAATTTTTAAGAAACAGGG + Intronic
923593411 1:235340435-235340457 TTGCTTTTTTTTTTGAGACAGGG - Intronic
924085632 1:240448812-240448834 TTACTATTTTTTTTAAAACAGGG - Intronic
924426673 1:243957583-243957605 TCTCTATTTTCCATGAAACCAGG + Intergenic
1063110728 10:3034799-3034821 TCACTATTTTTCCTGAATCATGG - Intergenic
1063402128 10:5755983-5756005 TTGCTTTTTTTTTTGAGACATGG - Intronic
1063466048 10:6245421-6245443 TTACTATTATTTTTGAAACAGGG + Intergenic
1063840075 10:10061356-10061378 TTTTTTTTTTTCAAGAAACAAGG + Intergenic
1063914707 10:10869662-10869684 TTGTAATTTTTCATAAAACCAGG - Intergenic
1064040508 10:11958749-11958771 TTTGTATTTTTCTGGAAACAGGG - Intronic
1064095701 10:12423034-12423056 TTGCTTTTGTACATGAAACTTGG + Intronic
1064125515 10:12656485-12656507 TTTCTCTTTTTTTTGAAACAGGG - Intronic
1064253734 10:13726900-13726922 TTGCTTTTTTTTCTGAGACAGGG + Intronic
1064567687 10:16659010-16659032 TTGCTAATATACATGAAAAATGG - Intronic
1064826411 10:19407472-19407494 TTATTATTTTTTAAGAAACAGGG - Intronic
1065095042 10:22272083-22272105 ATGCTCTTTTTATTGAAACAGGG + Intergenic
1065298463 10:24299416-24299438 TTCCTTTTTTTCTGGAAACAGGG + Intronic
1065694434 10:28366888-28366910 TTTTTATTTTTTATGACACAGGG - Intergenic
1065809649 10:29429820-29429842 TTTCTATTTTTAAAGAAATATGG + Intergenic
1066120662 10:32283321-32283343 TTTCTTTTTTTTTTGAAACAGGG + Intronic
1066617436 10:37309525-37309547 TTTCTATTTTTTAAGATACAGGG - Intronic
1068079230 10:52299023-52299045 TTTCTAGTTTTCATCAAACAAGG - Intergenic
1068217099 10:53996252-53996274 TTGCCATTTTACATGATAAAAGG + Intronic
1068986471 10:63112060-63112082 TTTCTATTTTTTTTGAGACAGGG - Intergenic
1069338462 10:67382003-67382025 TATCTATTTTTCATTGAACATGG - Intronic
1069471448 10:68694427-68694449 ATGCTCTTTCTCATGAAGCAAGG + Exonic
1069668614 10:70182532-70182554 TTATTATTTTTCTTGAGACAAGG - Intergenic
1070266887 10:74911834-74911856 TTATTATTTTTTAAGAAACAGGG + Intronic
1070420988 10:76237175-76237197 TTGCTATTTTTTAAGAGACAGGG - Intronic
1070457126 10:76628387-76628409 TTGCTATTTTTCAAGAACTGTGG + Intergenic
1070532116 10:77346037-77346059 TTCCTATTTTCCATGATGCAGGG - Intronic
1070995754 10:80779220-80779242 GTGCTCTTTCTCATAAAACATGG - Intergenic
1070998784 10:80811172-80811194 TTTCTCTTTCTCATAAAACAAGG + Intergenic
1071070528 10:81687073-81687095 TTTTTGTTTTTAATGAAACATGG - Intergenic
1071123415 10:82306774-82306796 TTGCTTTTTTTGATGGGACAGGG + Intronic
1071392308 10:85188226-85188248 TTTCTTTTTTTCCTGAAACGTGG + Intergenic
1071714539 10:88082017-88082039 TTCCCATTTTTCATAAAATATGG - Intergenic
1071775299 10:88780119-88780141 TTGCTATTTTTAATAGAACAAGG + Intergenic
1072506207 10:96070148-96070170 TTTCTTTTTTTCTTGAGACAGGG + Intergenic
1073548474 10:104374442-104374464 TTTTTTTTTTTCCTGAAACAAGG - Intronic
1073907923 10:108305911-108305933 TTTCTATTTTTAGTGAGACAAGG - Intergenic
1075607516 10:123823915-123823937 ATGCTACTTTTAATAAAACATGG - Intronic
1075916403 10:126171314-126171336 TCTCTATTTTTCATGACCCAGGG - Intronic
1076165292 10:128277389-128277411 TTGCTATTTTTCCTGTAATTAGG - Intergenic
1078808571 11:14734076-14734098 TTTCTTTTTTTCTTGAGACAGGG + Intronic
1079470150 11:20770338-20770360 TTGCTGTTTTTCTTTAAAAATGG - Intronic
1080119623 11:28662181-28662203 TTCTTATTTTTTATGAAAAAAGG + Intergenic
1080135817 11:28853308-28853330 TTGATACTTTTCCTGAAAGAAGG - Intergenic
1080270888 11:30449632-30449654 TTTCTTTTTTTATTGAAACAAGG - Intronic
1082833301 11:57635282-57635304 TTTCTATTTTTGAAAAAACAAGG + Intergenic
1082902533 11:58270834-58270856 TTGCTATTTCTCATATGACATGG + Intergenic
1083243389 11:61406747-61406769 TTACTATTTTTTTTGAGACAGGG + Intronic
1084348795 11:68578240-68578262 TTGCGTATTTTCCTGAAACATGG - Intronic
1085009174 11:73124791-73124813 TTGATGCTTTTCATGAAACCTGG - Intronic
1085129959 11:74029759-74029781 TTGTTATGTTTTTTGAAACAGGG + Intronic
1085228652 11:74945967-74945989 TTTCTTTTTTTCTTGAGACAAGG + Intronic
1085926007 11:81021844-81021866 TTTCCAGTTTTCATTAAACAAGG + Intergenic
1086102856 11:83119574-83119596 TTTTTATTTTTAAAGAAACAAGG + Intergenic
1086121645 11:83310949-83310971 TTGCTATTTCTCAGGGAATAGGG + Intergenic
1086775558 11:90828198-90828220 TTGCTAGTGTGAATGAAACAAGG + Intergenic
1087027006 11:93660033-93660055 TTGTTATTACTCATGTAACAAGG + Intergenic
1087713046 11:101576664-101576686 TTGGCATTTTTTATGAAAGAGGG + Intronic
1089971790 11:122699588-122699610 TTTCTTTTTTTTTTGAAACAAGG + Intronic
1090109805 11:123894871-123894893 TTTCTTTTTTTTAAGAAACAAGG - Intergenic
1090479294 11:127053998-127054020 TTTCTTTTTTTCAAGAGACAGGG + Intergenic
1090578488 11:128133991-128134013 TTCCTATTTCTCATGACACCTGG + Intergenic
1090800989 11:130172119-130172141 TTGCTTTTTTTTTTGAGACAGGG + Intronic
1092567305 12:9681369-9681391 TTGCTATTTTTCATGAAACAAGG - Intronic
1092959891 12:13586178-13586200 CTGCTATGTGTCATGATACAGGG + Intronic
1093241011 12:16674578-16674600 TTCTCATTTTTCATAAAACATGG + Intergenic
1093648426 12:21616056-21616078 TTCTTTTTTTTCAAGAAACAGGG + Intergenic
1094086975 12:26604499-26604521 CTGCTGTTTTACAAGAAACAGGG - Intronic
1094112495 12:26876423-26876445 TTGCTATGCCTCAGGAAACAGGG - Intergenic
1095320636 12:40821550-40821572 TAGCTCATTTTCATGAAACCTGG + Intronic
1096342445 12:50812815-50812837 TGGCTATTTTTTTTGAGACAGGG - Intronic
1097842642 12:64336923-64336945 TTGTTATATTACATGAAATAAGG - Intronic
1098002398 12:65959353-65959375 TTTCTTTTGTTCATGAAAAAAGG - Intronic
1098299345 12:69038006-69038028 TGGAGATTTTTAATGAAACAGGG - Intergenic
1098377091 12:69828087-69828109 TTACAATTTTTCTTGACACATGG - Intronic
1098522158 12:71445361-71445383 TTGCTATTTTTGATGTATCTTGG + Intronic
1099068954 12:78021426-78021448 TTGCTATTTTAGAGGAAATATGG - Intronic
1100077354 12:90802017-90802039 TTGCTAGCTATCATTAAACAGGG - Intergenic
1100392531 12:94156482-94156504 TTTTTTTTTTTCTTGAAACAGGG + Intronic
1100732653 12:97489438-97489460 TTTCTTTTTTTCTTGAGACAGGG - Intergenic
1100917193 12:99437555-99437577 TTGATTTCTATCATGAAACAGGG + Intronic
1100994322 12:100286458-100286480 TTTCTTTTTTTCAAGAAAAAAGG - Intronic
1101414334 12:104496101-104496123 TTTCTATTATTCATTTAACAAGG - Intronic
1101679688 12:106953531-106953553 ATTTTATTTTTCTTGAAACAGGG + Intergenic
1101720760 12:107348716-107348738 TTTCTCTTTTTTATGAGACAGGG - Intronic
1101722335 12:107360758-107360780 TTTGTATTTTTTCTGAAACAAGG + Intronic
1101801370 12:108025067-108025089 TTTCTATTTTTTTAGAAACAGGG + Intergenic
1101931632 12:109019286-109019308 TTGCTTTTTTTAATTAAAGAAGG + Intronic
1102356208 12:112238220-112238242 TTACTTTTTTTTTTGAAACAGGG + Intronic
1102986675 12:117284134-117284156 TGGCTTCTTTGCATGAAACATGG - Intronic
1103069703 12:117930905-117930927 TTGTTTGTTTTCTTGAAACAGGG - Intronic
1104002311 12:124867927-124867949 TTTCTTTTTTTCAAGAGACAGGG + Intronic
1104027121 12:125035782-125035804 TAGCCATCTTTCATTAAACAAGG + Intergenic
1104221959 12:126793635-126793657 TTTGTATTTTTGAAGAAACAGGG + Intergenic
1104233733 12:126911390-126911412 TTGCTGTTTTTCATAATAGAAGG + Intergenic
1107101085 13:36593269-36593291 TTCCTATTATTCCTGAAACATGG + Intergenic
1107254770 13:38411398-38411420 TTACTGTTTTTAAAGAAACATGG - Intergenic
1107466016 13:40651109-40651131 TTGTTTTTTTTTAAGAAACATGG + Intronic
1107714382 13:43185230-43185252 CAGATATTTTTCATGAAAAATGG + Intergenic
1107818578 13:44266311-44266333 GTGCTCTTTTTCATGGGACATGG - Intergenic
1107914938 13:45140043-45140065 TTTCTCTTTTTTTTGAAACAGGG + Intronic
1108133779 13:47333001-47333023 TTGTTATTTTTCATAAAACATGG + Intergenic
1108346006 13:49547793-49547815 TTGCTTTTTTTATTGAGACAGGG + Intronic
1108812489 13:54245351-54245373 TTTCTTTTTTTCTTGAGACAGGG - Intergenic
1109969578 13:69749576-69749598 TCGTTAATTTTCATGTAACATGG + Intronic
1110517815 13:76437256-76437278 CTGCTATTTTTCATTATCCATGG - Intergenic
1111229233 13:85319570-85319592 TTGCAATGTGTCATGAATCATGG - Intergenic
1111344379 13:86930636-86930658 TTGCTGATTTTCATAAAACCTGG - Intergenic
1111463162 13:88572604-88572626 TTTTTTTTTTTCATGAGACAAGG - Intergenic
1111569466 13:90063548-90063570 TAGCTGTTTTTTATTAAACATGG + Intergenic
1112031932 13:95464736-95464758 TTGCTTTTTTTTTTGAGACAGGG + Intronic
1112265847 13:97922564-97922586 TTTCTTTTTTTCCTGAGACAGGG - Intergenic
1112970103 13:105251328-105251350 TATCTATATTTCATGGAACAAGG - Intergenic
1113626545 13:111852222-111852244 TTTCTTTTTTTTTTGAAACAGGG - Intergenic
1114213667 14:20638332-20638354 TTTTTATGTTTCATGAAACTAGG + Intergenic
1114329181 14:21618816-21618838 CTACTAATTTTTATGAAACATGG + Intergenic
1114592524 14:23880168-23880190 TTGCTATTTGTGAATAAACATGG - Intergenic
1115125541 14:29988707-29988729 TTTCTGTTGTTCATGAAGCAAGG - Intronic
1115207977 14:30933270-30933292 TTTTTTTTTTTTATGAAACAGGG - Intronic
1115426406 14:33265088-33265110 TTGGTAGCTTTCTTGAAACAAGG + Intronic
1115702324 14:35966191-35966213 TAGCTATGTTTCATGATACTGGG + Intergenic
1117109540 14:52435970-52435992 TTGTTATTTTTTTTGAGACAGGG - Intronic
1117120445 14:52562584-52562606 TTGCTGTTTTTTAAGAGACAGGG - Intronic
1117574762 14:57086918-57086940 TTCCTATTTTCCATGTAAAAGGG + Intergenic
1117574881 14:57087896-57087918 TTGGTAGTTTTCCTGATACACGG - Intergenic
1118725420 14:68625477-68625499 TATTTATTTTTTATGAAACAGGG + Intronic
1118872020 14:69751058-69751080 TTTCTTTTTTTCAAGAGACAGGG + Intronic
1119108293 14:71945578-71945600 TATCTATTTTTCTTGAAATATGG + Intronic
1119113320 14:71995741-71995763 TTATTATTTTTCATGACGCACGG + Intronic
1119456095 14:74756738-74756760 TTTCTTTTTTTCTTGATACAGGG + Intergenic
1119663915 14:76470692-76470714 TTGCTGTTTTTAAAGAGACAAGG + Intronic
1119758734 14:77136771-77136793 TTTCTTTTTTTCTTGAGACAGGG + Intronic
1119849734 14:77858644-77858666 TTGCTACGTTTTATAAAACATGG - Intronic
1119897158 14:78230029-78230051 TTTGTATTTTTCTTGAGACAGGG + Intergenic
1119918720 14:78426495-78426517 TTACTATGTTTTATGTAACAGGG + Intronic
1120023071 14:79552030-79552052 TTGCCATTTCTAATGAACCACGG - Intronic
1120024086 14:79562917-79562939 TTTCAATTCTTCATAAAACATGG + Intronic
1121076000 14:91068777-91068799 GTCCCATTTTTAATGAAACAAGG + Intronic
1121271718 14:92642108-92642130 TTTCTTTTTTTTTTGAAACAGGG + Intronic
1121824088 14:96996352-96996374 TTGCCATTTTCAATTAAACATGG - Intergenic
1123884550 15:24712197-24712219 TTACTATTTTTCATGTATCCAGG + Intergenic
1124993649 15:34701113-34701135 TTCCTATTTTCCAGGAAACAAGG + Intergenic
1125486752 15:40116447-40116469 TTATTTTTTTTCTTGAAACAGGG + Intergenic
1126058992 15:44760562-44760584 TTGCGATTTTTCATTAAATCAGG - Intronic
1126288393 15:47043121-47043143 TTGCTCTTTTTCAGAAAAAAAGG + Intergenic
1126604761 15:50464845-50464867 TTGTTTTTTTTCTTGAGACAGGG - Intronic
1127476677 15:59340300-59340322 TTGCTATTTTTTTTGAGACAAGG - Intronic
1127478459 15:59356607-59356629 TTGTTGTTTTTCCTGAAACAGGG + Intronic
1127499719 15:59544726-59544748 TCTTTATTTTTCTTGAAACATGG + Intergenic
1128028999 15:64462594-64462616 TTTTTATTTTTAAAGAAACAGGG - Intronic
1129414200 15:75366201-75366223 TTGCTATTATTTTTGAGACAAGG + Intronic
1129570447 15:76677845-76677867 TTCCTATTTTTTAAGAGACATGG + Intronic
1129810027 15:78502867-78502889 TTATTATTTTTTAAGAAACAGGG - Intergenic
1130157996 15:81369915-81369937 TTGTTGTTTGTTATGAAACAGGG - Intronic
1130712141 15:86293835-86293857 TAGTTATTTGTCAAGAAACAAGG + Intronic
1131045274 15:89309710-89309732 TTTTTATTTTTCTTGAGACAGGG - Intronic
1131574981 15:93579669-93579691 TTGCTCTTTTTCATCAAATTTGG - Intergenic
1131616730 15:94024061-94024083 TTGCTCTTTTTCATAAAACATGG - Intergenic
1133437850 16:5795308-5795330 TTTTTTTTTTTCTTGAAACAAGG + Intergenic
1133508205 16:6432673-6432695 TTATTATTTTTCTTGAGACAGGG - Intronic
1133941120 16:10309953-10309975 TTTCTTTTTTTTTTGAAACAGGG + Intergenic
1134009910 16:10844143-10844165 TTGTTATTTTTTTTGAAACAGGG + Intergenic
1134046033 16:11101807-11101829 TTTCTTTTTTTTTTGAAACAGGG + Intronic
1134265604 16:12690201-12690223 ATGGTGTCTTTCATGAAACAGGG - Intronic
1134682291 16:16134641-16134663 TTTTTTTTTTTCCTGAAACAGGG + Intronic
1134795005 16:17027076-17027098 ATGCTATTATTCATGCAACCTGG - Intergenic
1135081642 16:19441324-19441346 TTTTTATTTTTCTTGAGACAGGG + Intronic
1135659131 16:24279298-24279320 TTTTTATTTTTCTTGAGACAGGG + Intronic
1135710642 16:24714060-24714082 TTTATAGTTTTCATGAAACTTGG + Intergenic
1136220600 16:28825208-28825230 TTTCTATTTTTTTTGAGACAGGG - Intronic
1136561360 16:31040979-31041001 TTGCTATTATTTTTGAGACAGGG - Intronic
1137762454 16:50951408-50951430 TTGTTTTTTTTACTGAAACATGG + Intergenic
1137962289 16:52894767-52894789 TTGATTTTTTTCAAGAGACAGGG - Intergenic
1138067618 16:53958558-53958580 TTGATATTTTACAGGGAACATGG - Intronic
1138464397 16:57177357-57177379 TTTTTTTTTTTCGTGAAACAGGG + Intronic
1138593180 16:58014235-58014257 TTACGATTTTTCCTGAAATATGG + Intronic
1139218076 16:65149071-65149093 TTGCAATTTCTTTTGAAACAGGG + Intergenic
1139502563 16:67379404-67379426 TTATTATTTTTCTTGAGACAGGG - Intronic
1139600842 16:67985973-67985995 TTTTTATTTTTCCTGAGACAGGG - Intergenic
1139608762 16:68039721-68039743 TTGCTTTTTTTCAAGAAACAGGG - Intronic
1139626594 16:68194587-68194609 TTGCTTTTTACCCTGAAACAAGG + Intronic
1139782555 16:69363973-69363995 TTTCTTTTTTTCTTGAGACAGGG - Intronic
1140517103 16:75551211-75551233 TTTCTTTTTTTCTTGATACAGGG + Intronic
1140768896 16:78185272-78185294 GTTCTATTTTTAATGCAACATGG + Intronic
1140956564 16:79871882-79871904 AGGCTTCTTTTCATGAAACATGG + Intergenic
1141484355 16:84328944-84328966 TTTTTTTTTTTCTTGAAACAGGG - Intronic
1142822460 17:2481199-2481221 TTTCTTTTTTTTCTGAAACATGG - Intronic
1142840593 17:2625934-2625956 TTTCTGTTTTTCTTGAGACAGGG - Intronic
1143262231 17:5607946-5607968 TTTTTTTTTTTCTTGAAACAGGG - Intronic
1143425092 17:6829518-6829540 TTTTTTTTTTTTATGAAACAGGG + Intronic
1143666403 17:8364361-8364383 TTTCTTTTTTTCTGGAAACAGGG + Intergenic
1143851583 17:9816241-9816263 TTGCTGTTGTCCATGAATCATGG + Intronic
1144132839 17:12264705-12264727 TTTCTTTTTTTCACAAAACAAGG + Intergenic
1144799831 17:17918513-17918535 TTGCAATTTTTTATGGAATAAGG - Intronic
1145744472 17:27304703-27304725 TTCTTATTTTTCTTGAGACAGGG - Intronic
1146201577 17:30863179-30863201 TTTCTTTTTTTCTTGAGACAGGG - Intronic
1147257451 17:39190392-39190414 TTATTATTTTTTATGAGACAGGG - Intronic
1147352264 17:39858979-39859001 TTATTATTTTTTATGAAACAGGG + Intronic
1147733850 17:42621377-42621399 TTTTTATTTTTTTTGAAACAAGG - Intergenic
1148705227 17:49624473-49624495 TTACTATTTTTTTTGAGACAGGG + Intronic
1149180965 17:53935515-53935537 TTGCTTTTTTTTTTAAAACAAGG - Intergenic
1149217013 17:54369595-54369617 TATATATTTTTCATAAAACATGG + Intergenic
1149311456 17:55398065-55398087 TTGATATTTTTCATCAAATTTGG + Intronic
1149669822 17:58397224-58397246 TTGCTGTGTTTCATAAAAAATGG - Intronic
1149825325 17:59823076-59823098 TTTCTTTTTTTCAAGAATCAGGG - Intronic
1149885411 17:60334991-60335013 TTGTTATTTTTTAAGAGACAGGG + Intronic
1150153369 17:62829473-62829495 TAGTTATTTTTCATTAAAAATGG - Intergenic
1150175501 17:63050348-63050370 TTTTTTTTTTTCTTGAAACAGGG - Intronic
1150183884 17:63159032-63159054 TTGCTTGCTCTCATGAAACAAGG - Intronic
1150718433 17:67593029-67593051 TTTCTTTTTTTCTTGAGACAGGG - Intronic
1151920533 17:77151620-77151642 TTGAAATTTTCCATAAAACAAGG - Intronic
1152409405 17:80115106-80115128 TTGATGTTTTTCATCAAACTTGG + Intergenic
1152481465 17:80556505-80556527 TTGCTGTTTTTATTGAAGCAGGG - Intronic
1153020673 18:626117-626139 TTATTTTTTTTCATGAGACAGGG + Intronic
1153063884 18:1023128-1023150 TTGTTATTTTTCTTTTAACATGG + Intergenic
1153488066 18:5621391-5621413 TTACTATAATTCAGGAAACATGG + Intronic
1153579277 18:6555717-6555739 TTACTATTTTTCATGTAAACCGG - Intronic
1153813021 18:8768684-8768706 TTGCTTTATTTCATGAAACTAGG + Intronic
1154366054 18:13710188-13710210 TTTCTTTTTTTTTTGAAACAAGG + Intronic
1154417518 18:14189633-14189655 TTTTTTTTTTTCTTGAAACAAGG + Intergenic
1155057261 18:22195718-22195740 TTGCTGTTTTTCACTTAACATGG + Intronic
1155295746 18:24382865-24382887 TTACTATTTTTTTTGAAACAGGG - Intronic
1156001232 18:32386791-32386813 TTGTTGTTTTTCATGACAGAGGG + Intronic
1156726462 18:40134285-40134307 TTGTTAATTTTCATGATTCAGGG + Intergenic
1157639342 18:49197518-49197540 TTTCTTTTTTTCAAGAACCATGG - Intronic
1158708155 18:59812755-59812777 TTGCTTTTGTTTTTGAAACAGGG + Intergenic
1159198225 18:65146385-65146407 TAGTTGCTTTTCATGAAACAAGG - Intergenic
1159305460 18:66636110-66636132 TTGCTATATTTGAAAAAACAAGG - Intergenic
1159928171 18:74287450-74287472 TTGTTATTTTCCATTGAACATGG - Intronic
1161639724 19:5413825-5413847 TTTGTATTTTTAGTGAAACAGGG - Intergenic
1161941618 19:7408268-7408290 TTTCTCTTTTTTTTGAAACAGGG - Intronic
1161985946 19:7654042-7654064 TTTTTATTTTTTATGAGACAGGG - Intergenic
1162124824 19:8493802-8493824 TTTCTTTTTTTCTTGAGACAGGG + Intronic
1162242506 19:9366284-9366306 TTCCTTTTTTTAATGAGACAAGG + Intronic
1162598870 19:11651404-11651426 TTTTTTTTTTTCCTGAAACAGGG - Intergenic
1163080636 19:14939154-14939176 ATGGTATTTTTCTTGCAACATGG + Intergenic
1163261814 19:16195467-16195489 TTGTTTTTTTTTTTGAAACAGGG - Intergenic
1163327179 19:16612289-16612311 TTGGTTTTTTTCTTGAGACAGGG + Intronic
1163344903 19:16734581-16734603 TTTCTGTTTTTCTTGCAACAGGG + Intronic
1163421058 19:17213827-17213849 TGGGTTTTTTTCTTGAAACACGG + Intronic
1163520663 19:17789721-17789743 TTCCTATTTTTGTAGAAACAGGG - Intergenic
1163853675 19:19682391-19682413 TTGGTATTTTTGTAGAAACAGGG + Exonic
1164026229 19:21355747-21355769 TTTTTTTTTTTCTTGAAACAGGG + Intergenic
1164474571 19:28565321-28565343 TTATTATTTTGCAGGAAACAGGG - Intergenic
1165101871 19:33443547-33443569 TTGCCATTTATCATGGCACATGG - Intronic
1165271213 19:34709320-34709342 TTGTTATTTTTTAAGAGACAGGG + Intergenic
1165538320 19:36468906-36468928 TTACTTTTTTTTTTGAAACAGGG - Intronic
1165715860 19:38045563-38045585 TTTCTTTTTTTCCTGAGACAAGG - Intronic
1165738049 19:38189757-38189779 TTTCTATTTTTTTTGAGACAGGG - Intronic
1167440399 19:49505291-49505313 TTACTTTTTTTCTTGAGACAGGG - Intergenic
1167484730 19:49755520-49755542 TTGTTGTTTTTTATGAGACAGGG - Intronic
1168528718 19:57108484-57108506 TTGCTTTTTTTTTTGAGACAGGG - Intergenic
1168675171 19:58272547-58272569 TTTTTATTTTTAAAGAAACAGGG - Intronic
925618594 2:5768273-5768295 TTGATTTATTTCATGAGACAAGG + Intergenic
925965648 2:9062891-9062913 TTTCTTTCTTTCTTGAAACAGGG - Intergenic
926126544 2:10275877-10275899 TTTGTATTTTTAGTGAAACAGGG - Intergenic
926406664 2:12560157-12560179 TTTCTATTTTTAAAGACACAGGG + Intergenic
926469791 2:13239500-13239522 TTGCTGTGTTTCATGTAATAGGG + Intergenic
927823364 2:26288700-26288722 TTTCTGTTTTTTTTGAAACAGGG - Intronic
928111339 2:28511736-28511758 TTGATATTTTTCATCAAATGTGG + Intronic
928721302 2:34124783-34124805 TTGCTACTTTTCCTGAATCCTGG + Intergenic
928743188 2:34380011-34380033 ATGCTATTTCTCAAGCAACATGG + Intergenic
929083330 2:38143230-38143252 TTGATATTTTTCATCAAATTTGG + Intergenic
930743278 2:54855726-54855748 GTTCTACTTTTCATGACACATGG + Intronic
930950035 2:57129334-57129356 TTTTTATTTTTCATGGATCATGG + Intergenic
930994872 2:57704377-57704399 TTGTTGTTTTTCTTGAGACAGGG + Intergenic
931380063 2:61744446-61744468 TTATTATTTTTTTTGAAACAGGG - Intergenic
931563000 2:63583804-63583826 ATCCTATTTTATATGAAACATGG - Intronic
932255720 2:70284388-70284410 TTATTATTTTTTTTGAAACAGGG + Intronic
932300463 2:70663450-70663472 TTGCTCTTTTTCAGGAAGGAGGG + Exonic
932547415 2:72728632-72728654 TTGCCATTTTTCAAGAACAAGGG + Intronic
932808713 2:74805992-74806014 TTTTTTTTTTTCATTAAACAGGG + Intergenic
933153915 2:78949584-78949606 TTGTTATTTTTAATGAGAAAGGG - Intergenic
933621931 2:84553467-84553489 TTTCTTTTTTTTTTGAAACAGGG + Intronic
936005318 2:108881969-108881991 TTGCTCTTTTTGTAGAAACAGGG - Intronic
937129244 2:119494939-119494961 TTTCTATTTTTCTAGAGACAGGG + Intronic
938024342 2:127932919-127932941 TTGTTATGTTTTTTGAAACAGGG + Intergenic
938545293 2:132323601-132323623 TGGCTTTTTTTCATTCAACATGG + Intergenic
939475768 2:142684974-142684996 TTTCTTTTTTTTTTGAAACAGGG + Intergenic
939760295 2:146167866-146167888 TTACTATTTTTCTTGTATCATGG - Intergenic
939814325 2:146875080-146875102 AGGCTGTTGTTCATGAAACATGG - Intergenic
940168049 2:150796890-150796912 TTTTTTTTTTTCTTGAAACAAGG + Intergenic
940304474 2:152211180-152211202 TTGCACTTTTTCTTGAGACAGGG + Intergenic
940483215 2:154262940-154262962 TTGATACTTATCCTGAAACACGG - Intronic
941103558 2:161325611-161325633 TTGATATTTTTATTGAAACTGGG - Intronic
941130462 2:161642785-161642807 GACCTATTTTTCATGAATCATGG - Intronic
941318909 2:164030505-164030527 TTGGTTTTTTCCAAGAAACAGGG + Intergenic
941555764 2:166979128-166979150 ATGCCTTTTTTCATGGAACATGG + Intronic
942562393 2:177234588-177234610 TTTCTATATTCCATTAAACAAGG - Intronic
942638201 2:178032259-178032281 TTGTTCTTATTCTTGAAACAGGG - Intronic
942935322 2:181549087-181549109 TTGCTATTTCCTATAAAACATGG + Intronic
943554839 2:189389943-189389965 TTGCTAAATTTCATGAAACCTGG + Intergenic
944289301 2:197987072-197987094 TAGCTATTTTTCAGTAAACTTGG - Intronic
945402874 2:209407800-209407822 TTGTTGTTTTTCTTGAGACAGGG - Intergenic
946424757 2:219587926-219587948 TTGCTCTTTTTATTGAGACAGGG - Intergenic
946786370 2:223248486-223248508 TTACTATTTTTTATAAGACATGG + Intergenic
947308682 2:228776508-228776530 TTGCCATTTTTCTTCAACCAAGG - Intergenic
1170622788 20:18009446-18009468 TTTTTTTTTTTCAAGAAACAGGG + Intronic
1170822986 20:19770063-19770085 TTTCTATTTCTCATGGAAGATGG + Intergenic
1171874146 20:30556361-30556383 TGGCTTTTTTTCATTCAACATGG + Intergenic
1172290390 20:33771841-33771863 TTTCTATTTTTGTTGAGACAAGG - Intronic
1172852835 20:37978924-37978946 TTGCTGTTGTTGTTGAAACAGGG - Intergenic
1173450752 20:43161720-43161742 TTGCTTTTTTGCAGGAAAAATGG - Intronic
1173698085 20:45039558-45039580 TTGTCATTTTTCATGTAAAATGG + Intronic
1173845484 20:46185856-46185878 TTGGAATTGTTCTTGAAACAAGG - Intronic
1174194323 20:48762266-48762288 TTGATTTTTTTCCTGAAAAATGG + Intronic
1174791380 20:53481569-53481591 TTTCTATTTTTTTTGAGACAGGG - Intronic
1174832615 20:53826715-53826737 TTTCTTTTTTTCTTGAGACAGGG - Intergenic
1174971364 20:55279569-55279591 TTTTTATTTTTAATGAAAAATGG - Intergenic
1175255165 20:57639931-57639953 TTGATTTTTTTAATGAACCAGGG - Intergenic
1175544328 20:59768590-59768612 TTCCCAGTTTTCATGAAAGAGGG + Intronic
1176330231 21:5542278-5542300 TTTGTATTTTTCATGAAGCTGGG - Intergenic
1176397526 21:6278673-6278695 TTTGTATTTTTCATGAAGCTGGG + Intergenic
1176439631 21:6710431-6710453 TTTGTATTTTTCATGAAGCTGGG - Intergenic
1176463893 21:7037500-7037522 TTTGTATTTTTCATGAAGCTGGG - Intergenic
1176487454 21:7419279-7419301 TTTGTATTTTTCATGAAGCTGGG - Intergenic
1176932313 21:14828521-14828543 TTACTATTTTCAATGTAACAGGG - Intergenic
1177581237 21:23023999-23024021 TTGCTTTTTCTCATGAAAGTGGG - Intergenic
1178035445 21:28577407-28577429 TTTGTCTTTTTCATGAAACATGG - Intergenic
1178302834 21:31467325-31467347 TTTTTATTTTTTAAGAAACAGGG - Intronic
1178834976 21:36089240-36089262 TTTCTTTTTTTTTTGAAACAGGG + Intergenic
1178940190 21:36899052-36899074 TTCCTTTTTTTCTTGAGACAGGG - Intronic
1181134371 22:20754091-20754113 TTTCTATTTTTTTTGAGACAGGG + Intronic
1181146035 22:20847746-20847768 TTGTTTTTTTTTTTGAAACAGGG - Intronic
1182213584 22:28697574-28697596 TTTTTTTTTTTCTTGAAACAAGG + Intronic
1182540567 22:31038668-31038690 TTGGTACTTTTCATGAAGGAAGG + Intergenic
1183892737 22:40943741-40943763 TTTCTTTTTTTTTTGAAACAGGG + Intergenic
1183901450 22:41009095-41009117 TTTCTATTTTTTAAGAGACAGGG + Intergenic
1184188648 22:42880622-42880644 TTTTTATTTTTCATGCCACAAGG - Intronic
949291373 3:2470378-2470400 TTGCTTATTTTTATAAAACAGGG + Intronic
949973887 3:9436302-9436324 TTTTTATTTTTTTTGAAACAAGG - Intronic
950293306 3:11805442-11805464 TTGTTATTTTTAAAGAGACAGGG + Intronic
950376093 3:12573526-12573548 TTATTATTTTTCTTGAGACAGGG - Intronic
951559557 3:23952190-23952212 TTAATATTTTTCCTGCAACATGG - Intronic
951643221 3:24859234-24859256 TTGCAATATCTCTTGAAACAAGG + Intergenic
951736545 3:25872039-25872061 TTCATATTTTACATGAAATATGG - Intronic
951947489 3:28156759-28156781 TTGTTATTTTTCAGTAAAGACGG + Intergenic
952126116 3:30302757-30302779 TTTTTATTTTTTTTGAAACAGGG + Intergenic
952362643 3:32646272-32646294 TTCCTTTGTTTCAGGAAACATGG + Intergenic
952365220 3:32668420-32668442 TTTTTATTTTTCTTGAGACAAGG - Intergenic
953498503 3:43409533-43409555 TTCTTATTTTTATTGAAACAGGG - Intronic
953669385 3:44949840-44949862 TTTCTTTTTTTTTTGAAACAGGG + Intronic
953862174 3:46554024-46554046 TTGTTTTTTTTCCTGAGACAGGG + Intronic
953934698 3:47030530-47030552 TTGGTAGTTTTCATCAAATATGG - Intronic
954626910 3:52027173-52027195 ATGCTCTTTCTCATGAAGCAAGG + Intergenic
954727250 3:52623290-52623312 CTGTTATTTTTTAGGAAACAGGG - Intronic
955675490 3:61443819-61443841 TAGCTATTTTACTTGAAACTTGG - Intergenic
957032386 3:75256731-75256753 TTTTTATTTTTCCTGAGACAAGG + Intergenic
957134921 3:76274534-76274556 CTGCTATATTTCTTGAAACTAGG - Intronic
957329323 3:78740475-78740497 TTTCTTTTTTTTTTGAAACAGGG + Intronic
957695530 3:83634052-83634074 TTTCTGTTATTCATGAGACAGGG - Intergenic
957697439 3:83658911-83658933 TTGCTGTTGTTGATGAGACAGGG + Intergenic
957715724 3:83927933-83927955 TTGTGATTTTTCTAGAAACAGGG + Intergenic
957826021 3:85445234-85445256 TTGCAATTTTTCATTAAACTAGG + Intronic
957987095 3:87586677-87586699 TTTCTTTTTTTTTTGAAACAAGG + Intergenic
958656786 3:97012321-97012343 TTGCTTTTTTTTTTGAGACAGGG + Intronic
959542168 3:107552336-107552358 TTTTTTTTTTTAATGAAACAGGG - Intronic
959706051 3:109339739-109339761 TTTGTCTTTTTCTTGAAACAAGG - Intergenic
960132866 3:114076171-114076193 TACTTATTTTTCTTGAAACATGG + Intronic
960256283 3:115514723-115514745 TAGCAATTTTTAATGAAAAAGGG + Intergenic
961139049 3:124540091-124540113 TTTGTATTTTTTATGAGACAGGG + Intronic
962140905 3:132789886-132789908 CTGTCATTTTTCTTGAAACAGGG + Intergenic
962355572 3:134691440-134691462 TTGCTATTTTTGTAGAGACAGGG - Intronic
962706825 3:138051691-138051713 TTCCTTTTTTTTTTGAAACAGGG - Intergenic
962770642 3:138607885-138607907 GTGTTTTTTTTAATGAAACAGGG + Intergenic
963183834 3:142390904-142390926 TTGCTATGTCTCATGGAATAGGG + Intronic
963279904 3:143373926-143373948 TTGATATTTTTCATCAAATTCGG - Intronic
963341415 3:144039223-144039245 TTTGTTTTTTTCAAGAAACAGGG + Intronic
963709807 3:148734317-148734339 TAGTTATTTTGGATGAAACAAGG + Intronic
963818621 3:149862954-149862976 TTCATTTATTTCATGAAACAGGG - Intronic
963868083 3:150384575-150384597 TTGTTATTTTTTCTGAGACAGGG - Intergenic
964260659 3:154832334-154832356 CTGCTATTTTTCACTCAACAAGG + Intergenic
964411815 3:156405684-156405706 TTGCTTTTTTTCATTTAACATGG + Intronic
964591092 3:158362332-158362354 TTTCTATTTTTTTTGAGACAGGG - Intronic
966093784 3:176173243-176173265 TTTGTATTTTTGAGGAAACAGGG - Intergenic
966330676 3:178809347-178809369 TTGCTACTTTTTATGAACAAAGG + Intronic
966703207 3:182879249-182879271 TTTCTCTTTTTTGTGAAACAGGG - Intronic
966749751 3:183310654-183310676 TTCCTTTTTTTTTTGAAACAGGG - Intronic
967906940 3:194509288-194509310 TTGTTTTTTTTCCTGAGACAGGG + Intergenic
968314755 3:197714337-197714359 TTGCTTTTTTTGTTGAGACAGGG + Intronic
968316945 3:197732887-197732909 TTGCTAGTTTTTTTGAAATAAGG - Intronic
970552063 4:17192101-17192123 TTCCTTATTTTCATGAAAAAGGG - Intergenic
971658956 4:29387526-29387548 TTGCAAGTTTTCTTGAAAGAAGG + Intergenic
971741099 4:30522673-30522695 CTGCCATTTTTCTTGAAAGATGG + Intergenic
971854031 4:32020850-32020872 TTGCTTTTTTTAATGTAGCATGG - Intergenic
971881378 4:32378881-32378903 TTCATATTTCTCATGAAACACGG - Intergenic
971901740 4:32669016-32669038 TTGTTATTTTTTGTGAAATATGG + Intergenic
971936143 4:33150196-33150218 TTGATGTATTTCAAGAAACACGG - Intergenic
972226100 4:37014212-37014234 GTGCTATTTGTAATGAAATATGG + Intergenic
972370051 4:38414827-38414849 TTGCTATTTTTCATGGGGGAGGG - Intergenic
972483931 4:39525000-39525022 TTGCTATTTCCCATGAAATACGG + Intronic
975514856 4:75235465-75235487 TGGCCATTTTTCATTAACCATGG + Intergenic
975991126 4:80261438-80261460 TTTTTTTTTTTTATGAAACAGGG - Intergenic
976209486 4:82653145-82653167 TTTCTCTTTTTCTGGAAACAGGG - Intronic
976313772 4:83637798-83637820 TTTCTTTTTTTTTTGAAACAGGG + Intergenic
976986896 4:91312489-91312511 TTGGTATGTTTCATGAAAGCAGG - Intronic
978044659 4:104111854-104111876 TTTTTTTTTTTCTTGAAACAGGG + Intergenic
978187860 4:105878985-105879007 TTATTATTTTTAATGAAATAGGG - Intronic
978548984 4:109903781-109903803 TTTTTTTTTTTCTTGAAACAAGG - Intergenic
978798517 4:112732254-112732276 TTTTTTTTTTTCAAGAAACAGGG + Intergenic
979750021 4:124267697-124267719 TTTCTTTTTTTCTTGAGACAGGG - Intergenic
979849323 4:125556717-125556739 TTGGTATTTTTTCTCAAACAGGG + Intergenic
980122342 4:128741032-128741054 TTCCTATTTTTGAAGAGACAGGG - Intergenic
980221321 4:129919664-129919686 TTGCTATATATCAGGAAATAAGG - Intergenic
980704175 4:136471513-136471535 TTGATACTTTTCTTGAAATATGG - Intergenic
981094384 4:140763172-140763194 TGACTATTTGTCATCAAACAGGG + Intergenic
981505928 4:145499606-145499628 TTTCTTTTTTTCTTGAGACATGG - Intronic
981903624 4:149894282-149894304 TTTCTTTTTTTTATGAGACAGGG - Intergenic
981953085 4:150434849-150434871 TTTTTTTTTTTCTTGAAACAAGG - Intronic
982362189 4:154530859-154530881 TATATATTTCTCATGAAACAAGG - Intergenic
982381638 4:154755243-154755265 TTGCAATTTTAAATGAAAGACGG - Intergenic
982741616 4:159062675-159062697 TTGCATTTTTTTTTGAAACAGGG + Intergenic
984284386 4:177710313-177710335 TTGCTATCTTTCAAGATATAAGG + Intergenic
984620087 4:181942740-181942762 TTGCTTTGTTTCATGAAATGAGG + Intergenic
986010918 5:3714376-3714398 TTTCCACTTTTCATGAAACCTGG + Intergenic
986116738 5:4782582-4782604 TTACTATTTTTTTTGAGACAAGG + Intergenic
986206928 5:5633475-5633497 TAGGTATTTGTCATAAAACAAGG + Intergenic
986279965 5:6314827-6314849 CTGCTCTTCTTCATGAAACTCGG - Intergenic
986577431 5:9227215-9227237 TTCATATTTTTTATCAAACAAGG - Intronic
987091887 5:14515412-14515434 TTTATATTTTTAGTGAAACAGGG + Intronic
987920879 5:24278831-24278853 TTAGTATTTTTCATCAAACTAGG + Intergenic
987960509 5:24802643-24802665 ATGCTATTTTACATGACAAAAGG - Intergenic
988446526 5:31291983-31292005 TTGCTGTGTTACATTAAACACGG + Intronic
989049298 5:37303513-37303535 TTGCTTGTTTTCATAAAACAAGG - Intronic
989247957 5:39275044-39275066 TTTCTACTTTTAATGAAAGAGGG + Intergenic
989748846 5:44866502-44866524 CTTATATTTTTCATGAAAAATGG - Intergenic
990175798 5:53106832-53106854 TTGATATGTTTCATTTAACATGG - Intronic
990434529 5:55774841-55774863 TTAATAGTTTTCATGAAACTTGG + Intronic
990894006 5:60677541-60677563 TTTCTTTTTTTTATGAGACAAGG + Intronic
991171601 5:63633036-63633058 TTGCCATGTTTCAGGAAATAGGG + Intergenic
991208434 5:64076793-64076815 TTGCTATGTTTGATCAAGCAAGG - Intergenic
991327081 5:65445849-65445871 TTTCTTTTTTTCTTGAGACAGGG - Intronic
991734675 5:69620902-69620924 TTTCTATTTTTTTTGAGACATGG + Intergenic
991780303 5:70125819-70125841 TTTCTATTTTTTTTGAGACATGG - Intergenic
991811109 5:70476043-70476065 TTTCTATTTTTTTTGAGACATGG + Intergenic
991859590 5:71001233-71001255 TTTCTATTTTTTTTGAGACATGG - Intronic
991872750 5:71126130-71126152 TTTCTATTTTTTTTGAGACATGG - Intergenic
991950414 5:71941968-71941990 TTATTATTTTTTTTGAAACAGGG - Intergenic
992480400 5:77145856-77145878 GTGCTACTTTTCATGAAAAAAGG + Intergenic
992691246 5:79242413-79242435 TTCCCTTTTTTCATGTAACAAGG + Intronic
993272688 5:85815469-85815491 TTGCTATTTCACATGAGAGAGGG + Intergenic
993644773 5:90449022-90449044 TTTTTTTTTTTCCTGAAACAGGG + Intergenic
994595160 5:101823312-101823334 TTGCTCTTTTTCCTGAAGCTAGG + Intergenic
994942169 5:106338682-106338704 ATTCTATTTTCCATGAAACTAGG - Intergenic
994953248 5:106493519-106493541 TTAATATTTTTCATTAGACAGGG - Intergenic
995631483 5:114138062-114138084 TTGATATTTTTCACCAAACATGG + Intergenic
995649714 5:114356860-114356882 TTGTTATGTTTCCAGAAACATGG + Intergenic
995789714 5:115872273-115872295 TTTCTATTTTTTTTGAGACAGGG - Intronic
996261143 5:121470689-121470711 TTTATATTTTTCATCAAATATGG + Intergenic
996333777 5:122360947-122360969 TCACTATTTACCATGAAACATGG - Intronic
996815460 5:127568791-127568813 TTCCTTTTTTTTATGAAACAAGG - Intergenic
996887276 5:128372496-128372518 TTTCTATTTTTTTTGAGACAGGG + Intronic
997123357 5:131199282-131199304 TTGCTATATTTAATGATAAAGGG + Intronic
998744346 5:145240239-145240261 TTTCTTTTTTTCATCAGACAGGG + Intergenic
999109940 5:149110406-149110428 TTGCTTTGTTTCATGAGAGAAGG - Intergenic
999204962 5:149841237-149841259 TTGCTCCTTTTCATCAATCAGGG - Intronic
1000212776 5:159123026-159123048 TGACTATTTTTTTTGAAACACGG - Intergenic
1000409196 5:160919968-160919990 TTTCTGTTTGTCAAGAAACAGGG + Intergenic
1000627300 5:163553806-163553828 TTGCTGTTTTTTTTGAGACAGGG - Intergenic
1000796041 5:165666255-165666277 TTGCTATTTCCCATGATAAAGGG - Intergenic
1000837115 5:166168849-166168871 TTTCTATTTTGCAAGATACAGGG + Intergenic
1000869715 5:166560629-166560651 TTGCTATTTTTCATCACATTTGG - Intergenic
1001609801 5:172991123-172991145 TTGAAATTGTTCATGAAAAAAGG - Intronic
1002513323 5:179737813-179737835 TTTCCTTTTTTCTTGAAACAGGG + Intronic
1002530616 5:179842353-179842375 TTGCTATTTTTTATAAGACTGGG - Intronic
1002923560 6:1591299-1591321 TTGTTGTTTTTCTTGAGACAGGG - Intergenic
1002934350 6:1659100-1659122 CTGCTATTCCTCATGAACCATGG + Intronic
1003636562 6:7836976-7836998 TTGAAATTTTTTTTGAAACATGG - Intronic
1003905652 6:10697182-10697204 TTGATAGTTTTCATGAATCGTGG + Intronic
1003905654 6:10697239-10697261 CTGGTAGTTTTCATGAATCACGG - Intronic
1004098091 6:12579604-12579626 TTGCAATTTTTTTTGAGACAGGG + Intergenic
1004321710 6:14636415-14636437 TTGCGATTGTTCCTGACACATGG - Intergenic
1004712123 6:18181737-18181759 TTACTTTTCTTCTTGAAACAGGG - Intronic
1004885534 6:20048215-20048237 TGGCTTTTTTTTTTGAAACAGGG - Intergenic
1005113290 6:22309767-22309789 TTGCTATATTTTATGTGACATGG - Intergenic
1005602433 6:27441385-27441407 TTGTAATTTTTCTAGAAACAGGG + Intergenic
1006240083 6:32670071-32670093 TTGCTGTTTTGCATGAACCATGG - Intergenic
1007438945 6:41841006-41841028 TTGTTTTTTTTTTTGAAACAAGG - Intronic
1007561559 6:42813026-42813048 TTACTAATTTTCTTGAGACAGGG - Intronic
1008146367 6:47896431-47896453 TTGCTGTTTTCCATGAAGAAGGG + Intronic
1008503824 6:52209566-52209588 TTTATTTTTTTCATGAGACAGGG - Intergenic
1008912414 6:56749553-56749575 TCACTTTTTTTCATGAAAAATGG - Intronic
1009054753 6:58321309-58321331 TTCCTATTATTTATTAAACAGGG - Intergenic
1009389366 6:63127122-63127144 TTGACATTTTTCATGATAAAAGG + Intergenic
1009459826 6:63899245-63899267 TTGCTAATTCTCAGAAAACAGGG - Intronic
1009576532 6:65469650-65469672 TTTGTATTTTTCAAGAAAGAGGG + Intronic
1009758355 6:67971018-67971040 TTGCTATTTTATATGCTACAAGG - Intergenic
1010094576 6:72026179-72026201 TTGCTGTTTTTCTTGAAATGTGG - Intronic
1010430880 6:75777432-75777454 TTTCTTTTTTTTTTGAAACAGGG + Intronic
1010841790 6:80654953-80654975 TTGCTAGTTATCATGCAAGAGGG + Intergenic
1011282773 6:85693190-85693212 TTCCTATTGTGCATTAAACATGG + Intergenic
1011762263 6:90580230-90580252 TTGATATTTTTCTTGACATATGG + Intronic
1012107648 6:95184588-95184610 TATCAATTTTTCATAAAACATGG + Intergenic
1012154188 6:95795803-95795825 TTTCTATTTCTCATAAAATAGGG + Intergenic
1012896477 6:104955380-104955402 TTGTTATTTCTCAGGAAAAAGGG - Intergenic
1013430754 6:110052919-110052941 TGGCTCTTTTTAAAGAAACAGGG + Intergenic
1013535592 6:111060504-111060526 TTGTTGTTTTTTAGGAAACAGGG - Intergenic
1013547350 6:111171128-111171150 TTTCTTTTTTTAATGAGACAGGG - Intronic
1013681001 6:112526255-112526277 TTTCCATTTTTCATTAATCAAGG + Intergenic
1013758251 6:113485558-113485580 TTGCAATTTTGTATGATACATGG + Intergenic
1014022782 6:116610247-116610269 TTCCTCTTTTTCCTGAGACAAGG + Intergenic
1014316717 6:119875836-119875858 CTGCTATTTGTCATGAAGTAGGG - Intergenic
1015162473 6:130168807-130168829 TTTCTTTTTTTCTTGAGACAGGG + Intronic
1015329877 6:131964560-131964582 TTTTTTTTTTTCTTGAAACAGGG + Intergenic
1015628235 6:135204303-135204325 TTGCTTTGTTTTTTGAAACAGGG + Intronic
1015948891 6:138531523-138531545 TTTTTTTTTTTCCTGAAACAGGG + Intronic
1016173227 6:141045777-141045799 TTGCTGGTTATAATGAAACATGG - Intergenic
1016257875 6:142130756-142130778 TTTCTTTTTTTAATGAAAAAGGG + Intergenic
1016320716 6:142842653-142842675 TTGCAGTCTTTCAGGAAACAAGG - Intronic
1017355599 6:153503617-153503639 TTGCCATTTATCATGATACTGGG + Intergenic
1017929713 6:158941260-158941282 TTTCTTTTTTTCTTGAGACAGGG - Intergenic
1019004061 6:168781499-168781521 TTGATATTCTCCACGAAACAGGG + Intergenic
1019116695 6:169770624-169770646 TTATTATTTTTTATGAGACAGGG + Intronic
1019698512 7:2461017-2461039 TTACTCTTTTTTATTAAACAAGG - Intergenic
1019817850 7:3214255-3214277 TTGCTTTTTTTTTTGAGACAGGG - Intergenic
1019948642 7:4351274-4351296 TTGTCATTTTTCAAGAAACTTGG + Intergenic
1020544326 7:9504824-9504846 TTGAAATTTTTCATTAAACTTGG - Intergenic
1020583308 7:10032699-10032721 TTGCTATTATTCACAAAAAAGGG + Intergenic
1020755538 7:12197888-12197910 TTGCTTTTTTTTTGGAAACAGGG + Intergenic
1020908091 7:14091196-14091218 TTGCTTTATTTCATGGAAGAAGG + Intergenic
1020969522 7:14918055-14918077 TTGAGATTTTTCATGAAGAATGG - Intronic
1021570580 7:22060750-22060772 TTGCTAGTGTACATGACACACGG + Intergenic
1022238917 7:28490268-28490290 TTGCAATTTTCCATGAAGGAAGG + Intronic
1022651022 7:32274872-32274894 TTGATATGGTTCATAAAACAAGG + Intronic
1022692947 7:32675682-32675704 TTACTATTTTTTTTGAGACAGGG - Intergenic
1023042227 7:36181762-36181784 TTGTAATTTTCCATGAAAAAGGG - Intronic
1023138614 7:37078709-37078731 GTGCTATTTCTCATGAAAAAAGG + Intronic
1023736927 7:43243581-43243603 TTTTTCTTTTTCAAGAAACAAGG - Intronic
1023846859 7:44126479-44126501 TTTCTTTTTTTTTTGAAACAAGG + Intergenic
1023898390 7:44454034-44454056 TTATTATTTTTTTTGAAACAAGG - Intronic
1023916788 7:44595966-44595988 TTGTTTTTTTTCTTGAGACAGGG - Intergenic
1023976581 7:45034842-45034864 TTTTTATTTTTCTTGAGACAAGG + Intronic
1024019933 7:45359586-45359608 ATGCTATTTTTCAGGAGAGAAGG + Intergenic
1026112978 7:67473170-67473192 TTTCTATTTTTTAAGAGACAGGG + Intergenic
1026124258 7:67565684-67565706 TTATTATTTTTTATGAGACAGGG + Intergenic
1026316130 7:69229252-69229274 TTGCTCTTTTTTTTGGAACAAGG + Intergenic
1026917751 7:74132215-74132237 TTTTTTTTTTTCATGAGACAGGG - Intergenic
1027476488 7:78638054-78638076 TTTATTTTTTTCTTGAAACAGGG - Intronic
1027539481 7:79451269-79451291 TTGATATTTGTCATGGAACGTGG - Intronic
1028149267 7:87353152-87353174 TTTCTTTTTTTTTTGAAACATGG + Intronic
1029091661 7:98053139-98053161 TTTTTATTTTTTAAGAAACAAGG + Intergenic
1029471924 7:100760039-100760061 TTTCTATTTTTTAAGAGACAGGG - Intronic
1029696770 7:102218679-102218701 TTGATTTTTTTCTTGAGACATGG - Intronic
1029855633 7:103514245-103514267 TTGTTATACTACATGAAACATGG - Intronic
1029862454 7:103587612-103587634 TTGCAACTTTTCATCCAACAAGG + Intronic
1030014927 7:105209529-105209551 TTTCTTTTTTTCCTGAGACAGGG - Intronic
1030468133 7:109928373-109928395 TTGTTATTTTATATAAAACAAGG - Intergenic
1030502608 7:110378889-110378911 TTACTGTTTTTCATGAAAACTGG + Intergenic
1030945537 7:115715329-115715351 TTGCTATTTTTTAAAACACATGG + Intergenic
1031826585 7:126573375-126573397 TAGCATTTTTTAATGAAACAGGG + Intronic
1032172626 7:129598198-129598220 TTGTTTTTTTTCTTGACACAGGG + Intergenic
1032832977 7:135647286-135647308 TTGCTATTTTTCTTAAAACAAGG + Intronic
1033511713 7:142065966-142065988 TTGTTTTTTTTTTTGAAACAGGG + Intronic
1033797772 7:144868578-144868600 TTGTTATTTTTTTTGAAATAGGG + Intergenic
1034254635 7:149717830-149717852 TTTTTGTTTTTCTTGAAACAGGG + Intronic
1034649519 7:152678712-152678734 TTGCTAGCTTTCTTGTAACAAGG + Intergenic
1034738162 7:153448027-153448049 TTGCTATTTTTAATGAAAAACGG - Intergenic
1034787692 7:153940549-153940571 TTTCTGTGTGTCATGAAACATGG - Intronic
1036194245 8:6700077-6700099 TTTTTATTTTTTATGATACAGGG - Intergenic
1036831281 8:12022327-12022349 TTTTTTTTTTTCATGAAGCACGG - Intergenic
1036896708 8:12641996-12642018 TTCCTTTCTTCCATGAAACAAGG - Intergenic
1037150948 8:15634484-15634506 TTGATATTTTGCATGAAAGCTGG + Intronic
1037172440 8:15909205-15909227 TTGCTACTTGTCATGAGAGAAGG - Intergenic
1037411508 8:18603508-18603530 TTGGAATTTTTAATGAAATAAGG - Intronic
1037465911 8:19160565-19160587 TTGATGTTGTTCATAAAACAGGG + Intergenic
1037534121 8:19809187-19809209 TTGCTATTTTTTTTAAGACAGGG + Intergenic
1037964478 8:23123339-23123361 TAGATATTTTTGATGAGACAGGG - Intergenic
1038125437 8:24668242-24668264 TTCCAATTTTTCATGGAGCAGGG + Intergenic
1038140256 8:24837398-24837420 TTGCTATTTTTCTTTAAATTTGG + Intergenic
1038159885 8:25026408-25026430 TTGTTGTTTTTCTTGAGACAGGG - Intergenic
1038825950 8:31002488-31002510 TTTTTATTTTTCTTGAGACAGGG + Intronic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041031905 8:53745389-53745411 TTGTTTTTTTTTAAGAAACAGGG - Intronic
1041592085 8:59599936-59599958 TTGCAATTTTTAAAGAAATATGG - Intergenic
1041731363 8:61066489-61066511 TTTCTTTTTTTCTTGAGACAGGG - Intronic
1041872847 8:62654776-62654798 AGGCTTTTTTCCATGAAACAAGG + Intronic
1041929627 8:63272607-63272629 TTTCTTTTTTTTTTGAAACAGGG + Intergenic
1042126408 8:65541596-65541618 TAGCTATTTCTTATGAAACAAGG - Intergenic
1042907489 8:73786655-73786677 TTGCTACTGCTTATGAAACAAGG + Intronic
1043000878 8:74758493-74758515 TTACTTTTTTTTTTGAAACATGG + Intronic
1043019900 8:74987155-74987177 TAGATAATTTTCATGAAGCATGG + Intronic
1043431039 8:80195512-80195534 TTGTTGTTTTTCATGAGACAGGG + Intronic
1043481555 8:80657682-80657704 TTTTTTTTTTTCTTGAAACAGGG - Intronic
1043553198 8:81398912-81398934 GTGCAATTTCTCATGGAACATGG - Intergenic
1044002719 8:86904444-86904466 TTGGTATTTGCCATGAATCAAGG + Intronic
1044081553 8:87891860-87891882 TTTTTTTTTTTCCTGAAACAGGG + Intergenic
1044406599 8:91833937-91833959 TTGCTATGTGTCATGAAAAGGGG + Intergenic
1044476696 8:92634903-92634925 TACTTATTTTTCATGCAACATGG - Intergenic
1044575063 8:93759454-93759476 TTTTTTTTTTTCATGAGACAGGG - Intronic
1044888649 8:96808199-96808221 TAGCTATATTTTATGAAAAATGG + Intronic
1045697557 8:104827211-104827233 GTGCTATTTTTATTGAAACGTGG + Intronic
1045860179 8:106807704-106807726 TTGAGATTTTTCATGAAGGATGG - Intergenic
1046697011 8:117352340-117352362 TTTCCTTTTTTCTTGAAACACGG - Intergenic
1046762988 8:118040804-118040826 TTGCTGCTTTTTATTAAACAAGG - Intronic
1047025358 8:120817712-120817734 TTGCCCTTTCTCATGAATCAAGG - Intergenic
1048489090 8:134875412-134875434 TTTTTTTTTTTCCTGAAACAGGG + Intergenic
1049715895 8:144091630-144091652 TTCATGTTTTTCATGAAACATGG + Intergenic
1049953360 9:667901-667923 TTTGTATTTTTAATGAGACAGGG + Intronic
1051462690 9:17340136-17340158 TTTTTATTTTTCTGGAAACAGGG - Intronic
1052171752 9:25407083-25407105 TTTCTTTTTTTTTTGAAACAAGG - Intergenic
1052568505 9:30189695-30189717 TAGCTCATTTTCATGAAGCAAGG + Intergenic
1052845028 9:33328015-33328037 TTGTTATTTGTTTTGAAACAGGG + Intronic
1054715307 9:68551526-68551548 TTTTTATTTTTCTTGAGACAAGG + Intergenic
1054824339 9:69557121-69557143 ATACTATTATTCATAAAACATGG + Intronic
1055154878 9:73049936-73049958 ATGCTTTTTTTCATGACACTCGG + Intronic
1056163845 9:83923174-83923196 TTCCTATATTTCATGAGAGAAGG - Intergenic
1056545686 9:87611463-87611485 TTGGTTTTTTTCTTGAGACAGGG + Intronic
1056624384 9:88242550-88242572 TTGCTACTGTTAATGAAAAATGG + Intergenic
1058499371 9:105594734-105594756 TTACTATTATTAATGAGACAGGG - Intronic
1058903463 9:109461748-109461770 TTTTTTTTTTTCCTGAAACAAGG - Intronic
1060140626 9:121206709-121206731 TTTTTTTTTTTCATGTAACATGG - Intronic
1203431864 Un_GL000195v1:98048-98070 TTTGTATTTTTCATGAAGCTGGG + Intergenic
1185881613 X:3746369-3746391 TTTCTCTTTTTCTTGAGACAGGG + Intergenic
1186608795 X:11118768-11118790 TTGCTATTTTTCAACTAAGAAGG - Intronic
1188256498 X:27967379-27967401 ATGCTGTTTTACATTAAACAGGG + Intergenic
1188378207 X:29459160-29459182 TTGCTATTATTCTTGAAGCCTGG + Intronic
1188542833 X:31268417-31268439 TTGCTATTTTTAAGCAAATATGG + Intronic
1188958404 X:36461915-36461937 TGTCTATTTTTTATGAAAGAAGG + Intergenic
1189417791 X:40830456-40830478 TTTCTTTTTTTTTTGAAACAGGG + Intergenic
1189481959 X:41398940-41398962 TTTCCATTTTTAATGAGACAAGG + Intergenic
1189897213 X:45667986-45668008 TTTTTTTTTTTTATGAAACAAGG - Intergenic
1190016151 X:46828979-46829001 TTTCTTTTTTTCCTGAGACAGGG - Intergenic
1190404814 X:50076527-50076549 TTGTTTTTTTTCTTGAGACAGGG + Intronic
1190423199 X:50306663-50306685 GTGCTTTTTATCATGAAAGAGGG + Intronic
1192136006 X:68601100-68601122 TTTCTTTTTTTCTTGAGACAGGG - Intergenic
1195784236 X:108501186-108501208 TTGCTATAATTCATAATACATGG + Intronic
1196278783 X:113798668-113798690 TTTGTATTTTTCATAAAACTAGG + Intergenic
1197186898 X:123597650-123597672 TTTCTGTTTTTTTTGAAACAGGG - Intergenic
1198246559 X:134837506-134837528 TTTCCATTTTTCAGGATACATGG - Intronic
1198472143 X:136957128-136957150 TTTTTTTTTTTCTTGAAACAGGG + Intergenic
1198581510 X:138070183-138070205 TTATTATTTTTTATGAAATATGG + Intergenic
1198740431 X:139836153-139836175 TTACTCTTTATCCTGAAACAGGG - Intronic
1199053044 X:143259983-143260005 TTGATTTTATTCATGAAAAATGG - Intergenic
1199060437 X:143350150-143350172 CTGGTCTCTTTCATGAAACATGG + Intergenic
1199509028 X:148598848-148598870 TAGTTATTTTTCATGATAAATGG - Intronic
1199704574 X:150412719-150412741 TTGTTTTTTTTAATGAAACAGGG + Intronic
1201700358 Y:16874525-16874547 TTTCTATTTTTGAAGAGACAGGG + Intergenic